Klebsiella pneumoniae bacteriophage with splitting property and application thereof

Abstract

The invention relates to a klebsiella pneumoniae bacteriophage with a splitting effect and application thereof. The klebsiella pneumoniae bacteriophages phi KpJH-1, phi Kp122 and phi Kp154 are successfully obtained by the inventor. Experiments show that the bacteriophage disclosed by the invention has an excellent bactericidal effect and good stability. The bacteriophage can be used for preparing medicines, cleaning agents or disinfectants for treating infectious diseases caused by klebsiella pneumoniae.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a Klebsiella pneumoniae phage with lytic effect and its application fields. Background Art

[0002] Klebsiella pneumoniae is an important Gram-negative opportunistic pathogen, which can cause various infectious diseases, including urinary tract infections, bacteremia, pneumonia and liver abscesses, and is one of the important pathogenic bacteria isolated clinically and in hospital infections. With the emergence of multi-drug resistant and highly pathogenic Klebsiella pneumoniae strains, the rapid geographical spread of these clinical strains is particularly worrying. The hospital infection rate caused by Klebsiella pneumoniae has been increasing year by year recently, and the continuous increase of multi-drug resistant strains often leads to the failure of clinical antibacterial drug treatment and the prolongation of the disease course. Therefore, there is an urgent need for a new type of drug to replace antibiotics for treatment.

[0003] Bacteriophage (phage) is a virus that invades bacteria. Bacteriophages are widely distributed. Their special feature is that they specifically use bacteria as hosts. Like other viruses, bacteriophages are just a mass of genetic material wrapped in a protein coat. Most bacteriophages also have a "tail" used to inject genetic material into the host cell. Compared with antibiotics, bacteriophages have strong specificity, rapid proliferation ability, low preparation cost, easy operation, safety and reliability. In recent years, Klebsiella pneumoniae phages isolated have been used in clinical treatment and achieved remarkable progress.

[0004] Therefore, there is an urgent need in this field to develop a disinfectant with good bactericidal effect, good storage stability and environmental friendliness to replace antibiotics. Summary of the Invention

[0005] In the first aspect of the present invention, a Klebsiella pneumoniae phage ΦKpJH-1 is provided, and the preservation number of the phage is GDMCC NO: 63990-B1.

[0006] In another preferred example, the phage belongs to the family Podoviridae.

[0007] In another preferred example, the phage has acidophobia and basophilia.

[0008] In another preferred example, the optimal temperature of the phage is -20 to 60 °C.

[0009] In another preferred example, the optimal pH of the phage is 5 to 11.

[0010] In another preferred example, the phage is used to prepare a drug for treating infectious diseases caused by Klebsiella pneumoniae infection.

[0011] In another preferred example, the Klebsiella pneumoniae is Klebsiella pneumoniae Kp25615.

[0012] In another preferred example, the phage is used for preparing a cleaning agent or a disinfectant.

[0013] In the second aspect of the present invention, there is provided a Klebsiella pneumoniae phage ΦKp122, and the preservation number of the phage is GDMCC NO: 63989-B1.

[0014] In another preferred example, the phage belongs to the Myoviridae family.

[0015] In another preferred example, the phage has acid fear and alkali preference.

[0016] In another preferred example, the optimal temperature of the phage is -20 to 50 °C.

[0017] In another preferred example, the optimal pH of the phage is 5 to 10.

[0018] In another preferred example, the phage is used for preparing a drug for treating infectious diseases caused by Klebsiella pneumoniae infection.

[0019] In another preferred example, the Klebsiella pneumoniae is Klebsiella pneumoniae Kp2107613.

[0020] In another preferred example, the phage is used for preparing a cleaning agent or a disinfectant.

[0021] In the third aspect of the present invention, there is provided a Klebsiella pneumoniae phage ΦKp154, and the preservation number of the phage is CCTCC NO: M 20232152.

[0022] In another preferred example, the phage belongs to the Myoviridae family.

[0023] In another preferred example, the phage has acid fear and alkali preference.

[0024] In another preferred example, the optimal temperature of the phage is -20 to 60 °C.

[0025] In another preferred example, the optimal pH of the phage is 6 to 9.

[0026] In another preferred example, the phage is used for preparing a drug for treating infectious diseases caused by Klebsiella pneumoniae infection.

[0027] In another preferred example, the Klebsiella pneumoniae is Klebsiella pneumoniae Kp13869.

[0028] In another preferred example, the phage is used for preparing a cleaning agent or a disinfectant.

[0029] The phage according to any one of the first, second, and third aspects of the present invention has one or more of the following characteristics:

[0030] (c1) The head has a regular polyhedron structure;

[0031] (c2) It is stable at -20 to 60 °C;

[0032] (c3) It is stable under the condition of pH = 5 to 11;

[0033] (c4) It has a bactericidal effect on Klebsiella pneumoniae.

[0034] In another preferred example, the bactericidal rate of the phage is ≥ 95%, preferably ≥ 97%, more preferably ≥ 99%.

[0035] In the fourth aspect of the present invention, there is provided a pharmaceutical composition, which comprises:

[0036] (a) A phage mixture, which is selected from the phages according to any one of the first, second, and third aspects of the present invention or two or more phages, and

[0037] (b) A pharmaceutically acceptable carrier.

[0038] In another preferred example, the pharmaceutical composition is used for preparing a pharmaceutical composition for treating infectious diseases caused by Klebsiella pneumoniae infection.

[0039] In another preferred example, the strain numbers of the Klebsiella pneumoniae are Kp13869, Kp2107613, and Kp25615.

[0040] In the fifth aspect of the present invention, there is provided a cleaner or disinfectant, which comprises the phage according to any one of the first, second, and third aspects of the present invention.

[0041] In another preferred example, the cleaner or disinfectant is used for lysing Klebsiella pneumoniae.

[0042] In another preferred example, the strain numbers of the Klebsiella pneumoniae are Kp13869, Kp2107613, and Kp25615.

[0043] In the sixth aspect of the present invention, there is provided a method for lysing Klebsiella pneumoniae, which comprises the step of:

[0044] Contacting the phage according to any one of the first, second, and third aspects of the present invention with Klebsiella pneumoniae, thereby lysing Klebsiella pneumoniae.

[0045] In another preferred example, the strain numbers of Klebsiella pneumoniae are Kp13869, Kp2107613, and Kp25615.

[0046] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1A The streak plate diagram of the ΦKp154 host strain Kp13869 is shown.

[0048] Figure 1B The streak plate diagram of the ΦKp122 host strain Kp2107613 is shown.

[0049] Figure 1C The streak plate diagram of the ΦKpJH-1 host strain Kp25615 is shown.

[0050] Figure 2A The plating diagram of ΦKp154 is shown.

[0051] Figure 2B The plating diagram of ΦKp122 is shown.

[0052] Figure 2C The plating diagram of ΦKpJH-1 is shown.

[0053] Figure 3A The transmission electron micrograph of ΦKp154 is shown.

[0054] Figure 3B The transmission electron micrograph of ΦKp122 is shown.

[0055] Figure 3C The transmission electron micrograph of ΦKpJH-1 is shown.

[0056] Figure 4A The temperature stability of ΦKp154 is shown.

[0057] Figure 4B The temperature stability of ΦKp122 is shown.

[0058] Figure 4C The temperature stability of ΦKpJH-1 is shown.

[0059] Figure 5A The pH stability of ΦKp154 is shown.

[0060] Figure 5B The pH stability of ΦKp122 is shown.

[0061] Figure 5C Shows the pH stability of ΦKpJH-1.

[0062] Figure 5A Shows the pH stability of ΦKp154.

[0063] Figure 5B Shows the pH stability of ΦKp122.

[0064] Figure 5C Shows the pH stability of ΦKpJH-1.

[0065] Figure 6A Shows the streak plate diagram indicating the host Kp2021447.

[0066] Figure 6B Shows the streak plate diagram indicating the host Kp2107613.

[0067] Figure 6C Shows the streak plate diagram indicating the host Kp25615. Detailed implementation mode

[0068] Through extensive and specific research, the present inventors unexpectedly obtained Klebsiella pneumoniae phages ΦKp154, ΦKp122, and ΦKpJH-1 for the first time. The above phages can effectively lyse Klebsiella, and the bacteriostatic rate is over 95%. Therefore, they can be developed into disinfectants for inhibiting Klebsiella pneumoniae. In addition, the above phages can be used in combination and have good stability. Based on this, the present invention was completed.

[0069] Terms

[0070] As used herein, the terms "ΦKpJH-1", "phage KpJH-1", and "JH-1" can be used interchangeably and all refer to the phage deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC, China, Guangzhou) on November 9, 2023, with the deposit number GDMCC NO: 63990-B1.

[0071] As used herein, the terms "ΦKp122", "phage Kp122", and "Kp122" can be used interchangeably and all refer to the phage deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC, China, Guangzhou) on November 9, 2023, with the deposit number GDMCC NO: 63989-B1.

[0072] As used herein, the terms "ΦKp154", "phage Kp154", and "Kp154" are used interchangeably and all refer to the phage deposited at the China Center for Type Culture Collection (Wuhan University) on November 8, 2023, with the deposit number CCTCC NO: M 20232152.

[0073] In the present invention, the term "the phage of the present invention" refers to phage ΦKpJH-1, ΦKp122, ΦKp154, or a combination thereof.

[0074] Phage source, isolation, and culture

[0075] All the phages of the present invention were isolated by the inventors from domestic sewage in the Shanghai area.

[0076] The phages of the present invention and their host bacteria were aerobically cultured in LB medium at 37°C.

[0077] Phage ΦKpJH-1

[0078] The plaque diameter of phage ΦKpJH-1 (Klebsiella pneumoniae phage ΦKpJH-1) is 2 mm, circular and transparent, without a halo. Observed through an electron microscope, its head has a regular polyhedron structure, belonging to the Podoviridae family, and the full-length genome is 40,251 bp. Phage ΦKpJH-1 was deposited at the Guangdong Microbial Culture Collection Center (GDMCC, China, Guangzhou) on November 9, 2023, with the deposit number GDMCC NO: 63990-B1.

[0079] Phage ΦKp122

[0080] The plaque diameter of phage ΦKp122 (Klebsiella pneumoniae phage ΦKp122) is 5 mm, circular and transparent, without a halo. Observed through an electron microscope, its head has a regular polyhedron structure, belonging to the Myoviridae family, and the full-length genome is 40,349 bp. Phage ΦKp122 was deposited at the Guangdong Microbial Culture Collection Center (GDMCC, China, Guangzhou) on November 9, 2023, with the deposit number GDMCC NO: 63989-B1.

[0081] Phage ΦKp154

[0082] The plaque diameter of the phage ΦKp154 (Klebsiella pneumoniae phage ΦKp154) is 1 mm, circular and transparent, without a halo. Observed through an electron microscope, its head has a regular polyhedron structure, belonging to the Myoviridae family, and the full-length genome is 40,757 bp. The phage ΦKp154 was deposited at the China Center for Type Culture Collection (Wuhan University) on November 8, 2023, and the deposit number is CCTCC M 20232152.

[0083] Phage composition

[0084] The present invention also provides a composition for lysing Klebsiella pneumoniae, which refers to a composition obtained by mixing the phage of the present invention with a pharmaceutically acceptable carrier and can be used for lysing Klebsiella pneumoniae.

[0085] "Pharmaceutically acceptable carrier" refers to a carrier used for administering therapeutic agents, including various excipients and diluents.

[0086] Acceptable carriers refer to those pharmaceutical carriers that are not themselves essential active ingredients and have no excessive toxicity after administration. Suitable carriers are well-known to those of ordinary skill in the art. In the composition, pharmaceutically acceptable carriers may contain liquids such as water, saline, and buffers. Additionally, auxiliary substances may also be present in these carriers, such as fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffering substances, etc. The carrier may also contain cell transfection reagents.

[0087] Detergent or disinfectant

[0088] The phage of the present invention can be prepared into a detergent or disinfectant by conventional methods, such as solutions, emulsions, suspensions, powders, foams, pastes, granules, aerosols, natural and synthetic materials impregnated with the active substance, microcapsules in polymers, and coating agents for seeds.

[0089] These preparations can be produced by known methods. For example, the phage of the present invention is mixed with extenders, which are liquid or liquefied gas or solid diluents or carriers, and surfactants, i.e., emulsifiers and / or dispersants and / or foam formers, can be optionally used. For example, when water is used as the extender, organic solvents can also be used as adjuvants.

[0090] When a liquid solvent is used as a diluent or carrier, it is basically suitable, such as: aromatic hydrocarbons, such as xylene, toluene or alkylnaphthalene; chlorinated aromatic or chlorinated aliphatic hydrocarbons, such as chlorobenzene, vinyl chloride or dichloromethane; aliphatic hydrocarbons, such as cyclohexane or paraffin, such as mineral oil fractions; alcohols, such as ethanol or ethylene glycol and their ethers and esters; ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone; or less common polar solvents, such as dimethylformamide and dimethyl sulfoxide, and water.

[0091] Regarding the diluent or carrier of liquefied gas, it refers to a liquid that will become a gas under normal temperature and pressure, such as aerosol propellants, such as halogenated hydrocarbons and butane, propane, nitrogen and carbon dioxide.

[0092] Solid carriers can be ground natural minerals, such as kaolin, clay, talc, quartz, activated clay, montmorillonite, or diatomaceous earth, and ground synthetic minerals, such as highly dispersed silica, alumina and silicates. Solid carriers for granules are crushed and graded natural zircon, such as calcite, marble, pumice, sepiolite and dolomite, as well as granules synthesized from inorganic and organic coarse powders, and granules of organic materials such as sawdust, coconut shells, corn cobs and tobacco stems, etc.

[0093] Nonionic and anionic emulsifiers can be used as emulsifiers and / or foam formers. For example, polyoxyethylene-fatty acid esters, polyoxyethylene-fatty alcohol ethers, such as alkylaryl polyethylene glycol ethers, alkyl sulfonates, alkyl sulfates, aryl sulfonates and albumin hydrolysis products. Dispersants include, for example, lignosulfite waste liquor and methyl cellulose.

[0094] Binders can be used in the preparation, such as carboxymethyl cellulose and natural and synthetic polymers in the form of powders, granules or emulsions, such as gum arabic, polyvinyl alcohol and polyvinyl acetate.

[0095] Colorants can be used, such as inorganic dyes, such as iron oxide, cobalt oxide and Prussian blue; organic dyes, such as organic dyes, such as azo dyes or metal phthalocyanine dyes; and trace nutrients, such as salts of iron, manganese, boron, copper, cobalt, aluminum and zinc, etc.

[0096] In addition, the cleaning agent or disinfectant of the present invention can also be made into a mixture with a synergist and exist in their commercial preparations or in the dosage forms prepared from these preparations. These synergists are compounds that enhance the action of the active substance. Since the active substance itself has activity, it may not be necessary to add a synergist.

[0097] The dosage forms of the cleaning agent or disinfectant of the present invention can be various, as long as they can effectively deliver the active ingredient to the interior of bacteria. From the perspective of ease of preparation and application, the preferred cleaning agent or disinfectant is a spray or solution preparation.

[0098] The phage of the present invention usually contains 0.0001-99 wt%, preferably 0.1-90 wt% of the total weight of the cleaning agent or disinfectant. The concentration of the active substance of the present invention in the commercial preparation or dosage form can vary within a wide range. The concentration of the phage of the present invention in the commercial preparation or dosage form can range from 0.0000001-100% (g / v), preferably between 0.0001 and 1% (g / v).

[0099] The main advantages of the present invention include:

[0100] (1) The phage of the present invention has excellent bactericidal effects and can kill 99% of bacteria within a short time;

[0101] (2) The phage of the present invention has good stability, is stable at -20 to 60 °C and stable at pH = 5 to 11;

[0102] (3) The phage of the present invention can be used to prepare drugs for treating infectious diseases caused by Klebsiella pneumoniae infection or to prepare disinfectants;

[0103] (4) The phage of the present invention has good compatibility with other phages: the phage of the present invention can be used in combination without affecting its bactericidal effects.

[0104] The present invention will be further illustrated below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by weight.

[0105] Example 1 Bacterial resuscitation and phage purification

[0106] 1.1 Method

[0107] Take out the bacteria Kp13869, Kp2107613, and Kp25615 stored in the ultra-low temperature refrigerator, pick a small amount of glycerol cryopreserved bacteria with an inoculation loop and inoculate them on an LB agar plate, and incubate them upside down at 37 °C for 24 hours. Pick a monoclonal bacterial colony from the LB agar plate and inoculate it into an LB liquid medium, and incubate it in a constant temperature shaker at 37 °C for 8 hours to obtain a turbid bacterial solution.

[0108] Take out the original phage solutions ΦKp154, ΦKp122, and ΦKpJH-1 stored in a 4°C refrigerator, serially dilute them with 0.9% saline. Take 100 μL of the phage dilution and 300 μL of the turbid bacterial solution, place them in a 0.5% LB upper-layer mixture, pour it onto an LB agar plate, wait for it to air dry, then invert it and incubate it in a 37°C incubator for 12 hours, and observe the plaques.

[0109] 1.2 Results

[0110] The plaque diameter of phage ΦKp122 is 5 mm, round and transparent, without a halo.

[0111] The plaque diameter of phage ΦKp154 is 1 mm, round and transparent, without a halo.

[0112] The plaque diameter of phage ΦKpJH-1 is 2 mm, round and transparent, without a halo.

[0113] Example 2 Phage Transmission Electron Microscopy

[0114] 2.1 Method

[0115] Scrape the upper layer of the culture dish with a single plaque grown on it using an L-shaped spreader, place it in 0.9% saline, and release it at 4°C for 12 hours. Centrifuge at 8000 r for 5 minutes to separate the precipitate. The supernatant is filtered through a 0.22-μm filter membrane to remove bacteria to obtain the original phage solution. Aspirate 500 μL of the phage original solution with a titer reaching 10 9 PFU / ml and send it to Wuhan Maisipu Biotechnology Co., Ltd. for transmission electron microscopy imaging.

[0116] 2.2 Results

[0117] The head of phage ΦKp122 has a regular polyhedron structure and belongs to the Myoviridae family.

[0118] The head of phage ΦKp154 has a regular polyhedron structure and belongs to the Myoviridae family.

[0119] The head of phage ΦKpJH-1 has a regular polyhedron structure and belongs to the Podoviridae family.

[0120] Example 3 Phage Sequence Verification

[0121] 3.1 Method

[0122] Use an M5λ phage genomic DNA rapid extraction kit to extract the DNA from the original phage solution. Send the DNA to Sangon Biotech for whole-genome sequencing. Randomly intercept three segments of sequences for each phage to synthesize primers, use the phage as a template for PCR verification. Agarose gel electrophoresis shows a clear and bright single band. The PCR product is sent for sequencing for sequence verification.

[0123] Table 1 shows the PCR primer sequences.

[0124] Table 1

[0125]

[0126] The polymerase chain reaction system is 50 μl (1 μl of forward primer, 1 μl of reverse primer, 1 μl of template, 25 μl of mix enzyme, 12 μl of ddH2O). The polymerase chain reaction conditions are 94°C for 2 mins, 94°C for 30 s, 56°C for 30 s, 72°C for 1 min, 30 cycles of step 2, and 72°C for 10 mins.

[0127] 3.2 Results

[0128] Agarose gel electrophoresis shows that all the products of the polymerase chain reaction have bright and single bands. The corresponding sequences of the PCR products sent for sequencing are as follows:

[0129] ΦKp-JH-1-1:

[0130] ACATCCAAGGAGGCATAATGTCCACGATTACACAATTCCCCTCAGGAAACA

[0131] CTCGGTACAGGATTGAGTTCGACTACCTAGCCAGAACGTTTGTTGTTGTTAC

[0132] ACTGGTGAATAGCTCTAACCCTACCCTGAACCGTGTACTGGAAGTTGGTCGA

[0133] GATTACCGCTTCCTTAATCCAACGATGATTGAGATGCTGGTTGACCAATCGG

[0134] GTTTCGACATCGTTCGTATTCACCGTCAGACTGGAACTGACTTAGTGGTAGA

[0135] CTTCAGGAATGGCTCAGTGTTGACAGCTAGTGACCTGACCAATGCAGAGCTT

[0136] CAGGCTATCCATATTGCAGAAGAAGGTCGAGACCAAACCGTTGACTTAGCG

[0137] AAGGAATATGCCGATGCTGCTGGTAGCTCTGCTGGCAACGCTAAGGATAGCGAGGACGAAGCAAACCGAATCGCA(SEQ ID NO:19)

[0138] ΦKp-JH-1-2:

[0139] CTGCGAAAGAAGTGCCTGCAGACTTCTACGAGCAGTTCGCGGACCAGCTTC

[0140] ATGAGAGTCAGCGCGACAAGTTGCCTGAGCTTCCGAAGCGCGGTAAACTGA

[0141] ACATCGAAGACATTCTGTTATCTGACTTTGCATTCGCCTAAGGAGGCACCGA

[0142] GTATGAAATTCGCACACAAGCAAACTGGCGTTAAGGGTGGTACTCAAATCG

[0143] TGACCGTTACCGAACACAACGGCAAGGGCTTGGTGAAGACCACGGTCATTC

[0144] CGACCGAGATGTCCAAGGAACTTAACGTCCCGTTCAAATGGCTGGTGCAAC

[0145] AGGTCGAACAGGCCCACGAACAGGCCCTAACCGAGGCGGCAACGAAATGA

[0146] CAGACCTTAAGTGGCTGGCCTTATGGCTGGCCTTCTTAGCAGTGTACACTTT

[0147] AATCCAACGCAAAAAAGGCTAAACACCATGTTCAACCGTAAACTGAAAGCACGTATCGCAGCA(SEQID NO:20)

[0148] ΦKpJH-1-3:

[0149] GGGGCCGGTCTGAGGGGCAAGCGGTCTATGACCGACTGAAGAACGGTAGACAGCCATATGAGACACGCGCTCAGAACTGTGCTGCTGTCACTATCCCGTCACTGTTTCCAAAGGAGTCAGACAACTCGTCTACTGAGTACACAACTCCGTGGCAAGCTGTAGGTGCTCGCTGTTTGAACAACTTGGCTGCAAAGCTGATGCTGGCATTATTCCCTCAGTCACCGTGGATGCGACTGACAGTCTCCGAATATGAGGCCAAGACCTTGAGTCAGGACTCAGAGGCTGCTGCTCGTGTTGACGAAGGGCTGGCTATGGTCGAGCGTGTGTTGATGGCCTACATGGAGACTAACAGTTTCCGTGTCCCATTGTTCGAAGCTCTGAAGCAGCTTATCGTCTCCGGTAACTGTCTGCTCTACATTCCAGAGCCTGAACAGGGAACCTACAGTCCTATGCGAATGTACCGCTTAGTGTCCTACGTTGTTCAACGTGATGCTTTCGGTAACATCTTGCAGATTGTGACTCTTGACAAGGTAGCGTTTAGTGCTCTACCGGAAGACGTGAAGTCTCA ACTAAACGCAGACGACTATGAGCCTGACACCGAGCTGGAAGTGTATACGCACATCTACCGTCAGGACGACG(SEQ ID NO:21)

[0150] ΦKp122-1:

[0151] GGGTAGCTGGATGCAGCTCGAGGTGTCGCCGATACGCGGAATCTTACCGTGTCGCTCCGAGGCCGCTACAGTGCTGCGGTCCTCCCGGCGAACCGAGAAGATACCGTTGGATTTGTTGAAGTGTAAGCGCATGGTTTATGCTCCTTTAGGTGGCTCGTCGTTCATTGACCACACGATAGCCGCGAGGATGAACACGATGATTAGAATCAGATTGATGGACATATTGTTGTCTCCTATAGTGCTACCTAATTACATCTTAACGGTAGGGTCTTCCTCGGTGCCGCGCCATTTGTCGAACGATGGGTGACGAAGAGAGCCGTCTGGAGTTTCCTCCATGTACTTGATTTGGCACGCCCAGCCAATATACGCCTGAGTGTCTCCGTTCAGTTCCTGAGTTAGTACCGCAGAGGTGAACTCCTCCATAAGTGCCTGAGAGATGTTGTTAGCGGATACCACGCGGCCAGACTCAAGGAGAACCTCGAAGCCAATCACCTTGCCCTCGTTGGCAAGACCGGGAGTTCCCCAGTTGAGTCCCACAACGATACCGTCAGCTTCATTCTCTGGCTTCATCTTCCACCAGCCGGACTTCTTACCACGCTTGTAGATGCCCTGAGGGTCCTTGACCACCAGACCTTCATTACCTTCTTCGGTTGGGGGGGGGGAAAAAAA(SEQ IDNO:22)

[0152] ΦKp122-2:

[0153] GGTACGAGCAGTGCTTCAGTTGACATCTCGTTGACTACCGCCAGCACCTTCTTGTTCACCTTCCACGGTGTGTTTTGCGCTAGGTTTACCGCCTTGTATACCTCGGGCATGTGCACGTCTGCATAGCGGCGCAGTGCCTTCTTGGAGTGGGTACGAACCAATGCCAGCGGGCGACGACCGACTGACCAGTAGCCACCGCCAACGGTCTCAACCCAAGGTTTCGGAGGGACTACGCACGGCTGGTGCATCGGGCTGATACCTGCGAGTGCGCCCGCTCGTTTGCTCAGGAGTTCCACGAAGGCCGGAGCCAGTTGGACCATCTGCATACTGGTCACATCGTCGGAGCCATCGGCCATCTTGTTCTTGGTCATTTCCACCAGACCAGTGCCCTCAATGAGCAGCTCCAGCAGCTTGGTCCCCACGTGCATCTGCTCGTCGGTCTTCCAGCCGACCCAGTTGCCACCACCCAGCATCCCTTTTGAAATCATATCGGCCTCTACGACCTGCATGAAAGCCTTCTTGTACACGTGGCCTACACGCTTGTCCAGCTGGTCCGCTACGTTCTTCTTGAAGTAGGCGGCTTCCTGCTCACGGATACGACCGAAGCGGGCCTCATCCTCAAGGGCCTTGCCTAACTGCGAGGACACCTGCTGGATAGTGGCCTTTGAGGCGTCTGTGAGCGTCCCTAAGACGACCTTAATGGTTAGCAGTGCGATTGCCTCACTGGACACTCCGCGCTTCTCCTTGAGCACCTCAGCGCCCATGCTAACAGCTAACTCTGAGGCGACGCCGTGCTTAATCGGGAGTGGGGGGGGGCTAAAAAAAAAAA(SEQ ID NO:23)

[0154] ΦKp122-3:

[0155] GGCGAATTTACGGTGTCCTTCAGCGCTTCCACTTCACCCTTCAGTTGTCCCTTACGTTCAGCCCGCTTGTCTAACGCCATGATTTCGTCCTTGAGCTGCTGCGTGGTCTTGCCACTACCGCCCATGATGGAGATATCACCGTTAACGCGACGATCGTACGCTGGGATAATCCGTGCCATGTCGAAGTCCCTCAGGTCGTTGACGCTGAATGTCGACCCATCCGGTAAGGTAACCGGGAGGTCGCTGTCGAACATGTTACGGGCCTCAAGGAACGAGTTGTTCTCGATACCGACCAGACCTGTGATGTTGTCGTCAATGACGCTGGACGCTGTGAAGTCCTCAGTGA(SEQ ID NO:24)

[0156] ΦKp154-1:

[0157] CAGGCCGGCGGTACGCGGGTCAGACATAGCTTTAATCATCTCAGCCTGAGACTCGAAGCCTTCAGCTTTACGGGCCACAGGTTTCGCTGGGGTAGCACGCTTGGCAATAGAGCGTTC(SEQ ID NO:25)

[0158] ΦKp154-2:

[0159] CTCGGTCATTTGCATGCCAGTACGCGCTCCTCGACTTTCGCAAGGTCAAACTTTAGGGCGTTTACATGATACTCCTCACGCTCACGTTCACGCTCCTTACGCCACCTAGCGGCGGCTTTGACGCGGTTTCTGCGGGCCTTGTTGTTGGCCCTACGGGCGCGACACAACGTGCTGTCACGGTCCCGCTTAGCCTTGTTGCGCTTACAGCGTTCAATCATCTTGTCGTTCGCTATCTGCTCAATCTCTGCGAGCAGGTCCTCAGGTTCCAGCGAGAAAGGCTCCCGGTCCCGGTCCGCTGAGAATGACACCGGGTCGGTAATCACTGGCTTGCCGTCTTTGGTGAACATGATGTTACCGCTGTGCATATCAAAGGATGCAATCCCGTAGAAGAACTTGTTAATCATCTTGCATGTCTCGACGAAGGGTAATTCCTTCTCTGCGCCAACAACATCGCCCAGCTCTGCATCAGAGTTCTCCACAAAATAGTTAGCTATGTCCGCGTAATGCTCGTGCGTCGCGTTGAAGTGCCTCTTGCATGGTTCCAACTCATCAAGTACCACCGTGTAGCACCCAGCGTGACGCGCAGGGGGGAATATAGACAA(SEQ ID NO:26)

[0160] ΦKp154-3:

[0161] AAAGTCGCTCGTTCTTTATCTGCAACCTTTAGCGTCAAAGTAGCTAAGTTGGCCAATGCTCAGGGATGTGCTGAATAAGTCACGAGCCTCCTCTGCGATGTGTGCAGACTGTAGAGCTGACACATTGAGGTCGGTCGCGCGTAGAACGGACCCATCGCTGAAGTCCACTACCATCTCGGATGCTGACGTGAAGCGTCGAATCTCTACACGGCTATACCCATCGGTACTGACCAGCAGCTTAATGCGCGTTCTGGAGACGTATCGGTAATCTGTGATGTTATCCAGTAAGAGTCGCTGGGTGTCCGACACGAGAGACACACGGACAAACTTACGCGACAGGTAGTCGAAGGGGATATCGT ATTCGTCGCTACCTGTGGGGTACTGGATAATTGTTTTAGTATCTAGGTCCATTGTGGCCTCCTTAAGTTGAATGTGGAGGGAAACCGCTAGGTCTCCCTATAGTGCTACCTAATTAGTTAGGTTTAGGCTGCTGTTTGATGGTTACTCCGTTAGCCTCGTAGATTTTCATGATGAGCTGTTGAGTCAGTGGGTCGTTCGGCACAAGCTCCTTAGTGGAGTTCATCAGGCCAGTCATGTAGTCACGCTCAGTCGGCTTATTAGGTGCTGTAGCAACACCGTAGGCGTTTTAGGGGTCCCCAAGAGTGAT(SEQ IDNO:27)

[0162] Example 4 Detection of Bacteriophage Stability and pH Stability

[0163] 4.1 Method

[0164] Take the original phage solutions ΦKp154, ΦKp122, and ΦKpJH-1 and place them at -20, 4, 25, 37, 50, 60, and 70 °C for 1 hour, and detect the phage titer. Use hydrochloric acid and sodium hydroxide to adjust the pH of the original phage solutions ΦKp154, ΦKp122, and ΦKpJH-1 to 4, 5, 6, 7, 8, 9, 10, and 11 in sequence. After treatment for 1 hour, detect the phage titer.

[0165] 4.2 Results

[0166] 4.2.1 Temperature Stability

[0167] After ΦKp122 was treated at 50 °C for 1 hour, its titer still remained at 10 8 PFU / ml.

[0168] After ΦKp154 was treated at 50 °C for 1 hour, its titer still remained at 10 8 PFU / ml.

[0169] After ΦKpJH-1 was treated at 50 °C for 1 hour, its titer still remained at 10 8 PFU / ml.

[0170] 4.2.2 pH Stability

[0171] When ΦKp122 was cultured for 1 hour within the range of pH 7.0 - 10.0, its titer remained above 10 8 PFU / ml. When pH = 4.0, it completely lost the ability to infect the host. ΦKp122 is acid-intolerant and alkali-loving.

[0172] When ΦKp154 was cultured for 1 hour within the range of 6.0 - 9.0, its titer remained above 10 8 PFU / ml. When pH = 5.0, it completely lost the ability to infect the host. ΦKp154 is acid-intolerant and alkali-loving.

[0173] When ΦKpJH-1 was cultured for 1 hour within the range of 6.0 - 10.0, its titer remained above 10 8 PFU / ml. When pH = 4.0, it completely lost the ability to infect the host. When pH = 11.0, the phage titer was still 10 4 PFU / ml. ΦKpJH-1 is acid-intolerant and alkali-loving.

[0174] Example 5 Bactericidal Efficiency of Phage

[0175] 5.1 Method

[0176] The ratio of the phage to its corresponding host bacterium, i.e., MOI, was adjusted to 10. The bacteria and the phage were mixed in equal volumes and cultured for 20 minutes to detect the number of bacteria.

[0177] 5.2 Results

[0178] Using the host bacteria Kp13869, Kp2107613, and Kp25615 corresponding to ΦKp154, ΦKp122, and ΦKpJH-1 respectively, with MOI = 10, the inventor repeated the experiment twice.

[0179] Among them, in the first experiment, the number of bacteria before treatment of Kp13869 was 6.1×10 7 CFU / ml, and the number of bacteria after treatment was 1.54×10 5CFU / ml, with a bactericidal rate of 99.7%. The number of bacteria before treatment with Kp25615 was 2.0×10 8 CFU / ml, and the number of bacteria after treatment was 1.2×10 4 CFU / ml, with a bactericidal rate of 99.9%. The number of bacteria before treatment with Kp2107613 was 2.6×10 8 CFU / ml, and the number of bacteria after treatment was 2.0×10 4 CFU / ml, with a bactericidal rate of 99.9%.

[0180] Among them, in the second experiment, the number of bacteria before treatment with Kp13869 was 6.7×10 7 CFU / ml, and the number of bacteria after treatment was 1.25×10 5 CFU / ml, with a bactericidal rate of 99.8%. The number of bacteria before treatment with Kp25615 was 1.68×10 8 CFU / ml, and the number of bacteria after treatment was 1.0×10 4 CFU / ml, with a bactericidal rate of 99.9%. The number of bacteria before treatment with Kp2107613 was 2.0×10 8 CFU / ml, and the number of bacteria after treatment was 1.44×10 4 CFU / ml, with a bactericidal rate of 99.9%.

[0181] Both groups of data showed that after the host bacteria were treated with the phage for 20 minutes, the bactericidal efficiency of the phage could reach as high as 99%.

[0182] The bactericidal results of the phage of the present invention are shown in Table 2.

[0183] Table 2

[0184]

[0185] Example 6 Detection of the Stability of the Phage Mixture

[0186] 6.1 Method

[0187] The phages ΦKp154, ΦKp122, and ΦKpJH-1 were adjusted to 8.0×10 8 PFU / ml, and the phage mixture was divided into 5 groups:

[0188] Group 1: ΦKp122, ΦKpJH-1, and ΦKp154 were mixed in equal volumes at a ratio of 1:1:1;

[0189] Group 2: ΦKp122, ΦKpJH-1, and 0.9% normal saline were mixed in equal volumes at a ratio of 1:1:1;

[0190] Group 3: ΦKp122 and 0.9% normal saline were mixed at a volume ratio of 1:2;

[0191] Mix 4 groups of ΦKpJH-1 and 0.9% normal saline in a volume ratio of 1:2;

[0192] Mix 5 groups of ΦKp154 and 0.9% normal saline in a volume ratio of 1:2.

[0193] Use the above five groups of phage mixtures to detect the phage titer for the resuscitation indicator hosts Kp2107613, Kp2021447, and Kp25615. Set the time to 30 minutes, and detect once a day for one week.

[0194] 6.2 Results

[0195] The phage mixtures of the first group and the fifth group have a lysing effect on Kp2021447. After mixing the phages for 30 minutes, detect the phage titer with Kp2021447. The titer of the phage mixture in the first group is 2.4×10 8 PFU / ml, and the titer of the phage mixture in the fifth group is 2.4×10 8 PFU / ml; after mixing the phages for 1 day, detect the phage titer with Kp2021447. The titer of the phage mixture in the first group is 2.4×10 8 PFU / ml, and the titer of the phage mixture in the fifth group is 1.6×10 8 PFU / ml; after mixing the phages for 7 days, detect the phage titer with Kp2021447. The titer of the phage mixture in the first group is 2.8×10 8 PFU / ml, and the titer of the phage mixture in the fifth group is 2.0×10 8 PFU / ml.

[0196] Among them, the phage mixtures of the first, second, third, and fifth groups have a lysing effect on Kp2107613. After mixing the phages for 30 minutes, detect the phage titer with Kp2107613. The titer of the phage mixture in the first group is 2.4×10 8 PFU / ml, the titer of the phage mixture in the second group is 3.2×10 8 PFU / ml, the titer of the phage mixture in the third group is 2.4×10 8 PFU / ml, and the titer of the phage mixture in the fifth group is 1.6×10 8 PFU / ml; after mixing the phages for 1 day, detect the phage titer with Kp2107613. The titer of the phage mixture in the first group is 4.0×10 8 PFU / ml, the titer of the phage mixture in the second group is 3.6×10 8 PFU / ml, the titer of the phage mixture in the third group is 3.6×10 8 PFU / ml, and the titer of the phage mixture in the fifth group is 2.4×10 8PFU / ml. The phage titer was detected with Kp2107613 7 days after phage mixing. The phage titer of the first group of phage mixtures was 3.2×10 8 PFU / ml, the phage titer of the second group of phage mixtures was 2.8×10 8 PFU / ml, the phage titer of the third group of phage mixtures was 2.8×10 8 PFU / ml, and the phage titer of the fifth group of phage mixtures was 1.24×10 8 PFU / ml.

[0197] Among them, the phage mixtures of the first, second, and fourth groups had a lysing effect on Kp25615. The phage titer was detected with Kp25615 30 minutes after phage mixing. The phage titer of the first group of phage mixtures was 3.2×10 8 PFU / ml, the phage titer of the second group of phage mixtures was 2.8×10 8 PFU / ml, and the phage titer of the fourth group of phage mixtures was 3.2×10 8 PFU / ml; the phage titer was detected with Kp25615 1 day after phage mixing. The phage titer of the first group of phage mixtures was 3.2×10 8 PFU / ml, the phage titer of the second group of phage mixtures was 3.6×10 8 PFU / ml, and the phage titer of the fourth group of phage mixtures was 3.2×10 8 PFU / ml; the phage titer was detected with Kp25615 7 days after phage mixing. The phage titer of the first group of phage mixtures was 2.0×10 8 PFU / ml, the phage titer of the second group of phage mixtures was 2.8×10 8 PFU / ml, and the phage titer of the fourth group of phage mixtures was 2.4×10 8 PFU / ml.

[0198] In summary, the experimental results show that the phage mixtures are stable and good, and this advantage can support the possibility of being used as environmental disinfectants in the future.

[0199] The stability results of the phage mixture of the present invention are shown in Table 3.

[0200] Table 3

[0201]

[0202]

[0203] Conclusion:

[0204] As can be seen from Examples 1 to 6, the phages of the present invention have excellent bactericidal effects and good stability. On the other hand, the phages of the present invention can be used in combination and can be used to prepare drugs or disinfectants for treating Klebsiella pneumoniae.

[0205] Phage preservation

[0206] The phage ΦKpJH-1 (Klebsiella pneumoniae phage ΦKpJH-1) of the present invention was deposited at the Guangdong Provincial Culture Collection Center of Microorganisms (GDMCC, Guangzhou, China) on November 9, 2023, with the deposit number GDMCC NO: 63990-B1.

[0207] The phage ΦKp122 (Klebsiella pneumoniae phage ΦKp122) of the present invention was deposited at the Guangdong Provincial Culture Collection Center of Microorganisms (GDMCC, Guangzhou, China) on November 9, 2023, with the deposit number GDMCC NO: 63989-B1.

[0208] The phage ΦKp154 (Klebsiella pneumoniae phage ΦKp154) of the present invention was deposited at the China Center for Type Culture Collection (Wuhan University) on November 8, 2023, with the deposit number CCTCC NO: M 20232152.

[0209] All documents mentioned in the present invention are cited herein by reference as if each document was individually cited by reference. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

1. A Klebsiella pneumoniae phage ΦKpJH-1, characterized in that, The preservation number of the phage is GDMCC NO: 63990-B1.

2. A Klebsiella pneumoniae phage ΦKp122, characterized in that, The preservation number of the phage is GDMCC NO: 63989-B1.

3. A Klebsiella pneumoniae phage ΦKp154, characterized in that, The preservation number of the phage is CCTCC NO: M20232152.

4. The phage according to any one of claims 1 to 3, characterized in that, Having one or more of the following characteristics: (c1) The head is an icosahedral structure; (c2) Stable at -20 to 60 °C; (c3) Stable under the condition of pH = 5 to 11; (c4) Has a bactericidal effect on Klebsiella pneumoniae.

5. A pharmaceutical composition, characterized in that, The composition comprises: (a) A phage mixture, the phage mixture is selected from any one of the phages in claims 1 to 3 or two or more phages, and (b) A pharmaceutically acceptable carrier.

6. The pharmaceutical composition according to claim 5, characterized in that, For preparing a pharmaceutical composition for treating infectious diseases caused by Klebsiella pneumoniae infection.

7. A cleaning agent or disinfectant, characterized in that, The cleaning agent or disinfectant comprises the phage according to any one of claims 1 to 3.

8. The cleaning agent or disinfectant according to claim 7, characterized in that, The cleaning agent or disinfectant is used for lysing Klebsiella pneumoniae.

9. A method for lysing Klebsiella pneumoniae, characterized in that, Including the steps: Contacting the phage according to any one of claims 1 to 3 with Klebsiella pneumoniae, thereby lysing Klebsiella pneumoniae.

10. The method according to claim 9, wherein The strain numbers of the Klebsiella pneumoniae are Kp13869, Kp2107613, and Kp25615.

Images