Orthogonal DNA fluorescent coding system based on computer-aided design and application

Abstract

The invention discloses a computer-aided design orthogonal DNA fluorescent coding system and application, and belongs to the technical field of DNA nanotechnology. By means of computer-assisted nucleic acid sequence design and CHA technology, an orthogonal amplification fluorescence coding mode is designed, efficient detection of various miRNAs is achieved, the miRNA detection cost is reduced, and the detection efficiency is improved.

Description

Technical Field

[0001] The present invention belongs to the field of DNA nanotechnology, and relates to the detection of disease biomarker miRNA, etc. Specifically, it relates to a computer-aided DNA fluorescence encoding system and the detection of multiple miRNAs using this system. Background Art

[0002] MicroRNA (miRNA) is a class of short, non-coding single-stranded RNAs (about 22 nucleotides in length). miRNAs mainly regulate the expression of related genes by inhibiting the translation of target genes or degrading the transcripts of their target genes. Aberrant expression of miRNAs is closely related to the pathogenesis of various cancers and has now been regarded as emerging biomarkers for the diagnosis, prognosis, and treatment monitoring of many diseases, especially cancers. At the same time, conducting miRNA expression profiling helps to deeply reveal the molecular mechanism of diseases and provides a basis for the discovery of drug targets and personalized treatment. However, studying a single miRNA often fails to comprehensively reflect complex biological processes. In contrast, simultaneous detection of multiple miRNAs can more comprehensively reveal the miRNA regulatory network and functions. Multi-miRNA detection technology not only improves the sensitivity and specificity of disease diagnosis but also provides an important basis for the molecular typing and personalized treatment of diseases. For example, in cancer research, multi-miRNA detection can distinguish different subtypes of tumors and predict the prognosis and treatment response of patients. In addition, multi-miRNA detection technology also helps to discover new miRNA markers and related regulatory mechanisms, promoting the development of precision medicine.

[0003] Currently, with the continuous development of miRNA detection technologies such as qPCR, microarray, and high-throughput sequencing technologies, it has become possible to simultaneously detect multiple miRNAs, thus improving the comprehensiveness and accuracy of research. However, the above methods have high requirements for instrument equipment, are time-consuming and laborious, and have high costs. Therefore, how to achieve simultaneous detection of multiple miRNAs in a more convenient and efficient manner has become an urgent problem for researchers to solve.

[0004] Fluorescence encoding detection technology is a high-throughput and highly sensitive detection method based on fluorescence signals, which is widely used in the fields of biomolecule detection, cell analysis, drug screening, etc. This technology can achieve simultaneous detection of multiple target substances by means of multiple distinguishable fluorescence signals. Nucleic acid molecules, especially DNA, have become an excellent medium and carrier in the fluorescence encoding system due to their advantages such as high addressability, programmability, and easy modification. Based on the nucleic acid-based fluorescence encoding method, by precisely positioning different fluorophores on DNA molecules, multiple output signals that can be distinguished by fluorescence detection instruments can be generated, thereby increasing the number of target substances that can be detected simultaneously.

[0005] In recent years, there has been much research on the nucleic acid fluorescence encoding method of miRNAs. For example, by providing the physical spatial distance of fluorophores through large-scale structures such as DNA origami structures, the recognition and imaging of multiple miRNAs at specific sites can be achieved. However, the design of DNA nanostructures is difficult and the synthesis efficiency is low, which increases the cost of detection. Another study uses molecular beacons with different fluorescent labels to achieve signal output through fluorescence recovery, but its detection sensitivity and specificity are both affected by the content and sequence of miRNAs. In addition, there is also a method of encoding more fluorescent channels by increasing variables through the photophysical property changes of fluorophores in different DNA environments, but this method is still limited by equipment conditions and is difficult to be widely applied. Therefore, developing a nucleic acid fluorescence encoding method that is easy to operate, easy to detect, highly orthogonal, and capable of signal amplification has become the core goal of this invention. Summary of the Invention

[0006] To make up for the deficiencies of the prior art, the present invention utilizes the high specificity, programmability, and easy modification characteristics of DNA, combines the Catalytic Hairpin Assembly (CHA) technology and computer-aided design to develop an orthogonal amplification DNA fluorescence encoding system for the simultaneous detection of multiple miRNAs, reducing the cost of miRNA detection and improving the detection efficiency.

[0007] The primary object of the present invention is to claim an orthogonal DNA fluorescence encoding system designed by computer-aided design, specifically:

[0008] Design and generate each basic module of CHA, and there is orthogonality between each module. All modules finally form a logic circuit; perform fluorescence encoding on different CHA circuits for the detection of multiple miRNA targets.

[0009] Furthermore, precisely generate each basic module of CHA with the aid of a computer, including the division of the basic modules of CHA and the generation scheme of the basic database.

[0010] Construction of the orthogonal CHA system: According to the logical principle of complementary pairing, construct different CHA orthogonal circuits in contrast to different miRNAs.

[0011] The present invention also claims a design scheme of a CHA circuit fluorescence encoding system based on computer-aided design.

[0012] Another object of the present invention is to claim a design method of the above-mentioned orthogonal DNA fluorescence encoding system designed by computer-aided design, including the following steps:

[0013] (1) Generation of the basic database of the CHA circuit;

[0014] (2) The orthogonal encoding method of the CHA circuit based on the database;

[0015] (3) The fluorescence encoding method of the encoded orthogonal CHA circuit system.

[0016] The present invention also requests protection for the application of the above-mentioned computer-aided designed orthogonal DNA fluorescence encoding system in the detection of multiple miRNAs.

[0017] The inventive concept of the present invention is: using the Catalytic Hairpin Assembly (CHA) technology for molecular detection and signal amplification, which can sensitively identify the target and output a high multiple of signals; at the same time, by constructing mutually orthogonal amplification systems with the help of a computer and modifying different fluorescent molecules, it not only ensures the output difference between circuits, but also avoids signal crosstalk between different circuits, and truly realizes the specific detection of the target and the orthogonality between multiple targets.

[0018] Specifically, this DNA fluorescence encoding system is composed of several CHA cyclic units with different fluorescence outputs. Each CHA system specifically responds to one target, and the cyclic units do not interfere with each other. In order to achieve orthogonality, at the initial stage of DNA design, the two basic elements of CHA - the hairpin loop - are further decomposed into several modules. These modules can be subdivided or spliced, but all decomposition methods need to ensure that all modules can ultimately complete the construction of the logic circuit. The basic module database, as the most basic element of the cyclic circuit, is generated by the computer by restricting its basic type composition, length, and the similarity and complementarity between modules, so as to ensure the orthogonality between different modules. Thus, the circuit feasibility of the DNA circuit assembled according to the splitting logic and the orthogonality between the circuits and cycles are ensured. By this way of first splitting and generating, and then logically assembling, different combinations of CHA systems are obtained. Subsequently, these CHA systems are respectively modified with different fluorophores to provide distinguishable detection channels. For different miRNAs, the target is further associated with the CHA system through a mediator strand. Thus, the efficient and accurate detection of multiple miRNAs is achieved.

[0019] Compared with the prior art, the beneficial effects of the present invention are:

[0020] The present invention designs an orthogonal amplification fluorescence encoding method with the help of computer-aided nucleic acid sequence design and CHA technology, realizes the efficient detection of multiple miRNAs, reduces the cost of miRNA detection, and improves the detection efficiency. Brief Description of the Drawings

[0021] Figure 1 Schematic diagram of the design of the orthogonal fluorescence encoding DNA circuit;

[0022] Figure 2 Schematic diagram of the process for generating a basic sequence library for computer code

[0023] Figure 3 Similarity comparison diagram between sequences in the generated database

[0024] Figure 4 Orthogonality fitting diagram between sequences in the generated database

[0025] Figure 5 Schematic diagram of the construction principle of the orthogonal CHA system

[0026] Figure 6 Orthogonality between the same kind of CHA circuits formed

[0027] Figure 7 Gel electrophoresis characterization diagram of the CHA circuit constructed by the LL method

[0028] Figure 8 Gel electrophoresis characterization diagram of different CHA circuits constructed by the TNT method

[0029] Figure 9 Construction diagram of the CHA fluorescence coding system

[0030] Figure 10 Fluorescence change situation of the CHA circuit and

[0031] Figure 11 Comparison diagram of the detection situations of CHA-375 and CHA-205 for three kinds of miRs in single and mixed systems

[0032] Figure 12 Comparison diagram of the detection situations of traditional CHA circuits for miR-205 and miR-21

[0033] Figure 13 Comparison diagram of the detection efficiency and orthogonal detection situations of different CHA circuits in the simulated actual detection environment Specific implementation manners

[0034] To more clearly elaborate the purpose, technical solution and advantages of the present invention, the embodiments of the present invention will be described in detail below with reference to the accompanying drawings. It should be understood that the following description of the embodiments is intended to explain and illustrate the overall concept of the present invention, rather than being construed as a limitation to the present invention.

[0035] Unless otherwise defined, technical or scientific terms used in this invention shall have the ordinary meanings as understood by those of ordinary skill in the field to which this invention pertains. The use of the word "a" or "an" in this invention does not exclude a plurality. Words such as "comprising" or "including" mean that the elements or items appearing before this word cover the elements or items listed after this word and their equivalents, without excluding other elements or items.

[0036] For easier understanding of this invention, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the field to which this invention pertains. In this document, the terms "CHA system" and "CHA circuit" both refer to the catalytic hairpin assembly circuit CHA.

[0037] In this invention, the database sequences, the generated DNA circuit sequences, and other sequences are shown in Table 1.

[0038] Table 1. Database sequences, generated DNA circuit sequences, and other sequences related to this invention

[0039]

[0040]

[0041]

[0042] Among them, the specific meanings of the nouns in the table are as follows: NT7-8 is the basic database of Scheme 1 generated according to the defined conditions; NT8-10 is the basic database of Scheme 2 generated according to the defined conditions;

[0043] L is the basic database of Scheme 3 generated according to the defined conditions;

[0044] TNT7-8 is the CHA system generated from the database NT7-8;

[0045] TNT8-10 is the CHA system generated from the database NT8-10;

[0046] LL is the CHA system generated from the database L;

[0047] CHA-224(NT7-8) is the CHA system constructed with miR-224 using the database NT7-8;

[0048] CHA-224(NT8-10) is the CHA system constructed with miR-224 using the database NT8-10;

[0049] CHA-224(LL) is a CHA system constructed by miR-224 using database LL;

[0050] CHA-205① is a CHA system constructed by miR-205;

[0051] CHA-375② is a CHA system constructed by miR-375;

[0052] CHA-155③ is a CHA system constructed by miR-155;

[0053] CHA-21④ is a CHA system constructed by miR-21. The above four are all constructed using database NT7-8.

[0054] Example 1 Generation of the CHA System Database

[0055] Use Python statements to write a program to generate a basic module database according to given conditions.

[0056] The present invention designs and generates three generation schemes for the basic module database:

[0057] Scheme 1. Sequence length: 7-8 bases; GC ratio: 40-60%; Sequence similarity: The length of consecutive identical base fragments between sequences does not exceed 3; Complementarity: The number of consecutive complementary bases between sequences does not exceed 3; The generated database is named NT7-8.

[0058] Scheme 2. Sequence length: 8-10 bases; GC ratio: 40-60%; Sequence similarity: The length of consecutive identical base fragments between sequences does not exceed 4; Complementarity: The number of consecutive complementary bases between sequences does not exceed 4; The generated database is named NT8-10.

[0059] Scheme 3. Sequence length: 14-15 bases; CG ratio: 40-60%; Sequence similarity: The length of consecutive identical base fragments between sequences does not exceed 5; Complementarity: The number of consecutive complementary bases between sequences does not exceed 5; The generated database is named L.

[0060] As Figure 2 shown, the running logic of the above program is specifically:

[0061] First, generate multiple DNA sequences with a given number of bases and GC ratio according to the four basic elements ATCG;

[0062] Second, determine whether the sequence is a sequence with a special structure (such as a sequence containing more than 3 consecutive C or G sequences, etc.). If so, remove the sequence containing the special structure;

[0063] Third, retain the generated sequences in the set, and compare the similarity and complementarity between the sequences one by one in the order of generation. If the number of similarities or complementarities between sequences exceeds the requirement, delete the sequence with a later order from the set, and retain the sequences that meet the requirements, and proceed in turn until the last two sequences;

[0064] Fourth, output the remaining sequences in the set to generate the CHA system database.

[0065] Example 2

[0066] Compare the similarity between the sequences in the three sets of databases of the present invention respectively. In this example, the database of Scheme 1 is taken as an example to specifically illustrate this process.

[0067] The similarity comparison can adopt known methods in the art. The present invention writes code according to Formula 1 for comparing the similarity between sequences.

[0068]

[0069] Figure 3 It is a heat map of similarity comparison. It can be seen from the heat map that the similarity between the sequences in the database of the present invention is all lower than 50%, meeting the design requirements.

[0070] Example 3

[0071] Perform orthogonal fitting on the sequences in the database of the present invention. In this example, Scheme 1 is taken as an example to specifically illustrate this process. Import the sequences in the database into the nupack software for orthogonal fitting, and the fitting conditions are DNA environment, Mg 2+ concentration of 5 mM, Na + concentration of 100 mM. The obtained Equilibrium probability data is the possibility of complementary pairing between sequences. It can be seen from Figure 4 that the complementary possibility between the basic sequences in the database does not exceed 0.05%, meeting the requirements.

[0072] Construction of the orthogonal CHA system

[0073] Construction method of the CHA system:

[0074] The conventional CHA circuit is a cyclic logic circuit composed of three DNA elements. The main cyclic logic is as follows: The primer strand opens the stem structure of the hairpin loop H1 through a strand displacement reaction and binds complementarily to a specific sequence, so that the other half sequence of the stem of the hairpin loop H1 is in a free state. This free sequence can further open the stem of another hairpin loop H2. At the same time, the loop sequence of the hairpin loop H2 can specifically bind to the part that was originally complementary to the primer strand, displacing the primer strand from the double-stranded structure. At this time, the hairpin loops H1 and H2 bind to form a double-stranded structure, and at the same time the primer strand returns to the free state. Thus, a complete cycle is completed. Subsequently, the free primer strand can continue to react with other hairpin loops H1 in the environment and start the next cycle. This cycle repeats continuously to achieve the cyclic amplification effect of the signal.

[0075] In this embodiment, based on the above cyclic logic of CHA, a computer-aided design sequence library is used to further precisely control the operation of the CHA circuit. According to the database sequences under different conditions, there are two CHA construction methods:

[0076] Scheme 1: Use NT7-8 and NT8-10 as the basic databases. The underlying logic of this construction scheme is to divide the basic element hairpin loop of CHA into two modules, namely the toe module (Toe, T) and the non-toe module (None-Toe, NT). Four sequences are respectively selected from the NT7-8 and NT8-10 databases. According to the strand displacement principle and the base complementary pairing rule, two CHA circuits are constructed, and their logic rules are as Figure 5 shown in (1) below. The generated CHA systems are named TNT7-8 and TNT8-10 respectively. Taking NT7-8 as an example, we select four sequences: TAAACTCG, GTGAAGT, TCAGGAT, and TGTCGACA. Use GTGAAGT and TGTCGACA as NT1 and NT2, and the remaining two as T1 and T2. NT1* is the complementary sequence of NT1. Similarly, NT2*, T1*, and T2* can be known. According to Figure 5The logic constructs two hairpin loops of CHA, namely TGTCGACATAAACTCGGTGAAGTTGTCGA CAATCCTGA (SEQ ID No.44) and GTCGACAACTTCACCGAGTTTATGTCG ACAATCCTGATAAACTCGGTGAAGT (SEQ ID No.45). The generated hairpin loops are inspected to determine whether they meet the following two conditions. Condition 1: Whether there is a sequence with multiple consecutive "C" or "G" in the hairpin loop generated by module combination. If so, re-screening is required. Condition 2: The ratio of the stem and loop of the generated hairpin loop needs to be controlled between 40% and 60% to ensure the structural stability of the hairpin loop in the absence of the target and the efficiency of hairpin loop opening in the presence of the target. If the above conditions are met, the CHA system is retained, and the "s part" will be adjusted accordingly when encoding specific microRNA (miRNA) subsequently. Similarly, the DNA sequence of TNT8-10 can be deduced.

[0077] Scheme 2: Select database L as the basic database. Its underlying logic is similar to that of Scheme 1, and it also modularizes the hairpin loop. However, there is only one type of part module in this scheme, which is named the loop module (Loop). Select two sequences from database L and construct a CHA circuit according to the strand displacement principle and the base complementary pairing principle. Its logical rules are as Figure 5 shown in (2) below. The generated CHA system is named LL.

[0078] Taking the two sequences ATTGCAGAGCCTAAC (SEQ ID No.46) and AGAAACCTGAGCGA (SEQ ID No.47) as examples, they are defined as L1 and L2 respectively. According to the complementary sequence rule and Figure 5 the basic logic presented, the hairpin loops ATTGCAGAGCCTAACAG AAACCTGAGCGAGTTAGGCTCTGCAAT (SEQ ID No.48) and AGCCTAACTCG CTCAGGTTTCTGTTAGGCTCTGCAATAGAAACCTGAGCGA (SEQ ID No.49) can be obtained. If these two hairpin loops meet the preset conditions, they are reserved for further encoding miR in the CHA system, etc. Similarly, the specific situation of the primer s part will be described in detail in the subsequent miR encoding link.

[0079] miR detection DNA circuit encoding: Introduce the TM strand. The TM strand presents a special hairpin loop structure that contains both a sequence complementary to the corresponding miR and a sequence that can bind to the hairpin loop H1. The specific structure is as Figure 5As shown in (3). When the TM chain specifically recognizes and contacts a specific miR, its original hairpin structure will be opened, and the exposed partial sequence can further open the hairpin loop H1, thus initiating the CHA cyclic reaction.

[0080] Example 5

[0081] This example is used to test the orthogonality of the generated CHA system.

[0082] Taking the CHA system constructed by Scheme 1 as an example: The CHA system designed with miR-205, miR375, miR-21, and miR-155 as targets, and the specific sequences CHA-205①, CHA-375②, CHA-155③, and CHA-21④ are shown in Table 1. Input the generated CHA circuit into the Nupack software and perform fitting analysis in a simulated DNA environment, where the Mg 2+ concentration is 5 mM and the Na + concentration is 100 mM. Through calculation, the Equilibrium probability data obtained is the possibility of direct complementary pairing between chains. As Figure 6 can be seen, for the designed TMn, Hn-1, and Hn-2 chains (n = 1, 2, 3, 4), the possibility of the target reaction is much higher than that of other non-specific reactions. This result indicates that there is a high degree of orthogonality between the circuits of the generated CHA system in theory.

[0083] Example 6

[0084] Figure 7 and Figure 8 are the gel electrophoresis characterization diagrams of different CHA circuits (Lane 1: TM, Lane 2: H1, Lane 3: H2, Lane 4: miR + TM, Lane 5: miR + H1 + H2, Lane 6: TM + H1 + H2, Lane 7: miR + TM + H1, Lane 8: miR + TM + H1 + H2, Lane 9: H1 + H2, Lane 10: H1 + H2 (annealed at 95 °C), Lane 11: miR + H1, Lane 12: miR + H2, Lane 13: TM + H1).

[0085] To verify the actual application effect of the encoded CHA, place the corresponding chains in a constant temperature of 37 °C for 2 h according to the above ratio (another group of H1 + H2 is annealed at 95 °C for 5 min and then naturally cooled to room temperature), and the buffer is 1×TBE, with the Mg 2+ concentration being 5 mM. Finally, load them into a 12% polyacrylamide gel at a final concentration of 1 μM for each component and run for 1.5 h under the condition of 110 V. Then take out the gel, stain and decolorize it, and obvious blue-violet bands can be observed on the gel. Place it in an imager for imaging.

[0086] As shown in lane 8 of the gel electrophoresis figure, the three CHA systems can operate and achieve a cyclic effect. However, there is a small amount of signal leakage in the CHA of the LL system in the blank control, i.e., lane 6, while TNT7-8 and TNT8-10 may have more precise encoded modules and basically no signal leakage phenomenon. Therefore, the following experiments will focus on verifying the fluorescence encoding effect of TNT7-8 and TNT8-10.

[0087] Example 7 Construction of the CHA Fluorescence Encoding System

[0088] Combined Figure 9 The construction process of the CHA fluorescence encoding system shown is used to detail this example. In different CHA systems, there are two specific fluorophore encoding sites, H1 and H2. Through the cyclic system of CHA, there are two variables in the final signal output. By modifying the variables with four fluorophores that have relatively little crosstalk with each other, the number of measurement channels can be effectively increased, and thus imaging analysis or detection of multiple targets can be achieved. The fluorophores selected for modification in this example are: 1. Alexa-405; 2. FAM; 3. Cy3; 4. Cy5. According to the two sites, H1 and H2, theoretically, various fluorescence output combination forms can be generated, and the specific situation is shown in Table 2 (it should be noted that the color order of H1 and H2 does not affect the result here. For example, connecting Cy3 to H1 and FAM to H2 is regarded as the same situation as connecting FAM to H1 and Cy3 to H2).

[0089] Table 2: Fluorescence Output Combinations of the Present Invention

[0090]

[0091]

[0092] To verify the feasibility of fluorescence detection of the CHA fluorescence encoding system, we designed two CHA systems, TNT7-8 and TNT8-10, for miR-224, and the fluorophores used were FAM and Cy5. The DNA circuit was cycled at different ratios, and the reaction conditions were 37°C, 1×TBE buffer, Mg 2+ concentration of 5 mM, reaction time of 2 h, and the final concentration of each component was 300 nM. After the reaction, fluorescence detection at a given emission / absorption wavelength was performed using a steady-state fluorescence spectrometer.

[0093] Figure 10Fluorescence changes of the CHA circuit. As can be seen from the figure, the fluorescence recovery effects of the two CHA circuits are significant, both exceeding 15 times, proving that the CHA circuit with the above coding method has good detection sensitivity. And compared with the traditional CHA system designed for miR-224, it has better sensitivity. In addition, by comparing the two encoded CHA systems, it can be found that the fluorescence recovery effect of TNT8-10 is higher, but the background under the condition of TM+H1+H2 is also higher, while TNT7-8 has a lower background under the same concentration of the target, and is more suitable for the detection of low-abundance target substances. Therefore, next, the orthogonality of the orthogonal fluorescence coding system of TNT7-8 and its orthogonal detection ability will be explored emphatically.

[0094] Example 8 Construction and testing of orthogonal-encoded fluorescence circuits

[0095] According to the above method, in this example, multiple sets of CHA circuits of the TNT7-8 type were constructed for different tumor marker miRNAs (such as miR-21, miR-205, miR-375), and the orthogonal detection ability between different CHA fluorescence circuits was verified.

[0096] To verify the orthogonality of the detection, in this example, two designed orthogonal CHA circuits were selected, and the detection targets were miR-375 and miR-205 respectively. At the same time, three miRs (miR-375, miR-205, miR-21) were selected as the targets and detection impurities of the system. The specificity of the two CHA systems for detecting the targets and the orthogonality of the circuits were detected in single systems and mixed systems.

[0097] Figure 11 Detection of three miRs in single and mixed systems by CHA-375 and CHA-205. Figure 12 Detection of miR-205 and miR-21 by the traditional CHA circuit. It can be found that only when the target exists, the encoded CHA circuit produces specific fluorescence output, and the presence of other targets and CHA circuits does not significantly affect the detection efficiency of CHA, proving that the computer-aided encoded CHA circuit's specificity for the target and the good orthogonality between circuits can significantly enhance its detection effect on the target. At the same time, the sensitivity of the encoded CHA circuit, that is, the fluorescence recovery effect, can significantly improve its orthogonal effect.

[0098] Example 9 Application of actual miRNA detection effect

[0099] To evaluate the detection performance of the CHA circuit in the complex diluted body fluid environment faced during the actual liquid biopsy process, the present invention constructs a simulation environment. Specifically, a system containing 0.5% fetal bovine serum (FBS) and mixed with a variety of random sequences is used to simulate the diluted body fluid environment during the liquid biopsy process. The experimental conditions are similar to those of the orthogonal detection experiment, except that 0.5% FBS is additionally added to the reaction system, and 3-4 random sequences with random concentrations (the concentration range is 0.1-10 times the concentration of the detection target) are introduced.

[0100] Under this simulation environment, we selected the above three CHA systems to detect their detection efficiency and orthogonal detection situation in the simulated actual detection environment (as Figure 13 shown). We found that in the simulated body fluid environment, whether it is a single detection system or a complex mixed system, both show good orthogonal detection ability. At the same time, in the 0.5% FBS environment, compared with the buffer environment, although the detection effect shows a significant decline, its fluorescence recovery efficiency can still be maintained above 80%, which fully demonstrates that the CHA system has the actual ability to detect miRNA in a complex environment. In summary, the fluorescence encoding method proposed in this study has potential application value for expansion, and is expected to be combined with other miRNA extraction methods, etc., so as to achieve the simultaneous and efficient detection of multiple miRNAs.

[0101] The foregoing description of specific exemplary embodiments of the present invention is for purposes of illustration and exemplification. These descriptions are not intended to limit the invention to the precise forms disclosed, and it is apparent that many changes and variations are possible in light of the above teaching. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the invention and its practical applications, so that those skilled in the art can implement and utilize the various different exemplary embodiments of the invention, as well as various different selections and changes. Any equivalent embodiments or modifications made without departing from the spirit of the invention should be included within the protection scope of the invention.

Claims

1. A computer-aided orthogonal DNA fluorescence coding system, characterized in that: The basic modules of CHA are designed and generated, and each module is orthogonal to each other, and all modules eventually form a logic circuit; fluorescence encoding is performed on different CHA circuits, and a CHA fluorescence encoding system is constructed for the detection of multiple miRNA targets.

2. The system according to claim 1, characterized in that The basic modules of CHA are accurately generated with the help of computers, including the division of the basic modules of CHA and the generation plan of the basic module database.

3. The system according to claim 1, characterized in that According to the logical principle of complementary pairing, CHA orthogonal circuits were constructed by comparing different miRs.

4. The design scheme of the CHA circuit fluorescence coding system based on the computer-aided design of claim 2 is characterized in that: The restrictions on the basic module database are: Sequence length is limited to: 7-8 bases; GC ratio: 40-60%; The similarity between sequences meets the requirement that the length of consecutive identical base segments between sequences does not exceed 3; Complementarity requirement: The number of consecutive bases that can complement each other between sequences shall not exceed 3.

5. The design scheme of the CHA circuit fluorescence coding system based on the computer-aided design of claim 2 is characterized in that: The restrictions on the basic module database are: Sequence length is limited to: 8-10 bases; GC ratio: 40-60%; The similarity between sequences meets the requirement that the length of consecutive identical base segments between sequences does not exceed 4; Complementarity requirement: The number of consecutive bases that can be complementary between sequences shall not exceed 4.

6. The design scheme of the CHA circuit fluorescence coding system based on the computer-aided design of claim 2 is characterized in that: The restrictions on the basic module database are: Sequence length was limited to: 14-15 bases; CG ratio: 40-60%; The similarity between sequences meets the requirement that the length of consecutive identical base segments between sequences does not exceed 5; Complementarity requirement: The number of consecutive bases that can complement each other between sequences shall not exceed 5.

7. A method for designing a computer-aided orthogonal DNA fluorescent coding system, characterized in that: The following steps are involved: (1) Generation of CHA circuit basic module database; (2) CHA circuit is based on the orthogonal coding method of the database; (3) Fluorescence coding method of the encoded orthogonal CHA circuit system.

8. The method according to claim 7, characterized in that In step (2), the hairpin loop, the basic element of CHA, is modularized, sequences are selected from the basic database, and the CHA orthogonal system is constructed based on the chain displacement principle and base complementary pairing rules.

9. The method according to claim 7, characterized in that: In step (3), two specific fluorophore encoding sites, H1 and H2, are set in different CHA systems, and the CHA circulation system is used to make the final signal output contain two variables; Performing modification operations based on the variables on fluorophores with less crosstalk between each other; The fluorophores used for modification include: Alexa-405, FAM, Cy3, and Cy5; Based on the two sites H1 and H2, a variety of fluorescence output combinations can be generated.

10. Application of the computer-aided designed orthogonal DNA fluorescence encoding system of claim 1 for detecting multiple miRNAs.

Images