A kasp molecular marker related to salt tolerance of sorghum, primer and application thereof

Abstract

The present application relates to the technical field of molecular marker development and molecular marker assisted breeding, and specifically discloses a KASP molecular marker related to salt tolerance of sorghum, a primer and application thereof.The KASP molecular marker is ST1.1 as shown in SEQ ID NO.1, and the base at 100bp of the sequence shown in SEQ ID NO.1 has T / C polymorphism.The KASP molecular marker ST1.1 provided by the present application is used for identifying salt tolerance of sorghum, and through KASP genotyping detection, the genotype of a sample with strong FAM fluorescence signal is T / T, which is salt-tolerant germplasm;the genotype of a sample with strong HEX fluorescence signal is C / C, which is salt-sensitive germplasm.

Description

Technical Field

[0001] This invention relates to the fields of molecular marker development and molecular marker-assisted breeding technology, specifically to a KASP molecular marker, primers, and their applications related to salt tolerance in sorghum. Background Technology

[0002] sorghum ( Sorghum bicolor As a highly efficient C4 crop, *Lycium chinense* (L.) has become a strategic "pioneer crop" for the development of saline-alkali marginal lands globally due to its outstanding drought, salt, and barrenness tolerance. Under saline-alkali stress, plants face severe challenges throughout their entire growth cycle, from seed germination to reproductive growth: seed germination rates are significantly reduced, root development is inhibited leading to weakened absorption, ion homeostasis imbalances cause metabolic disorders, and leaf photosynthetic efficiency declines, accelerating senescence, ultimately resulting in a sharp reduction in biomass and yield loss. Notably, some sweet sorghum varieties have demonstrated strong adaptability in saline-alkali lands, producing up to 7 tons of biomass per mu (approximately 0.067 hectares), providing an important solution for ensuring food security and bioenergy supply. However, current research still has significant shortcomings—the molecular mechanisms by which salt tolerance is synergistically regulated by a multi-gene network remain unclear, and breakthroughs in the discovery and analysis of key functional genes are urgently needed. Although traditional breeding has achieved some success, it is still limited by the genetic characteristics of complex quantitative traits. There is an urgent need to combine molecular marker-assisted breeding and genome editing technology to accelerate the breeding of new varieties with high resistance and quality. This is of strategic significance for improving the productivity of marginal land and addressing the global trend of increasing soil salinization.

[0003] Molecular marker technology is a core tool for crop genetic improvement. While first-generation markers (such as RFLP) and second-generation markers (such as SSR) are widely used, they suffer from limitations such as high cost, low throughput, and complex operation. With the rapid popularization of high-throughput sequencing technology, the development efficiency of molecular markers based on single nucleotide polymorphisms (SNPs) has significantly improved, and their numbers have grown exponentially. Against this backdrop, third-generation marker KASP (competitive allele-specific PCR) has become the mainstream technology for crop molecular breeding due to its advantages of high throughput, low cost, and high accuracy. KASP technology uses SNP sites as the core detection target and achieves efficient genotyping of massive numbers of SNP markers through optimized primer design and fluorescence detection systems, perfectly meeting the application requirements of high-throughput and low-cost molecular markers in the genomics era. Compared with traditional markers, KASP technology does not require complex electrophoresis equipment, reduces the cost per reaction by more than 50%, and is suitable for screening populations of tens of thousands, with a daily detection throughput of tens of thousands of samples, significantly improving breeding efficiency. It is necessary to develop a KASP molecular marker related to salt tolerance in sorghum. Summary of the Invention

[0004] To develop a KASP molecular marker associated with salt tolerance in sorghum, this invention provides a KASP molecular marker, primers, and their applications. The KASP molecular marker provided by this invention enables early auxiliary prediction and identification of salt tolerance phenotypes in sorghum seedlings, and can quickly identify potentially high-quality target individual plants or a large number of progeny, thereby shortening the sorghum breeding cycle and improving breeding efficiency.

[0005] This invention provides a KASP molecular marker related to salt tolerance in sorghum, wherein the KASP molecular marker is ST1.1;

[0006] The nucleotide sequence of the molecular marker ST1.1 is shown in SEQ ID NO.1. The base at 100 bp of the molecular marker ST1.1 exhibits T / C polymorphism.

[0007] The KASP molecular marker ST1.1 provided by this invention is used to identify the salt tolerance of sorghum. Through KASP genotyping detection, the genotype of samples with strong FAM fluorescence signal is T / T, which is salt-tolerant; the genotype of samples with strong HEX fluorescence signal is C / C, which is salt-sensitive.

[0008] The present invention also provides a primer set for amplifying the KASP molecular marker, the primer set comprising two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.4.

[0009] The present invention also provides a kit comprising the aforementioned primer set.

[0010] The present invention also provides a chip comprising the aforementioned primer set.

[0011] Furthermore, the primer set is a solid powder or a liquid reagent.

[0012] This invention also provides a method for identifying salt-tolerant sorghum varieties, comprising the following steps:

[0013] Extract DNA from the sorghum stalks to be tested;

[0014] The extracted sorghum DNA was subjected to a KASP reaction using the primer set or the kit described above to obtain the reaction product.

[0015] The reaction products were placed in a KASP genotyping device for fluorescence signal reading. Cluster analysis was performed based on the FAM and HEX fluorescence intensities to obtain genotypes at polymorphic sites. The genotype of samples with strong FAM fluorescence signals was T / T, indicating salt-tolerant germplasm; the genotype of samples with strong HEX fluorescence signals was C / C, indicating salt-sensitive germplasm.

[0016] The present invention also provides the application of the KASP molecular marker related to salt tolerance of sorghum, the primer set, or the kit in identifying salt-tolerant sorghum varieties.

[0017] Furthermore, using the sorghum DNA to be tested as a template, PCR amplification was performed using the two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and the universal reverse primer shown in SEQ ID NO.4 to obtain the reaction product;

[0018] The reaction products were placed in a KASP genotyping device for fluorescence signal reading. The criteria for determining salt-tolerant sorghum varieties were as follows: when the fluorescence signal of the PCR product was close to the Y-axis representing the HEX fluorescence signal, the genotype was C / C, and the sorghum sample to be tested was determined to be salt-sensitive; when the fluorescence signal of the PCR product was close to the X-axis representing the FAM fluorescence signal, the genotype was T / T, and the sorghum sample to be tested was determined to be salt-tolerant.

[0019] Furthermore, the PCR amplification system consisted of: 5 μL of 50 ng / μL DNA template, 10 μL of 2×KASP Master mix, 0.2 μL each of the two 10 μM upstream primers, 0.6 μL of the 10 μM downstream primer, and water added to a final volume of 20 μL.

[0020] Furthermore, the PCR reaction program included: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 62℃ annealing and extension for 1 min, for 10 cycles; 95℃ denaturation for 15 s, 57℃ annealing and extension for 1 min, for 32 cycles.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] The KASP molecular marker ST1.1 provided by this invention is used to identify salt tolerance in sorghum. Using sorghum DNA as a template, PCR amplification is performed using two specific forward primers shown in SEQ ID NO.2–SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.4 to obtain the reaction product. The reaction product is then placed in a KASP genotyping device for fluorescence signal reading. The criteria for determining salt-tolerant sorghum varieties are as follows: when the fluorescence signal of the PCR product is close to the Y-axis representing the HEX fluorescence signal, the genotype is C / C, and the sorghum sample is determined to be salt-sensitive; when the fluorescence signal of the PCR product is close to the X-axis representing the FAM fluorescence signal, the genotype is T / T, and the sorghum sample is determined to be salt-tolerant.

[0023] This invention only requires PCR amplification of leaf DNA from salt-tolerant germplasm using the KASP primer set developed in this invention, followed by detection of its fluorescence signal, to achieve early auxiliary prediction and identification of salt tolerance phenotypes in sorghum seedlings. This method is simple to operate, economical, practical, and highly efficient in screening, enabling rapid identification of potentially high-quality target individual plants or large numbers of progeny, thereby shortening the sorghum breeding cycle and improving breeding efficiency.

[0024] The KASP molecular marker provided by this invention, compared with other marker types such as SSR and InDel, only requires PCR for detection, without the need for sequencing, silver staining, or band reading operations. It is simple, fast, and low in cost. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 Correlation analysis of chlorophyll decrease and propylene glycol.

[0027] Figure 2 QTL mapping for the F2 population of Bayeqi / PL212.

[0028] Figure 3 The F2 population typing results for Bayeqi / PL212;

[0029] In the figure, a is the genotyping diagram of the KASP molecular marker ST1.1 in 172 sorghum individual plants;

[0030] b represents the decrease in chlorophyll content of individual plants with different genotypes under salt treatment.

[0031] Figure 4 The results of 70 natural resource classifications;

[0032] In the figure, a is the genotyping diagram of the KASP molecular marker ST1.1 in 70 sorghum individual plants;

[0033] b represents the decrease in chlorophyll content of individual plants with different genotypes under salt treatment. Detailed Implementation

[0034] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0035] Example 1: A KASP molecular marker, primers and their applications related to salt tolerance in sorghum.

[0036] I. Evaluation Methods for Salt Tolerance in Sorghum Seedlings

[0037] Use round pots with a diameter of 0.50 m and a height of 0.40 m. Fill each pot with 8.00 kg of air-dried soil. Add 4 L of 240 mM sodium chloride (NaCl) to the salt treatment group and 4 L of water to the control group. Add distilled water to adjust the soil moisture content to 28% (by weight). Let the soil stand for 2 hours to allow it to dry before sowing.

[0038] Forty sorghum seeds were sown in each pot, and the indicators were measured 40 days after sowing, at the 7-leaf stage.

[0039] Collect the fully expanded leaves from the top of each surviving plant in each pot, take 0.5 g of leaf sample, add 95% ethanol, grind and centrifuge to collect the supernatant; the precipitate is washed twice with ethanol and centrifuged, the two supernatants are combined and the volume is adjusted to 25 mL; the absorbance at wavelengths of 470 nm, 663 nm and 646 nm is measured using a spectrophotometer, and the chlorophyll content is calculated according to the formula of Lichtenthaler & Wellburn (1983).

[0040] Based on the absolute percentage decrease in chlorophyll content of plants in the salt-treated group compared to the control group, a five-level salt tolerance evaluation standard was established: a decrease rate >45% was level 5 (salt-sensitive), 35-45% was level 4, 25%-35% was level 3, 15%-25% was level 2, and ≤15% was level 1 (salt-tolerant).

[0041] To verify the reliability of the newly constructed salt tolerance evaluation standard, correlation analysis revealed a significant positive correlation between the reduction in chlorophyll and the traditional method of using malondialdehyde to identify salt tolerance. Figure 1 Therefore, the reduction in chlorophyll content can characterize the salt tolerance of sorghum seedlings. The newly established method is simple and reliable, requiring no kits or multiple reagents, and only alcohol and a spectrophotometer are needed to quickly assess the salt tolerance of sorghum seedlings.

[0042] II. Location of QTLs and Determination of Molecular Markers

[0043] 1. Group building

[0044] The salt-tolerant variety Bayeqi was used as the male parent, and the salt-sensitive variety PL212 was used as the female parent, with similar chlorophyll content in the seedling stage. Hybrid combinations were constructed in 2018, and Table 1 shows the process of obtaining the family lines.

[0045] Table 1. Process of obtaining family pedigree

[0046]

[0047] 2. Field trials and phenotypic statistics

[0048] The F2 population was planted in the potted plant area of ​​the Shenyang Experimental Base in May 2019. The specific planting method was the same as described above, and the phenotypic identification method was the same as described above for the detection and evaluation standards of chlorophyll reduction.

[0049] 3. Positioning of QTL

[0050] Based on a five-level salt tolerance evaluation system, this invention selected extreme phenotypic populations (30 level 1 salt-tolerant progeny plants and 30 level 5 salt-tolerant progeny plants) to construct salt-tolerant and salt-sensitive mixed pools, respectively, and conducted whole-genome resequencing analysis using parental materials. After sequencing on the Illumina platform and strict quality control, 49.807 Gb of high-quality clean data was finally obtained. The sequencing data were aligned to the sorghum reference genome Sorghumbicolor v3.1.1 using Burrows-Wheeler Aligner (BWA v0.7.17). The results showed that the average sequencing depth of both parents reached over 10×, and the coverage of the mixed pools was close to 20×, with the 1× genome coverage of the samples exceeding 90% (Table 2).

[0051] Variation detection was performed using the Genome Analysis Toolkit (GATK v4.2.6.1), identifying 903,025 single nucleotide polymorphisms (SNPs) and 438,453 insertion / deletion markers (InDels). Based on a parental homozygous differential screening strategy, 327,929 SNPs and 236,111 InDel polymorphic markers were obtained for subsequent analysis. The SNP-index and InDel-index of the offspring population were calculated among the parents, and Δ(SNP-index) and Δ(InDel-index) distribution maps were constructed. A 95% confidence threshold (P<0.05) was determined after 1000 permutation tests, ultimately locating the key QTL regulating salt tolerance in seedlings to the 26.78-27.26 Mb region of chromosome 9, named [QTL name missing]. ST1 ( Salt Tolerance 1 ) site ( Figure 2 ).

[0052] Table 2. Positioning of QTL

[0053]

[0054] 4. Tag Development

[0055] according to ST1 The physical location information of the site was used to search for the variation in the interval using VCF files. Finally, an SNP variation was found in both parents at Chr09:26,790,518, which can be used to develop a KASP molecular marker and was named ST1.1.

[0056] The nucleotide sequence of the molecular marker ST1.1 is shown in SEQ ID NO.1, and the base at 100 bp in this sequence has a T / C polymorphism.

[0057] SEQ ID NO.1:

[0058] CTTGGAATCAGCGCGATCAAGTGCTCGGAGAAGATCCGAGCCGTCGATCTTCTTTCCCTTGTAGCGCGGGAGCGGTGGTCGGGTGCTCGGTGCCAGTATCCATGTGGTCGGAACCGGCGCCGCCGCAGATTGGATCTGGGTTCCTTCCGAAACCGTGGTCGTGAGACCGCCGCCGTGCATCGTCCACGTGATCTGGCCGA.

[0059] Among them, sorghum with genotype TT or TC is a salt-tolerant variety; sorghum with genotype CC is a salt-sensitive variety.

[0060] III. Design of Molecular Marker Primers

[0061] The molecular marker primer set consists of forward primer Ft, forward primer Fs, and universal reverse primer R. The nucleotide sequence of forward primer Ft is shown in SEQ ID NO.2; the nucleotide sequence of forward primer Fs is shown in SEQ ID NO.3; and the nucleotide sequence of universal reverse primer R is shown in SEQ ID NO.4. Detailed sequences are shown in Table 3 below.

[0062] Table 3 Design of molecular marker primer sets

[0063]

[0064] Note: The lowercase part is the connector sequence FAM and HEX.

[0065] IV. Correlation Analysis of KASP Fluorescence Detection Results and Salt Tolerance in Sorghum Seedlings

[0066] S1. During the seedling stage, 172 individual plants from the F2 population in Table 1 were selected, and sorghum germplasm leaf samples with a length and width of about 1 cm were taken and placed in a deep well plate (96 wells, 2 mL). After freeze-drying, steel balls were added, and the samples were ground at 50 Hz until they were completely crushed.

[0067] S2. DNA was extracted using a modified CTAB method to obtain genomic DNA from the sample.

[0068] S3. Use the primer set or kit for amplifying ST1.1 to perform PCR amplification on the extracted DNA to obtain the PCR amplification product.

[0069] The PCR amplification system consisted of: 5 μL of 50 ng / μL DNA template, 10 μL of 2×KASP Master mix, 0.2 μL each of the two 10 μM upstream primers, 0.6 μL of the 10 μM downstream primer, and water to a final volume of 20 μL.

[0070] The PCR reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 62℃ annealing and extension for 1 min, 10 cycles; 95℃ denaturation for 15 s, 57℃ annealing and extension for 1 min, 32 cycles.

[0071] S4. The PCR reaction products were placed in a KASP genotyping device for fluorescence signal reading. Cluster analysis was performed based on the FAM and HEX fluorescence intensities to obtain the genotypes at polymorphic sites. 34 samples showed HEX fluorescence, indicating a C / C genotype; 97 samples showed comparable HEX and FAM fluorescence, indicating a T / C genotype; and 41 samples showed FAM fluorescence, indicating a T / T genotype. Since the chlorophyll content of both parents was similar at the seedling stage, the method in Example 1 could be used to obtain the difference in chlorophyll reduction between the salt-treated and untreated parents. One-way ANOVA revealed that the chlorophyll reduction in the T / T genotype was significantly lower than that in the T / C genotype, and the chlorophyll reduction in the T / C genotype was significantly lower than that in the CC genotype. Figure 3 Therefore, materials with the TT genotype exhibit stronger salt tolerance than those with the T / C and C / C genotypes. This demonstrates that the KASP primer set of this invention is specific for the salt tolerance phenotype in sorghum.

[0072] V. Genotyping of Sorghum Natural Resources Using Molecular Markers

[0073] The genotypes of over 70 natural sorghum germplasm resources were detected using the molecular marker ST1.1, and the decrease in chlorophyll content in sorghum leaves under salt stress was also measured. The genotyping results of the over 70 natural sorghum germplasm resources are shown in Table 4.

[0074] Table 4. Genotypes of over 70 sorghum germplasm resources

[0075]

[0076] The results are as follows Figure 4 As shown. Cluster analysis was performed based on FAM and HEX fluorescence intensities to obtain genotypes at polymorphic sites. 35 samples showed HEX fluorescence, indicating a C / C genotype; 3 samples showed comparable HEX and FAM fluorescence, indicating a T / C genotype; and 41 samples showed FAM fluorescence, indicating a T / T genotype. One-way ANOVA revealed that the chlorophyll decrease in materials carrying the T / T genotype was significantly lower than that in materials carrying the C / C genotype; therefore, the salt tolerance of the T / T genotype was significantly higher than that of the C / C genotype. Figure 4 Since all materials used were self-pollinated in bags, only 3 heterozygous plants were found at this site, and the statistical analysis of salt tolerance may be biased; therefore, they were not included in the statistics. In summary, ST1.1 is not only applicable to the offspring of Bayeqi / PL212, but can also be directly used for salt tolerance testing of natural sorghum populations. It has universality and can be used on a large scale for screening salt-tolerant materials.

[0077] It should be noted that all sorghum germplasm resources in this invention were provided by the germplasm resource bank of the Sorghum Research Institute of Liaoning Academy of Agricultural Sciences.

[0078] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0079] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A KASP molecular marker associated with salt tolerance in sorghum, characterized in that, The KASP molecule is labeled ST1.1; The nucleotide sequence of the molecular marker ST1.1 is shown in SEQ ID NO.

1. The base at 100 bp of the molecular marker ST1.1 has a T / C polymorphism. When the genotype is TT or TC, the sorghum is a salt-tolerant variety; when the genotype is CC, the sorghum is a salt-sensitive variety.

2. A primer set, characterized in that, The primer set is used to amplify the KASP molecular marker as described in claim 1, and the primer set includes two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.

4.

3. A reagent kit, characterized in that, It includes the primer set as described in claim 2.

4. A chip, characterized in that, It includes the primer set as described in claim 2.

5. The reagent kit according to claim 3 or the chip according to claim 4, characterized in that, The primer set is a solid powder or a liquid reagent.

6. A method for identifying salt-tolerant sorghum varieties, characterized in that, Includes the following steps: Extract DNA from the sorghum stalks to be tested; The extracted sorghum DNA to be tested was subjected to a KASP reaction using the primer set described in claim 2 or the kit described in claim 3 to obtain the reaction product; The reaction products were placed in a KASP genotyping device for fluorescence signal reading. Cluster analysis was performed based on the FAM and HEX fluorescence intensities to obtain genotypes at polymorphic sites. The genotype of samples with strong FAM fluorescence signals was T / T, indicating salt-tolerant germplasm; the genotype of samples with strong HEX fluorescence signals was C / C, indicating salt-sensitive germplasm.

7. The application of the KASP molecular marker related to salt tolerance of sorghum as described in claim 1, the primer set as described in claim 2, or the kit as described in claim 3 in the identification of salt-tolerant sorghum varieties.

8. The application according to claim 7, characterized in that, Using the sorghum DNA to be tested as a template, PCR amplification was performed using the two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and the universal reverse primer shown in SEQ ID NO.4 to obtain the reaction product; The reaction products were placed in a KASP genotyping device for fluorescence signal reading. The criteria for determining salt-tolerant sorghum varieties were as follows: when the fluorescence signal of the PCR product was close to the Y-axis representing the HEX fluorescence signal, the genotype was C / C, and the sorghum sample to be tested was determined to be salt-sensitive; when the fluorescence signal of the PCR product was close to the X-axis representing the FAM fluorescence signal, the genotype was T / T, and the sorghum sample to be tested was determined to be salt-tolerant.

9. The application according to claim 8, characterized in that, The PCR amplification system consisted of: 5 μL of 50 ng / μL DNA template, 10 μL of 2×KASP Master mix, 0.2 μL each of the two 10 μM upstream primers, 0.6 μL of the 10 μM downstream primer, and water to a final volume of 20 μL.

10. The application according to claim 8, characterized in that, The PCR reaction program included: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 62℃ annealing and extension for 1 min, 10 cycles; 95℃ denaturation for 15 s, 57℃ annealing and extension for 1 min, 32 cycles.

Images