Virus-like particle for expressing mIL21 and 4-1BBL and application of virus-like particle in in-vitro amplification of NK cells

Amplification of NK cells by virus-like particles (B21-VLP) expressing mIL21 and 4-1BBL solves the complexity and side effects of existing CAR-T cell therapy, and achieves efficient amplification and strong killing ability of NK cells.

CN120209100AActive Publication Date: 2025-06-27HEBEI JINYAO BIOTECHNOLOGY CO LTD
View PDF 17 Cites 0 Cited by

Patent Information

Application Number
CN202510382002.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-06-27
Estimated Expiration
2045-03-28

AI Technical Summary

Technical Problem

The existing CAR-T cell therapy has problems such as graft-versus-host disease, complex production process, long cycle and high cost. At the same time, some patients will experience side effects such as cytokine release syndrome and neurotoxic effects after treatment.

Method used

Virus-like particles (B21-VLP) expressing mIL21 and 4-1BBL were used to amplify NK cells, and efficient amplification of NK cells was achieved through the expression of VLP, and the tumorigenic risk of K562 cells was avoided.

Benefits of technology

Efficient expansion of NK cells was achieved. NK cells accounted for more than 90% of the total cell content on day 21 of culture, and had strong killing ability to tumor cells, reducing the risk of treatment side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120209100A_ABST
    Figure CN120209100A_ABST
Patent Text Reader

Abstract

The invention discloses a virus-like particle for expressing mIL21 and 4-1BBL and application of the virus-like particle in in-vitro amplification of NK cells, the brand new virus-like particle for expressing mIL21 and 4-1BBL is creatively constructed for the first time, efficient amplification of the NK cells is achieved, and the tumorigenic risk of K562 cells is avoided. The method has a wide application prospect in the technical field of in-vitro amplification of NK cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to a virus-like particle expressing mIL21 and 4-1BBL and its application in in vitro expansion of NK cells. Background Art

[0002] Genetically modifying immune cells through chimeric antigen receptors (CARs) to target and kill tumor cells is an effective cancer treatment method. Currently, T cell-based CAR-T cell therapy has been clinically applied. Although CAR-T cells have obvious anti-tumor activity, there are still certain clinical limitations. Allogeneic CAR-T can cause severe graft-versus-host disease (GVHD). Therefore, currently, most CAR-Ts are produced based on autologous cells, with a complex production process, long cycle, and high cost. In addition, some patients will experience severe side effects after CAR-T treatment, such as cytokine release syndrome (CRS) and neurotoxicity.

[0003] Natural killer cells (NK cells), which are also immune cells, have natural advantages in tumor treatment. NK cells have non-specific target recognition and killing mechanisms, can kill tumor cells in a non-MHC-restricted manner, do not require prior antigen sensitization, have strong immune surveillance and killing functions, and have multiple cytotoxic mechanisms. They can regulate immune responses by producing cytokines and play key roles in both innate and adaptive immune responses. Moreover, NK cells have killing functions against almost common tumor cells such as lung cancer, liver cancer, breast cancer, and lymphoma, showing broad-spectrum anti-tumor effects.

[0004] CAR-NK cell therapy based on NK cells modifies NK cells obtained from different sources through genetic engineering to express chimeric antigen receptor CAR, enhancing their biological functions, and then injecting them into patients to specifically kill tumor cells. Currently, the therapeutic effect of umbilical cord blood-derived allogeneic CAR-NK cells in lymphoma has been verified, and it has also been confirmed that they do not cause severe graft-versus-host reactions, have a low risk of cytokine storm, are easy to scale up production, and can be ready-to-use. Therefore, CAR-NK has great potential to be developed into a "universal" cell therapy product.

[0005] The application range of allogeneic CAR-NK is 1×10 6 -8×10 7 CD3-CD56+NK cells per kilogram of body weight of the patient, and multiple infusions are required. However, the proportion of NK cells in peripheral blood is only about 5-15%, and only about 15%-30% in umbilical cord blood. Therefore, it is necessary to expand NK cells in large numbers before adoptive immunotherapy. Summary of the Invention

[0006] In view of this, the object of the present invention is to provide a virus-like particle expressing mIL21 and 4-1BBL and its application in in vitro expansion of NK cells in the art.

[0007] Virus-like particles (VLPs) are highly structured protein particles self-assembled from single or multiple structural proteins of a virus, and are similar to natural virus particles in morphological structure. VLPs lack regulatory proteins and infectious nucleic acids, have no replication ability, and have advantages such as high safety. The present invention aims to use VLPs to express mIL21 and 4-1BBL to achieve NK cell expansion and avoid the oncogenic risk of K562 cells.

[0008] The present invention adopts the following technical solutions to achieve the above-mentioned invention object:

[0009] In the first aspect of the present invention, a virus-like particle B21-VLP expressing mIL21 and 4-1BBL is provided.

[0010] Further, the B21-VLP is composed of the following operably linked elements connected in sequence: mIL21, T2A, 4-1BBL, T2A, VSV-G;

[0011] The amino acid sequence of the mIL21 is as shown in SEQ ID NO.16, and the amino acid sequence of the 4-1BBL is as shown in SEQ ID NO.17.

[0012] Further, the amino acid sequence of the VSV-G is as shown in SEQ ID NO.18;

[0013] Optionally, the base sequence of the mIL21 is as shown in SEQ ID NO.20, and the base sequence of the 4-1BBL is as shown in SEQ ID NO.21;

[0014] Optionally, the base sequence of the VSV-G is as shown in SEQ ID NO.22.

[0015] In the present invention, the mIL21 is the same as mbIL21, and mbIL21 is obtained by molecular modification on the basis of mouse IL21. It usually contains the functional domains of IL21, and these domains are crucial for its binding to the receptor and exerting biological activity. It has functions such as immunomodulation, anti-tumor, and anti-virus. In a specific embodiment of the present invention, the amino acid sequence of the mIL21 is as shown in SEQ ID NO.16.

[0016] In the present invention, the 4-1BBL refers to the 4-1BB ligand, also known as CD137L, which is a member of the tumor necrosis factor superfamily and plays an important role in the immune system. 4-1BBL is a type II transmembrane protein composed of 306 amino acids. Its extracellular region contains 171 amino acids and can be proteolytically cleaved to form soluble 4-1BBL. It has typical structural characteristics of the tumor necrosis factor superfamily, including a β-sheet structure and multiple α-helices, which are crucial for its binding to receptors and signal transduction. In a specific embodiment of the present invention, the amino acid sequence of the 4-1BBL is as shown in SEQ ID NO.17.

[0017] In the present invention, the T2A is a 2A peptide sequence derived from the foot-and-mouth disease virus (FMDV). The 2A peptide is a short peptide that can cause the viral polyprotein to self-cleave post-translationally during viral infection, generating multiple independent functional proteins. The T2A peptide is usually composed of about 20 amino acids and has a specific amino acid sequence and spatial structure. T2A can link different types of genes, whether encoding structural proteins or regulatory proteins, etc., and can effectively achieve co-expression. In a specific embodiment of the present invention, the amino acid sequence of the T2A is as shown in SEQ ID NO.19.

[0018] In the present invention, the VSV-G refers to the Vesicular Stomatitis Virus Glycoprotein, which is a transmembrane glycoprotein composed of 511 amino acids with a molecular weight of about 67 kDa. In a specific embodiment of the present invention, the amino acid sequence of the VSV-G is as shown in SEQ ID NO.18.

[0019] The second aspect of the present invention provides a method for constructing a virus-like particle B21-VLP expressing mIL21 and 4-1BBL.

[0020] Furthermore, the construction method includes the following steps:

[0021] (1) Construct a B21-VSVG envelope plasmid:

[0022] (2) Transfect a host cell with the B21-VSVG envelope plasmid to construct B21-VLP.

[0023] Furthermore, the construction of the B21-VSVG envelope plasmid includes the following steps:

[0024] (1) Obtain the mIL21 and 4-1BBL fragments by gene synthesis as Fragment 1. The amino acid sequence of the mIL21 is as shown in SEQ ID NO.16, and the amino acid sequence of the 4-1BBL is as shown in SEQ ID NO.17;

[0025] (2) Using pMD2.G as the plasmid backbone, digest it with the EcoRⅠ restriction endonuclease to obtain Fragment 2;

[0026] (3) Using pMD2.G as the plasmid template, obtain Fragment 3 by PCR. Design the primer VSVG-F1, and the amino-terminal sequence from the 5'-end to the 3'-end is as shown in SEQ ID NO.1. Use homologous recombination to design homologous arms and add them to the 5'-end, and the amino-terminal sequence is as shown in SEQ ID NO.2. Design the 3'-end primer VSVG-R1, and the amino-terminal sequence from the 5'-end to the 3'-end is as shown in SEQ ID NO.3;

[0027] (4) Use homologous recombinase to ligate the obtained Fragment 1, Fragment 2, and Fragment 3 to obtain the complete plasmid, which is the B21-VSVG envelope plasmid.

[0028] Furthermore, constructing B21-VLP by transfecting host cells with the B21-VSVG envelope plasmid includes the following steps:

[0029] (1) Mix the envelope plasmid B21-VSVG, the helper plasmid pMDLg, and pRSV as Solution A. Take PEI and mix it with the culture medium as Solution B. Mix Solutions A and B to obtain the AB mixture, and add the AB mixture to the host cell culture medium to culture the host cells;

[0030] (2) Perform a medium change operation after 3 - 5 h;

[0031] (3) Perform feeding after 20 - 22 h;

[0032] (4) Harvest after 48 h of packaging to obtain B21-VLP.

[0033] In some embodiments, the culture conditions of the host cells are in an incubator at 37°C with 5% CO2, and shake culture at 125 rpm.

[0034] Furthermore, the dosages of the envelope plasmid and the helper plasmid are respectively: B21-VSVG (1 - 10) μg, pMDLg (5 - 50) μg, pRSV (1 - 10) μg;

[0035] Optionally, the dosages of the envelope plasmid and the helper plasmid are respectively: B21-VSVG 5 μg, pMDLg 20 μg, pRSV 5 μg;

[0036] Optionally, the host cell is a 293T cell, a 293 cell, a HEK293F cell, a CHO cell, a Vero cell or a HeLa cell;

[0037] Optionally, the host cell is a 293T cell;

[0038] Optionally, the culture medium is a transient transfection medium, an EmCD HEK293 Plus medium, a CELL-WISE 293 medium CW001, a complete medium M293TI, a glutamine-free medium M293TIS, a glutamine-free and phenol red-free medium M293TINPR or a union293 medium;

[0039] Optionally, the culture medium is a transient transfection medium;

[0040] Optionally, when preparing the solution A, the dosage of the culture medium is 0.5 - 5 mL;

[0041] Optionally, when preparing the solution A, the dosage of the culture medium is 1 mL;

[0042] Optionally, when preparing the solution B, the dosages of the PEI and the culture medium are 25 - 125 μL and 0.5 - 5 mL respectively;

[0043] Optionally, when preparing the solution B, the dosages of the PEI and the culture medium are 75 μL and 1 mL respectively;

[0044] Optionally, the feeding includes supplementing glucose and glutamine.

[0045] In some embodiments, the medium replacement operation includes the following steps: after centrifuging the host cells at 1000 rpm for 5 min, resuspend the cells with 20 mL of the transient transfection medium, and transfer them to a 125 mL cell culture shake flask. Place it in a 37 °C and 5% CO2 incubator and culture with shaking at 125 rpm.

[0046] In some embodiments, the feeding includes the following steps: add 80 μL of 50% glucose injection solution and 800 μL of L-glutamine to a 125 mL cell culture shake flask, slowly shake and mix during this period, place it in a 37 °C and 5% CO2 incubator and culture with shaking at 125 rpm.

[0047] In some embodiments, the harvesting comprises the following steps: transferring the host cell suspension into a centrifuge tube, centrifuging at 2000 rpm for 10 min, taking the supernatant as the virus harvest solution, filtering the virus harvest solution using a 0.45 μm filter membrane, transferring the virus harvest solution into a centrifuge tube, centrifuging at 18300 g for 2 h at 4°C with a ramp of 9 and a hold of 0, and resuspending the virus precipitate using DPBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0048] The third aspect of the present invention provides a composition comprising the B21-VLP described in the first aspect of the present invention.

[0049] The fourth aspect of the present invention provides a culture for expanding NK cells.

[0050] Furthermore, the culture comprises the B21-VLP described in the first aspect of the present invention or the composition described in the third aspect of the present invention.

[0051] The fourth aspect of the present invention provides a method for in vitro expanding NK cells, in vitro culturing or stimulating NK cells.

[0052] Furthermore, the method comprises: contacting NK cells with the B21-VLP described in the first aspect of the present invention, the composition described in the third aspect of the present invention, or the culture described in the fourth aspect of the present invention;

[0053] Optionally, the NK cells are present in the umbilical cord blood mononuclear cell population.

[0054] In some embodiments, umbilical cord blood contains abundant hematopoietic stem cells and various immune cells, including NK cells. The NK cells in umbilical cord blood have some unique characteristics and advantages, such as: low immunogenicity, strong proliferation ability, anti-tumor activity, and immunomodulatory effect.

[0055] The fifth aspect of the present invention provides any of the following applications:

[0056] (1) The application of the B21-VLP described in the first aspect of the present invention, the composition described in the third aspect of the present invention, or the culture described in the fourth aspect of the present invention in in vitro expanding NK cells, in vitro culturing or stimulating NK cells;

[0057] (2) The application of NK cells cultured with the B21-VLP described in the first aspect of the present invention, the composition described in the third aspect of the present invention, or the culture described in the fourth aspect of the present invention in the preparation of anti-tumor drugs.

[0058] In some embodiments, there are no particular limitations on the specific source of the NK cells of the present invention. The sources of the NK cells include, but are not limited to: NK cells derived from bone marrow, NK cells derived from peripheral blood, NK cells derived from peripheral lymphoid tissues, NK cells derived from the thymus, and NK cells derived from non-lymphoid tissues such as the liver, lungs, and intestines.

[0059] In some embodiments, the tumors include, but are not limited to: hematological malignancies and solid tumors. Among them, the hematological malignancies include, but are not limited to: acute myeloid leukemia, non-Hodgkin lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, Hodgkin lymphoma, and multiple myeloma. The solid tumors include, but are not limited to: melanoma, renal cell carcinoma, non-small cell lung cancer, small cell lung cancer, glioblastoma, meningioma, nasopharyngeal carcinoma, oral cancer, breast cancer, esophageal cancer, mediastinal tumor, gastric cancer, liver cancer, colorectal cancer, pancreatic cancer, bladder cancer, prostate cancer, ovarian cancer, cervical cancer, osteosarcoma, Ewing sarcoma, soft tissue sarcoma, skin cancer, and thyroid cancer.

[0060] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0061] The present invention has creatively constructed a novel virus-like particle (B21-VLP) expressing mIL21 and 4-1BBL for the first time, achieving efficient expansion of NK cells and avoiding the tumorigenic risk of K562 cells. In addition, when the B21-VLP stimulates CBMC, it can selectively expand NK cells, and NK cells account for more than 90% of the total cell content on the 21st day of culture. Moreover, the NK cells cultured with the B21-VLP have strong killing ability against tumor cells, and have broad application prospects in the technical field of in vitro expansion of NK cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 : Map of B21-VSVG envelope plasmid;

[0063] Figure 2 : Schematic diagram of the principle of B21-VLP in vitro expansion of NK cells;

[0064] Figure 3 : Schematic structural diagrams of B21-VLP, B-VLP, 21-VLP, and no VSV-B21-VLP;

[0065] Figure 4 : Result diagram corresponding to the influence of the presence or absence of VSV-G structure on the physical titer of VLP;

[0066] Figure 5 : Result diagram of the comparison of the cell expansion effects of VLP with or without VSV-G structure;

[0067] Figure 6 : Results graph corresponding to the increase in the proportion of NK cells in cultured CBMC cells with the increase in the concentration of B21-VLP;

[0068] Figure 7 : Results graph corresponding to the good amplification effect of B21-VLP with a mass of 500 ng on NK cells in CBMC;

[0069] Figure 8 : Results graph of the comparison of the stimulation effects of B21-VLP, B-VLP, and 21-VLP with a mass of 500 ng on CBMC;

[0070] Figure 9 : Results graph of the comparison of the amplification ability effects of B21-VLP constructed in the present invention and K562-41BBL-mbIL21 on NK cells;

[0071] Figure 10 : Results graph of the comparison of the proportion of NK cells in the total cells in the B21-VLP group and the K562-41BBL-mbIL21 group;

[0072] Figure 11 : Results graph of the comparison of the stimulation effects of B21-VLP constructed in the present invention and K562-41BBL-mbIL21 on CBMC;

[0073] Figure 12 : Results graph corresponding to the selective amplification of NK cells when B21-VLP constructed in the present invention stimulates CBMC;

[0074] Figure 13 : Results graph of co-culturing NK cells cultured with B21-VLP as effector cells and K562 tumor cells as target cells at effector-to-target ratios of 10:1, 3:1, and 1:1, and detecting the proportions of effector cells and target cells using a flow analyzer after 24 h. Detailed implementation manners

[0075] The following combines specific embodiments to further elaborate the present invention. The specific embodiments are only used to explain the present invention and cannot be understood as a limitation to the present invention. Those of ordinary skill in the art can understand that: various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and purposes of the present invention, and the scope of the present invention is defined by the claims and their equivalents.

[0076] The reagents and raw materials used in the present invention are easily obtained by those of ordinary skill in the art. Without special instructions, they can all be obtained from commercial sources. For the experimental methods without specific conditions noted in the present invention, the detection is usually carried out according to conventional conditions or the conditions recommended by the manufacturer. In particular, the following examples are only used to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and their results described in the following examples are only used to illustrate the present invention and should not and will not limit the present invention described in detail in the claims.

[0077] Example 1 Construction of B21-VSVG Envelope Plasmid

[0078] 1. Experimental Materials

[0079] The primers were all synthesized by Genewiz (Suzhou) Inc.

[0080] PCR MIX enzyme: Jinsha Biotech, product number SF212;

[0081] AgeⅠ restriction endonuclease: Biolabs, product number R3552SVIAL;

[0082] XholⅠ restriction endonuclease: Biolabs, product number R0146VVIAL;

[0083] EcoRⅠ restriction endonuclease: Biolabs, product number R0101VVIAL;

[0084] Homologous recombination enzyme: Jinsha Biotech, product number SC612;

[0085] Agarose Gel DNA Recovery Kit: Tiangen Biochemical Technology, product number DP209-02;

[0086] Small-scale DNA Extraction Kit: Jinsha Biotech, product number PE707-50.

[0087] 2. Experimental Methods

[0088] (1) Construction of B21-VSVG Envelope Plasmid

[0089] 1) The mbIL21 and 4-1BBL (CD137L) fragments were obtained by gene synthesis as Fragment 1;

[0090] 2) Using pMD2.G as the plasmid backbone, Fragment 2 was obtained by digestion with EcoRⅠ restriction endonuclease;

[0091] 3) Using pMD2.G as the plasmid template, fragment three was obtained by PCR. The primer VSVG-F1 was designed with the base sequence from 5' to 3' as: GAATTCTGACACTATGAAGTGCCTTT (SEQ ID NO.1), and the homologous arm was designed to be added to the 5' end using the homologous recombination method, with the base sequence GAGAACCCCGGCCCC (SEQ ID NO.2). The 3' end primer VSVG-R1 was designed with the base sequence from 5' to 3' as TGTGCAGGATTTGAGTTACTTTCCAAGT (SEQ ID NO.3);

[0092] 4) The obtained fragments one, two, and three were ligated using homologous recombinase to obtain a complete plasmid, which was named B21-VSVG. The B21-VLP was composed of the following operably linked elements connected in sequence: mbIL21, T2A, 4-1BBL, T2A, VSV-G; among them, the amino acid sequences of mbIL21, 4-1BBL, VSV-G, and T2A were respectively as shown in SEQ ID NO.16-19, and the base sequences of mbIL21, 4-1BBL, VSV-G, and T2A were respectively as shown in SEQ ID NO.20-23.

[0093] 5) The plasmid was transformed using Escherichia coli competent cells. After overnight growth on the plate, the plasmid was sequenced to verify its correctness;

[0094] 6) The plasmid colonies with correct verification were expanded in culture, and plasmid DNA was extracted using a DNA extraction kit.

[0095] (2) Construction of IL21-VSVG envelope plasmid

[0096] 1) Using the B21-VSVG plasmid as the plasmid backbone, fragment one was obtained by digestion with the restriction enzymes AgeⅠ and XholⅠ;

[0097] 2) Using the B21-VSVG plasmid as the template, fragment two was obtained by PCR. The 5' end primer IL21-VSVG-F1 was designed with the base sequence from 5' to 3' as TCAGCATCTGTCCTCGAGAACAC (SEQ ID NO.4). The 3' end primer was designed with the base sequence from 5' to 3' as TGGTCCTGGATTTTCCTCCACG (SEQ ID NO.5), and the homologous arm was designed to be added to the 5' end primer using the homologous recombination method, with the base sequence from 5' to 3' as GTACAGCAGGCACT (SEQ ID NO.6);

[0098] (3) Using the B21-VSVG plasmid as a template, fragment three was obtained by PCR. The 5'-end primer IL21-VSVG-F2 was designed, and the base sequence from the 5'-end to the 3'-end was CCAAGTGCCTGCTGTACCTGG (SEQ ID NO.7). Using the homologous recombination method, a homologous arm was designed and added to the 5'-end, and the base sequence was GGAAAATCCAGGA (SEQ ID NO.8). The 3'-end primer IL21-VSVG-R2 was designed, and the base sequence from the 5'-end to the 3'-end was TTTATGGTGAAAGCAGGACCGGT (SEQ ID NO.9);

[0099] (4) Fragments one, two, and three were electrophoresed on an agarose gel, and the corresponding plasmid fragment bands were extracted using an agarose gel DNA recovery kit and quantified;

[0100] (5) The obtained fragments one, two, and three were ligated using a homologous recombinase to obtain a complete plasmid, which was named IL21-VSVG;

[0101] (6) The plasmid was transformed into competent Escherichia coli cells. After overnight growth on the plate, the plasmid was sequenced to verify its correctness;

[0102] (7) The plasmid colonies with correct verification were expanded in culture, and plasmid DNA was extracted using a DNA extraction kit.

[0103] (3) Construction of the B-VSVG envelope plasmid

[0104] (1) Using the B21-VSVG plasmid as a plasmid backbone, fragment one was obtained by digestion with the EcoRⅠ restriction endonuclease;

[0105] (2) Using the B21-VSVG plasmid as a plasmid template, fragment two was obtained by PCR. The 5'-end primer B-VSVG-F1 was designed, and the base sequence from the 5'-end to the 3'-end was GAATACGCCTCTGACGCTTCAC (SEQ ID NO.10). Using the homologous recombination method, a homologous arm was designed and added to the 5'-end, and the base sequence was AAGCACGTGAGATCTGCCACCATG (SEQ ID NO.11). The 3'-end primer B-VSVG-R1 had the base sequence CTGCACTGGTGGGGTGAATTC (SEQ ID NO.12);

[0106] (4) Fragments one and two were electrophoresed on an agarose gel, and the corresponding plasmid fragment bands were extracted using an agarose gel DNA recovery kit and quantified;

[0107] (5) The obtained fragments one and two were ligated using a homologous recombinase to obtain a complete plasmid, which was named B-VSVG;

[0108] 5) Transform the plasmid using competent E. coli cells. After spreading the cells on the plate and growing overnight, sequence the plasmid to verify its correctness.

[0109] 6) Expand the culture of the plasmid colonies with correct verification, and extract plasmid DNA using a small - scale DNA extraction kit.

[0110] (4) Construction of B21 - noVSVG envelope plasmid

[0111] 1) Use the B21 - VSVG plasmid as the plasmid backbone and digest it with EcoRⅠ restriction endonuclease to obtain fragment one.

[0112] 2) Use the B21 - VSVG plasmid as the plasmid template and perform PCR to obtain fragment two. Design the 5' - end primer B21 - F1, with the base sequence from 5' to 3' being AAGCACGTGAGATCTGAATTCG (SEQ ID NO.13). Design the 3' - end primer TTCCGACCTCGGTGAAGGGA (SEQ ID NO.14), and use homologous recombination method to add homologous arms to the 5' - end, with the base sequence being CTGCACTGGTGGGGTTCTAGA (SEQ ID NO.15);

[0113] Electrophorese fragment one and two on an agarose gel, and use an agarose gel DNA recovery kit to extract the corresponding plasmid fragment bands and quantify them.

[0114] 3) Use homologous recombinase to ligate the obtained fragment one and two to obtain a complete plasmid, which is named B21 - noVSVG.

[0115] 4) Transform the plasmid using competent E. coli cells. After spreading the cells on the plate and growing overnight, sequence the plasmid to verify its correctness.

[0116] 5) Expand the culture of the plasmid colonies with correct verification, and extract plasmid DNA using a small - scale DNA extraction kit.

[0117] 3. Experimental results

[0118] The map of the constructed B21 - VSVG envelope plasmid is as Figure 1 shown. The schematic diagram of the principle of B21 - VLP amplifying NK cells in vitro is as Figure 2 shown. The schematic structural diagrams of B21 - VLP, B - VLP, 21 - VLP, and no VSV - B21 - VLP are as Figure 3 shown.

[0119] Example 2 Construction of virus - like particle B21 - VLP expressing mIL21 and 4 - 1BBL

[0120] 1. Experimental materials

[0121] Transient transfection medium: Consen Biotech, product number A21501;

[0122] KBM 581 medium: Corning, product number 88-591-CM;

[0123] PEI: Polyplus, product number 101000026;

[0124] 50% Glucose injection: Henan Kelun Pharmaceutical Co., Ltd.;

[0125] L-Glutamine: Solarbio, product number G0200;

[0126] Human serum albumin (HSA): Paisific Biopharmaceuticals;

[0127] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0128] Recombinant human interleukin-2 for injection (IL2): Shuanglu Pharmaceutical;

[0129] P24 ELISA kit: Yeasen Biotech Co., Ltd., product number 99301ES24;

[0130] FITC Anti-Human CD3: Kuangbo Biotech, product number 6610004;

[0131] PE anti-human CD56: Kuangbo Biotech, product number A6803;

[0132] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, product number E-AB-F1109H;

[0133] PerCP Anti-Human CD8 Antibody: Elabscience, product number AN00427F.

[0134] 2. Experimental methods

[0135] (1) Process of transfecting 293T cells with the constructed envelope plasmid for expression

[0136] 1) Prepare two kinds of VLPs using B21-VSVG and B21-noVSVG envelope plasmids respectively. First, inoculate 293T cells, take 5×10 6 cells, and use 20 mL of Resuspend it in a 125 mL cell culture shaking flask with transient transfection medium, place it in an incubator at 37°C with 5% CO2, and culture it with shaking at 125 rpm. Mix two kinds of envelope plasmids (5 μg) with helper plasmids (pMDLg 20 μg, pRSV 5 μg) respectively as solution A, and mix 75 μL of PEI with 1 mL of medium as solution B. Gently mix solutions A and B to avoid generating bubbles, and let it stand at room temperature for 5 min after mixing. Add solution B to solution A, gently mix, and let it stand at room temperature for 20 min after mixing. Slowly add the AB mixture to the cell culture shaking flask, and gently shake and mix during the addition. Place the cell culture shaking flask in an incubator at 37°C with 5% CO2, and culture it with shaking at 125 rpm.

[0137] 2) Perform a medium change operation after 3 - 5 h. Centrifuge the cells at 1000 rpm for 5 min, and then resuspend the cells with 20 mL transient transfection medium, and transfer them to a 125 mL cell culture shaking flask. Place it in an incubator at 37°C with 5% CO2, and culture it with shaking at 125 rpm.

[0138] 3) Feed the cells after 20 - 22 h. Add 80 μL of 50% glucose injection solution and 800 μL of L - glutamine to each 125 mL cell culture shaking flask, and gently shake and mix during the addition. Place it in an incubator at 37°C with 5% CO2, and culture it with shaking at 125 rpm.

[0139] 4) Harvest the cells 48 h after packaging. Transfer the cell suspension into a centrifuge tube, centrifuge at 2000 rpm for 10 min, take the supernatant as the virus harvest solution, and filter the virus harvest solution with a 0.45 μm filter membrane. Transfer the virus harvest solution into a centrifuge tube, and centrifuge at 18300 g for 2 h at 4°C with a ramp of 9 and a hold of 0. Resuspend the virus precipitate with DPBS containing 2% HSA to obtain B21 - VLP, B - VLP, 21 - VLP, and B21 - noVSVG - VLP virus concentrates respectively.

[0140] 5) Detect the physical titer using P24 ELISA after sampling. After the remaining samples are aliquoted, store them at - 80°C for future use.

[0141] 6) Compare the physical titers of B21 - VSVG and B21 - noVSVG.

[0142] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0143] 1) Isolation of mononuclear cells

[0144] Dispense 200 mL of cord blood into centrifuge tubes, centrifuge at 2000 rpm at room temperature for 20 min, remove the upper light yellow plasma, and add physiological saline with the same volume as the upper light yellow plasma to obtain diluted cord blood; Take another centrifuge tube, add lymphocyte separation medium, and add the diluted cord blood to the lymphocyte separation medium to layer the diluted blood and the lymphocyte separation medium, then centrifuge at 2000 rpm at room temperature for 30 min, remove part of the supernatant, aspirate the middle white film layer into the centrifuge tube, then add physiological saline with the same volume, centrifuge at 2000 rpm at room temperature for 10 min, remove the supernatant, wash three times, and count; Among them, the volume ratio of the lymphocyte separation medium to the diluted cord blood is 15:45 - 50.

[0145] 2) Seeding and stimulation of mononuclear cells

[0146] Seed the precipitate after removing the supernatant in the previous step at a cell density of 5.0×10 6 cells / mL into KBM 581 medium containing IL-2 at a concentration of 200 IU / mL to form a mixed solution; Place the mixed solution in a coated T25 culture flask, and then culture it in an incubator at a temperature of 37 °C and a saturated humidity of 5% CO2 by volume.

[0147] 3) In vitro expansion of cord blood NK cells

[0148] After separating cord blood mononuclear cells in the previous step, place them in 2 T25 flasks, with 5.0×10 6 cells per flask and a volume of 5 mL. Add 500 ng of B21-VLP and B21-noVSVG-VLP for stimulation, and 5% autologous serum in the coated T25 flasks. The inoculation day is day 0.

[0149] Replenish the medium on day 2: Add KBM 581 medium containing IL-2 at a concentration of 200 IU / mL with the same volume.

[0150] Replenish the medium on days 4 - 6: Observe the cells every day, and add KBM 581 medium containing IL-2 at a concentration of 200 IU / mL according to the color of the cell suspension or the cell amount. The volume added each time should not exceed twice the existing volume.

[0151] Count on day 7, adjust the cell density to 0.8 - 1.0×10 6 cells / mL according to the color of the cell suspension and the cell number, and detect the NK phenotype by flow cytometry. Starting from day 7, count the cells every 2 days and supplement KBM 581 medium containing IL-2 at a concentration of 200 IU / mL for amplification to maintain the cell concentration at 8 - 1.0×10 6 cells / mL. Culture for a total of 21 days.

[0152] 3. Experimental Results

[0153] VSV-G (a plasmid for lentivirus packaging) plays an auxiliary role in the lentivirus packaging process. This plasmid contains the gene sequence of vesicular stomatitis virus G protein (VSV-G). This gene replaces the viral envelope protein coding gene in the original virus, significantly enhancing the host cell infection range of the virus. VLPs were packaged using plasmids with VSV-G and without VSV-G respectively, and the P24 content of VLPs was measured by ELISA as its physical titer. The experiment proved that the presence or absence of the VSV-G structure had a great impact on the physical titer of VLPs. The physical titer of VLPs with VSV-G was significantly higher than that of VLPs without VSV-G( Figure 4 ).

[0154] Mononuclear cells (CBMC) were isolated from umbilical cord blood. After measuring the physical titer of VLPs, CBMC were amplified with B21-VLPs and B21-noVSVG-VLPs of the same mass of 500 ng, and 5% autologous serum was added. Cell counting was performed every 2 - 3 days starting from the 7th day of culture. After 22 days of culture, the results showed that VLPs with or without the VSV-G structure had an amplification effect on cells, but the amplification effect of B21-VLPs with VSV-G was better( Figure 5 ).

[0155] Example 3 B21-VLPs have a good amplification effect on NK cells in CBMC

[0156] 1. Experimental Materials

[0157] Transient transfection medium: Consen Biotech, product number A21501;

[0158] KBM 581 medium: Corning, product number 88-591-CM;

[0159] PEI: Polyplus, product number 101000026;

[0160] 50% Glucose injection: Henan Kelun Pharmaceutical Co., Ltd.;

[0161] L-Glutamine: Solarbio, product number G0200;

[0162] Human serum albumin (HSA): Paisific Biopharmaceuticals;

[0163] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0164] Recombinant human interleukin-2 for injection (IL2): Shuanglu Pharmaceutical Co., Ltd.;

[0165] P24 ELISA Detection Kit: Yeasen Biotech Co., Ltd., product number 99301ES24;

[0166] FITC Anti-Human CD3: Kuangbo Biotech Co., Ltd., product number 6610004;

[0167] PE anti-human CD56: Kuangbo Biotech Co., Ltd., product number A6803;

[0168] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, product number E-AB-F1109H;

[0169] PerCP Anti-Human CD8 Antibody: Elabscience, product number AN00427F.

[0170] 2. Experimental Methods

[0171] (1) Process of transfecting 293T cells with the constructed envelope plasmid for expression

[0172] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 293T cells. Take 5×10 6 cells, resuspend them in a 125 mL cell culture flask with 20 mL of 293 medium, and place it in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm. Mix the envelope plasmid B21-VSVG (5 μg) and the helper plasmid (pMDLg 20 μg, pRSV 5 μg) as solution A, and take 75 μL of PEI and mix it with 1 mL of medium as solution B. Gently mix solutions A and B to avoid generating bubbles, and let it stand at room temperature for 5 min after mixing. Add solution B to solution A, gently mix, and let it stand at room temperature for 20 min after mixing. Slowly add the AB mixture to the cell culture flask, and gently shake and mix during the addition. Place the cell culture flask in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm.

[0173] 2) Perform a medium change operation after 3 - 5 h. Centrifuge the cells at 1000 rpm for 5 min, then resuspend the cells with 20 mL of 293 medium and transfer them to a 125 mL cell culture flask. Place it in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm.

[0174] 3) Feed the cells at 20 - 22 h. Add 80 μL of 50% glucose injection solution and 800 μL of glutamine to each 125 mL cell culture flask, and gently shake and mix during the addition. Place it in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm.

[0175] 4) Harvest after 48 h of packaging.

[0176] 5) Transfer the cell suspension into a centrifuge tube, centrifuge at 2000 rpm for 10 min, take the supernatant, which is the virus harvest fluid. Filter the virus harvest fluid using a 0.45 μm filter membrane. Transfer the virus harvest fluid into a centrifuge tube, and centrifuge at 18300 g for 2 h at 4 °C with a rising rate of 9 and a falling rate of 0. Resuspend the virus precipitate with PBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0177] 6) After sampling, detect the physical titer using P24 ELISA. After the remaining is aliquoted, store it at -80 °C for standby.

[0178] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0179] 1) Isolation of mononuclear cells

[0180] Aliquot 200 mL of umbilical cord blood into centrifuge tubes, centrifuge at 2000 rpm for 20 min at room temperature, remove the upper light yellow plasma, then add physiological saline with the same volume as the upper light yellow plasma to obtain diluted umbilical cord blood; Take another centrifuge tube, add lymphocyte separation medium, and add the diluted umbilical cord blood into the lymphocyte separation medium to make the diluted blood and the lymphocyte separation medium form layers. Then centrifuge at 2000 rpm for 30 min at room temperature. After removing part of the supernatant, aspirate the middle white membrane layer into a centrifuge tube, then add physiological saline with the same volume, centrifuge at 2000 rpm for 10 min at room temperature, remove the supernatant, wash three times, and count; Among them, the volume ratio of the lymphocyte separation medium to the diluted umbilical cord blood is 15:45 - 50.

[0181] 2) Inoculation and stimulation of mononuclear cells

[0182] Resuspend the precipitate after removing the supernatant in the previous step at a cell density of 5.0×10 6 cells / mL and inoculate it into K581 serum-free medium, and add IL2 factor with a concentration of 200 IU / mL to form a mixture; Place the mixture in a coated T25 culture flask, and then culture it in an incubator at 37 °C with a saturated humidity of 5% CO2 by volume.

[0183] 3) In vitro expansion of umbilical cord blood NK cells

[0184] After isolating umbilical cord blood mononuclear cells in the previous step, aliquot them into 3 T25 flasks, with 5.0×10 6Cells, with a volume of 5 mL. Add B21-VLP with masses of 1500 ng, 500 ng, and 150 ng respectively to the coated T25 flasks, along with 5% autologous serum. The inoculation day is defined as day 0. The replenishing solution described in this step is K581 medium containing IL-2 at a concentration of 200 IU / mL.

[0185] Replenishing solution on day 2: Add the same volume of medium.

[0186] Replenishing solution on days 4 - 6: Observe the cells daily and add K581 complete medium according to the color of the cell suspension or the cell quantity. The volume added each time should not exceed twice the existing volume.

[0187] Count the cells on day 7 and adjust the cell density to 0.8 - 1.0×10 6 cells / mL, and detect the NK phenotype by flow cytometry. Starting from day 7, count the cells every 2 days and supplement the amplification medium to maintain the cell concentration at 8 - 1.0×10 6 cells / mL. When culturing for ten days, detect the proportion of CD3+CD56- cells by flow cytometry. On days 10, 13, 19, and 22 of the culture respectively, count the cultured CBMC and calculate their growth multiples.

[0188] 3. Experimental results

[0189] Isolate mononuclear cells (CBMC) from umbilical cord blood. After measuring the physical titer of VLP, stimulate CBMC with B21-VLP with masses of 1500 ng, 500 ng, and 150 ng respectively. After culturing for ten days, detect the proportion of CD3+CD56- cells by flow cytometry. The results show that as the concentration of B21-VLP increases, the proportion of NK cells in the cultured CBMC cells increases ( Figure 6 ).

[0190] On days 10, 13, 19, and 22 of the culture respectively, count the cultured CBMC and calculate their growth multiples. The results show that there is little difference in cell proliferation when the mass of B21-VLP is 1500 ng and 500 ng. Therefore, we believe that using 500 ng of B21-VLP has a good amplification effect on NK cells in CBMC ( Figure 7 ).

[0191] Example 4 Comparison of the stimulating effects of B21-VLP, B-VLP, and 21-VLP on CBMC

[0192] 1. Experimental materials

[0193] Transient transfection medium: Kangsheng Bio, product number A21501;

[0194] KBM 581 medium: Corning, catalog number 88-591-CM;

[0195] PEI: Polyplus, catalog number 101000026;

[0196] 50% Glucose Injection: Henan Kelun Pharmaceutical Co., Ltd.;

[0197] L-Glutamine: Solarbio, catalog number G0200;

[0198] Human Serum Albumin (HSA): Paisfike Biopharmaceuticals;

[0199] Dulbecco's Phosphate Buffered Saline (DPBS): Gibco, catalog number 14190250;

[0200] Recombinant Human Interleukin-2 for Injection (IL2): Shuanglu Pharmaceutical Co., Ltd.;

[0201] P24 ELISA Detection Kit: Yeasen Biotech Co., Ltd., catalog number 99301ES24;

[0202] FITC Anti-Human CD3: Kuangbo Biotech, catalog number 6610004;

[0203] PE anti-human CD56: Kuangbo Biotech, catalog number A6803;

[0204] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, catalog number E-AB-F1109H;

[0205] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0206] 2. Experimental Methods

[0207] (1) Process of transfecting 293T cells with the constructed envelope plasmid for expression

[0208] 1) Prepare VLPs using plasmid B21-VSVG, B-VSVG, and 21-VSVG respectively. First, inoculate 293T cells, take 5×10 6 cells, and use 20 mL of The transient transfection medium was resuspended in a 125 mL cell culture shake flask and placed in a 37°C, 5% CO2 incubator, and cultured with shaking at 125 rpm. The envelope plasmid B21-VSVG (5 μg) and the helper plasmids (pMDLg 20 μg, pRSV 5 μg) were mixed as solution A, and 75 μL of PEI was mixed with 1 mL of medium as solution B. Solutions A and B were gently mixed well to avoid generating bubbles, and then left to stand at room temperature for 5 min after mixing. Solution B was added to solution A, gently mixed well, and then left to stand at room temperature for 20 min after mixing. The AB mixture was slowly added to the cell culture shake flask, and the flask was slowly shaken and mixed during this process. The cell culture shake flask was placed in a 37°C, 5% CO2 incubator and cultured with shaking at 125 rpm.

[0209] 2) Perform a medium change operation 3 - 5 h later. After centrifuging the cells at 1000 rpm for 5 min, the cells were resuspended with 20 mL of the transient transfection medium, transferred to a 125 mL cell culture shake flask, and placed in a 37°C, 5% CO2 incubator and cultured with shaking at 125 rpm.

[0210] 3) Feed the cells 20 - 22 h later. 80 μL of 50% glucose injection solution and 800 μL of glutamine were added to each 125 mL cell culture shake flask, and the flask was slowly shaken and mixed during this process. The flask was placed in a 37°C, 5% CO2 incubator and cultured with shaking at 125 rpm.

[0211] 4) Harvest the cells 48 h after packaging.

[0212] 5) Transfer the cell suspension into a centrifuge tube, centrifuge at 2000 rpm for 10 min, take the supernatant, which is the virus harvest solution. Filter the virus harvest solution using a 0.45 μm filter membrane. Transfer the virus harvest solution into a centrifuge tube, and centrifuge at 18300 g for 2 h at 4°C with a ramp of 9 and a hold of 0. Resuspend the virus pellet with PBS containing 2% HSA to obtain the B21-VLP, B-VLP, and 21-VLP virus concentrates.

[0213] 6) After sampling, detect the physical titer using P24 ELISA. The remaining samples were aliquoted and stored at -80°C for future use.

[0214] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0215] 1) Isolation of mononuclear cells

[0216] Dispense 200 mL of cord blood into centrifuge tubes, centrifuge at 2000 rpm at room temperature for 20 min, remove the upper light yellow plasma, and add physiological saline with the same volume as the upper light yellow plasma to obtain diluted cord blood; Take another centrifuge tube, add lymphocyte separation medium, and add the diluted cord blood to the lymphocyte separation medium to layer the diluted blood and the lymphocyte separation medium. Then centrifuge at 2000 rpm at room temperature for 30 min, remove part of the supernatant, aspirate the middle white film layer into the centrifuge tube, then add physiological saline with the same volume, centrifuge at 2000 rpm at room temperature for 10 min, remove the supernatant, wash three times, and count; Among them, the volume ratio of the lymphocyte separation medium to the diluted cord blood is 15:45 - 50.

[0217] 2) Seeding and stimulation of mononuclear cells

[0218] Resuspend the precipitate after removing the supernatant in the previous step at a cell density of 5.0×10 6 cells / mL in K581 serum-free medium, and add IL2 factor at a concentration of 200 IU / mL to form a mixture; Place the mixture in a coated T25 culture flask, and then culture it in an incubator at 37°C with 5% CO2 saturation humidity by volume.

[0219] 3) In vitro expansion of cord blood NK cells

[0220] After separating cord blood mononuclear cells in the previous step, place them in 3 T25 flasks, with 5.0×10 6 cells per flask and a volume of 5 mL. Add 500 ng of B-VLP, 21-VLP, and B21-VLP respectively to the coated T25 flasks for stimulation, and 5% autologous serum. The inoculation day is day 0. The replenishing solution in this step is KBM 581 medium containing IL-2 at a concentration of 200 IU / mL.

[0221] Replenishing solution on day 2: Add KBM 581 complete medium with the same volume.

[0222] Replenishing solution on days 4 - 6: Observe the cells every day, and add KBM 581 complete medium according to the color of the cell suspension or the cell quantity. The volume added each time should not exceed twice the existing volume.

[0223] Count on day 7, adjust the cell density to 0.8 - 1.0×10 6 cells / mL according to the color of the cell suspension and the cell quantity, and detect the NK phenotype by flow cytometry. Starting from day 7, count the cells every 2 days and add amplified KBM581 complete medium to maintain the cell concentration at 8 - 1.0×10 6cells / mL. On the 22nd day of culture, the cultured CBMCs were counted and the growth multiple was calculated.

[0224] 3. Experimental results

[0225] Umbilical cord blood CBMCs were isolated. The physical titers of B21-VLP, B-VLP, and 21-VLP were determined. CBMCs were stimulated with 500 ng of mass. On the 22nd day of culture, the cultured CBMCs were counted and the growth multiple was calculated. The experimental results showed that the stimulation effect of using B21-VLP was the best. In addition, the growth multiples of CBMCs in the B-VLP group and the 21-VLP group were almost 0, while the growth multiple of CBMCs in the B21-VLP group was 250. It can be seen that mIL21 and 4-1BBL have a synergistic effect on cell expansion ( Figure 8 ), and this synergistic effect is a technical effect unexpected by those skilled in the art based on the prior art.

[0226] Example 5 Comparison of the amplification effects of B21-VLP and K562-41BBL-mbIL21 on NK cells

[0227] 1. Experimental materials

[0228] Transient transfection medium: Consen Biotech, product number A21501;

[0229] KBM 581 medium: Corning, product number 88-591-CM;

[0230] PEI: Polyplus, product number 101000026;

[0231] 50% Glucose injection: Henan Kelun Pharmaceutical Co., Ltd.;

[0232] L-Glutamine: Solarbio, product number G0200;

[0233] Human serum albumin (HSA): Paisfiko Biopharmaceuticals;

[0234] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0235] Recombinant human interleukin-2 for injection (IL2): Shuanglu Pharmaceutical Co., Ltd.;

[0236] P24 ELISA detection kit: Yeasen Biotech Co., Ltd., product number 99301ES24;

[0237] FITC Anti-Human CD3: Kuangbo Biotech, product number 6610004;

[0238] PE anti-human CD56: Kuangbo Biotech, product number A6803;

[0239] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, product number E-AB-F1109H;

[0240] PerCP Anti-Human CD8 Antibody: Elabscience, product number AN00427F.

[0241] The K562-41BBL-mbIL21 is derived from the literature: Shman TV, Vashkevich KP, Migas AA, Matveyenka MA, Lasiukov YA, Mukhametshyna NS, Horbach KI, Aleinikova OV. Phenotypic and functional characterisation of locally produced natural killer cells ex vivo expanded with the K562-41BBL-mbIL21 cell line. Clin Exp Med. 2023 Oct;23(6):2551-2560. doi: 10.1007 / s10238-022-00974-2. Epub 2022 Dec 17. PMID: 36527513.

[0242] 2. Experimental methods

[0243] (1) The expression process of transfecting 293T cells with the constructed envelope plasmid

[0244] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 293T cells with 5×10 6 cells, resuspend them in a 125 mL cell culture flask with 20 mL of transient transfection medium, and place them in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm. Mix the envelope plasmid B21-VSVG (5 μg) and the helper plasmids (pMDLg 20 μg, pRSV 5 μg) with 1 mL of transient transfection medium as solution A, and take 75 μL of PEI and mix it with 1 mL of Transient transfection medium mixture is used as Solution B. Gently mix Solution A and Solution B to avoid generating bubbles. After mixing, let it stand at room temperature for 5 min. Add Solution B to Solution A, gently mix, and then let it stand at room temperature for 20 min. Slowly add the AB mixture to the cell culture flask and gently shake and mix during the addition. Place the cell culture flask in a 37°C, 5% CO2 incubator and culture with shaking at 125 rpm.

[0245] 2) Perform medium replacement operation after 3 - 5 h. Centrifuge the cells at 1000 rpm for 5 min, then resuspend the cells with 20 mL transient transfection medium and transfer them to a 125 mL cell culture flask. Place it in a 37°C, 5% CO2 incubator and culture with shaking at 125 rpm.

[0246] 3) Feed the cells after 20 - 22 h. Add 80 μL of 50% glucose injection solution and 800 μL of glutamine to each 125 mL cell culture flask, and gently shake and mix during the addition. Place it in a 37°C, 5% CO2 incubator and culture with shaking at 125 rpm.

[0247] 4) Harvest after 48 h of packaging.

[0248] 5) Transfer the cell suspension into a centrifuge tube, centrifuge at 2000 rpm for 10 min, take the supernatant as the virus harvest solution. Filter the virus harvest solution with a 0.45 μm filter membrane. Transfer the virus harvest solution into a centrifuge tube, and centrifuge at 18300 g for 2 h at 4°C with a ramp of 9 and a hold of 0. Resuspend the virus precipitate with PBS containing 2% HSA to obtain the B21 - VLP virus concentrate.

[0249] 6) After sampling, detect the physical titer using P24 ELISA. Aliquot the remaining sample and store it at -80°C for future use.

[0250] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0251] 1) Isolation of mononuclear cells

[0252] Dispense 200 mL of umbilical cord blood into centrifuge tubes, centrifuge at 2000 rpm at room temperature for 20 min, remove the upper light yellow plasma, and then add physiological saline with the same volume as the upper light yellow plasma to obtain diluted umbilical cord blood; take another centrifuge tube, add lymphocyte separation medium, and add the diluted umbilical cord blood to the lymphocyte separation medium to make the diluted blood and the lymphocyte separation medium form layers. Then centrifuge at 2000 rpm at room temperature for 30 min. After removing some of the supernatant, aspirate the middle white membrane layer into a centrifuge tube, then add physiological saline with the same volume, centrifuge at 2000 rpm at room temperature for 10 min, remove the supernatant, wash three times, and count; among them, the volume ratio of the lymphocyte separation medium to the diluted umbilical cord blood is 15:45 - 50.

[0253] 2) Seeding and stimulation of mononuclear cells

[0254] The precipitate after removing the supernatant in the previous step was seeded at a cell density of 5.0×10 6 cells / mL in K581 serum-free medium, and IL-2 factor was added at a concentration of 200 IU / mL to form a mixture; the mixture was placed in a coated T25 culture flask, and then cultured in an incubator at 37°C with 5% CO2 saturated humidity by volume.

[0255] 3) In vitro expansion of cord blood NK cells

[0256] After the separation of cord blood mononuclear cells in the previous step, they were placed in two T25 flasks, with 5.0×10 6 cells in each flask and a volume of 5 mL. 500 ng of B21-VLP was added to one of the coated flasks for stimulation, and K562-41BBL-mbIL21 cells were added to the other flask at a ratio of 1:1 with CBMC and 5% autologous serum. The inoculation day was day 0. The replenishing fluid in this step was K581 medium containing IL-2 at a concentration of 200 IU / mL.

[0257] Replenishing fluid on day 2: Add the same volume of medium.

[0258] Replenishing fluid on days 4 - 6: Observe the cells every day, and add K581 complete medium according to the color of the cell suspension or the cell quantity. The volume added each time should not exceed twice the existing volume.

[0259] Count on day 7, adjust the cell density to 0.8 - 1.0×10 6 cells / mL according to the color of the cell suspension and the cell quantity, and detect the NK phenotype by flow cytometry. Starting from day 7, count the cells every 2 - 3 days and supplement the amplification medium to maintain the cell concentration at 8 - 1.0×10 6 cells / mL. On day 22 of the culture, detect the proportion of CD3-CD56+ NK cells by flow cytometry.

[0260] 3. Experimental results

[0261] The experiment showed that B21-VLP had an amplification ability for NK cells similar to that of K562-41BBL-mbIL21. The proportion of NK cells in the total cells could reach over 90% ( Figure 9 - 10 ).

[0262] Separate CBMC, measure the physical titer of B21-VLP. Stimulate CBMC with 500 ng of B21-VLP and K562-41BBL-mbIL21 respectively. The results show that when CBMC is stimulated with B21-VLP, the flow cytometry detection results show that the cell debris is significantly reduced. Therefore, it is more advantageous to stimulate with B21-VLP constructed by the present invention( Figure 11 ).

[0263] Example 6 When CBMC is stimulated with B21-VLP, NK cells can be selectively expanded

[0264] 1. Experimental materials

[0265] Transient transfection medium: Kangsheng Biotech, product number A21501;

[0266] KBM 581 medium: Corning, product number 88-591-CM;

[0267] PEI: Polyplus, product number 101000026;

[0268] 50% Glucose injection: Henan Kelun Pharmaceutical;

[0269] L-Glutamine: Solarbio, product number G0200;

[0270] Human serum albumin (HSA): Paisfike Biopharmaceutical;

[0271] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0272] Recombinant human interleukin-2 for injection (IL2): Shuanglu Pharmaceutical;

[0273] P24 ELISA detection kit: Yeasen Biotech, product number 99301ES24;

[0274] FITC Anti-Human CD3: Kuangbo Biotech, product number 6610004;

[0275] PE anti-human CD56: Kuangbo Biotech, product number A6803;

[0276] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, product number E-AB-F1109H;

[0277] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0278] 2. Experimental methods

[0279] (1) Expression process by transfecting 293T cells with the constructed envelope plasmid

[0280] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 5×10 6 cells of 293T cells, resuspend them in a 125 mL cell culture flask with 20 mL of transient transfection medium, and place it in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm. Mix the envelope plasmid B21-VSVG (5 μg), helper plasmids (pMDLg 20 μg, pRSV 5 μg) with 1 mL of transient transfection medium as solution A, and take 75 μL of PEI and mix it with 1 mL of transient transfection medium as solution B. Gently mix solutions A and B to avoid generating bubbles, and let it stand at room temperature for 5 min after mixing. Add solution B to solution A, gently mix, and let it stand at room temperature for 20 min after mixing. Slowly add the AB mixture to the cell culture flask, and gently shake and mix during the addition. Place the cell culture flask in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm.

[0281] 2) Perform a medium change operation 3 - 5 h later. Centrifuge the cells at 1000 rpm for 5 min, resuspend the cells with 20 mL of transient transfection medium, and transfer them to a 125 mL cell culture flask. Place it in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm.

[0282] 3) Feed the cells at 20 - 22 h. Add 80 μL of 50% glucose injection solution and 800 μL of glutamine to each 125 mL cell culture flask, and gently shake and mix during the addition. Place it in a 37°C, 5% CO2 incubator, and culture with shaking at 125 rpm.

[0283] 4) Harvest after 48 h of packaging.

[0284] 5) Transfer the cell suspension into a centrifuge tube, centrifuge at 2000 rpm for 10 min, take the supernatant as the virus harvest solution. Filter the virus harvest solution with a 0.45 μm filter membrane. Transfer the virus harvest solution into a centrifuge tube, and centrifuge at 18300 g for 2 h at 4°C with a ramp of 9 and a hold of 0. Resuspend the virus pellet with PBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0285] 6) After sampling, detect the physical titer using P24 ELISA. After the remaining sample is aliquoted, store it at -80 °C for future use.

[0286] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0287] 1) Isolation of mononuclear cells

[0288] Aliquot 200 mL of umbilical cord blood into centrifuge tubes, centrifuge at 2000 rpm at room temperature for 20 min, remove the upper light yellow plasma, add physiological saline with the same volume as the upper light yellow plasma to obtain diluted umbilical cord blood; Take another centrifuge tube, add lymphocyte separation medium, and add the diluted umbilical cord blood to the lymphocyte separation medium to make the diluted blood and lymphocyte separation medium form layers. Then centrifuge at 2000 rpm at room temperature for 30 min. After removing part of the supernatant, aspirate the middle white film layer into a centrifuge tube, then add physiological saline with the same volume, centrifuge at 2000 rpm at room temperature for 10 min, remove the supernatant, wash three times, and count; Among them, the volume ratio of lymphocyte separation medium to diluted umbilical cord blood is 15:45 - 50.

[0289] 2) Seeding and stimulation of mononuclear cells

[0290] Resuspend the pellet obtained after removing the supernatant in the previous step at a cell density of 5.0×10 6 cells / mL in K581 serum-free medium, and add IL2 factor at a concentration of 200 IU / mL to form a mixture; Place the mixture in a coated T25 culture flask, and then culture it in an incubator at 37 °C with 5% CO2 saturation humidity.

[0291] 3) In vitro expansion of umbilical cord blood NK cells

[0292] After isolating umbilical cord blood mononuclear cells in the previous step, aliquot them into 2 T25 flasks, with 5.0×10 6 cells per flask and a volume of 5 mL. Add 500 ng of B21-VLP to stimulate one of the coated flasks, and add K562-41BBL-mbIL21 cells to the other flask at a ratio of 1:1 with CBMC and 5% autologous serum. The inoculation day is day 0. The replenishing fluid in this step is K581 medium containing IL-2 at a concentration of 200 IU / mL.

[0293] Replenish the fluid on day 2: Add the same volume of medium.

[0294] Replenish the fluid on days 4 - 6: Observe the cells every day, and add K581 complete medium according to the color of the cell suspension or the cell quantity. The volume added each time should not exceed twice the existing volume.

[0295] Count on the 7th day, adjust the cell density to 0.8 - 1.0×10 6 cells / mL according to the color of the cell suspension and the number of cells, and detect the NK phenotype by flow cytometry. Starting from the 7th day, count the cells every 2 - 3 days and supplement the amplification medium to maintain the cell concentration at 8 - 1.0×10 6 cells / mL. On the 22nd day of culture, detect the proportion of CD3 - CD56+ NK cells by flow cytometry.

[0296] 3. Experimental results

[0297] Isolate CBMC and determine the physical titer of B21 - VLP. Stimulate CBMC with 500 ng of B21 - VLP by mass for 21 days. Detect the content of T cells, NKT cells, and NK cells by flow cytometry every 2 days. The results show that B21 - VLP can selectively amplify NK cells when stimulating CBMC, and the NK cells account for more than 90% of the total cell content on the 21st day of culture ( Figure 12 ).

[0298] Example 7 NK cells cultured with B21 - VLP have strong killing ability against K562 cells

[0299] 1. Experimental materials

[0300] Transient transfection medium: Kangsheng Bio, product number A21501;

[0301] KBM 581 medium: Corning, product number 88 - 591 - CM;

[0302] PEI: Polyplus, product number 101000026;

[0303] 50% glucose injection: Henan Kelun Pharmaceutical Industry;

[0304] L - Glutamine: Solarbio, product number G0200;

[0305] Human serum albumin (HSA): Paisfike Biopharmaceuticals;

[0306] Dulbecco's phosphate - buffered saline (DPBS): Gibco, product number 14190250;

[0307] Recombinant human interleukin - 2 for injection (IL2): Shuanglu Pharmaceutical;

[0308] P24 ELISA detection kit: Yeasen Biotech, product number 99301ES24;

[0309] FITC Anti-Human CD3: Kuangbo Biotech, product number 6610004;

[0310] PE anti-human CD56: Kuangbo Biotech, product number A6803;

[0311] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, product number E-AB-F1109H;

[0312] PerCP Anti-Human CD8 Antibody: Elabscience, product number AN00427F.

[0313] 2. Experimental methods

[0314] (1) Process of transfecting 293T cells with the constructed envelope plasmid for expression

[0315] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 293T cells, take 5×10 6 cells, and resuspend them in a 125 mL cell culture flask with 20 mL of transient transfection medium. Place it in a 37°C, 5% CO2 incubator and culture with shaking at 125 rpm. Mix the envelope plasmid B21-VSVG (5 μg), the helper plasmid (pMDLg 20 μg, pRSV 5 μg) with 1 mL of transient transfection medium as solution A, and take 75 μL of PEI and mix it with 1 mL of transient transfection medium as solution B. Gently mix solutions A and B to avoid generating bubbles, and let it stand at room temperature for 5 min after mixing. Add solution B to solution A, gently mix, and let it stand at room temperature for 20 min after mixing. Slowly add the AB mixture to the cell culture flask, and gently shake and mix during the addition. Place the cell culture flask in a 37°C, 5% CO2 incubator and culture with shaking at 125 rpm.

[0316] 2) Perform a medium change operation after 3 - 5 h. Centrifuge the cells at 1000 rpm for 5 min, then resuspend the cells with 20 mL and 1 mL of transient transfection medium, and transfer them to a 125 mL cell culture flask. Place it in a 37°C, 5% CO2 incubator and culture with shaking at 125 rpm.

[0317] 3) Feed the cells at 20 - 22 h. Add 80 μL of 50% glucose injection and 800 μL of glutamine to each 125 mL cell culture flask, and gently shake and mix during the addition. Place it in a 37°C, 5% CO2 incubator and culture with shaking at 125 rpm.

[0318] 4) Harvest after 48 h of packaging.

[0319] 5) Transfer the cell suspension into a centrifuge tube, centrifuge at 2000 rpm for 10 min, take the supernatant, which is the virus harvest fluid. Filter the virus harvest fluid using a 0.45 μm filter membrane. Transfer the virus harvest fluid into a centrifuge tube, and at 4 °C, increase by 9 and decrease by 0, centrifuge at 18300 g for 2 h. Resuspend the virus pellet using PBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0320] 6) After sampling, detect the physical titer using P24 ELISA. After the remaining is aliquoted, store it at -80 °C for later use.

[0321] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0322] 1) Isolation of mononuclear cells

[0323] Aliquot 200 mL of umbilical cord blood into centrifuge tubes, centrifuge at 2000 rpm at room temperature for 20 min. After removing the upper light yellow plasma, add physiological saline with the same volume as the upper light yellow plasma to obtain diluted umbilical cord blood; Take another centrifuge tube, add lymphocyte separation medium, and add the diluted umbilical cord blood into the lymphocyte separation medium to make the diluted blood and lymphocyte separation medium form layers. Then centrifuge at 2000 rpm at room temperature for 30 min. After removing part of the supernatant, aspirate the middle white film layer into a centrifuge tube, then add physiological saline with the same volume, centrifuge at 2000 rpm at room temperature for 10 min, remove the supernatant, wash three times, and count; Among them, the volume ratio of lymphocyte separation medium to diluted umbilical cord blood is 15:45 - 50.

[0324] 2) Seeding and stimulation of mononuclear cells

[0325] Seed the pellet after removing the supernatant in the previous step at a cell density of 5.0×10 6 cells / mL into K581 serum-free medium, and add IL2 factor with a concentration of 200 IU / mL to form a mixture; Place the mixture in a coated T25 culture flask, and then culture it in an incubator at 37 °C with a volume percentage of 5% CO2 and saturated humidity.

[0326] 3) In vitro expansion of umbilical cord blood NK cells

[0327] After the isolation of umbilical cord blood mononuclear cells in the previous step, 5.0×10 per bottle 6Place the cells in a T25 flask with a volume of 5 mL. Add 500 ng of B21-VLP stimulation to one of the coated flasks, with a ratio of CBMC to 1:1 and 5% autologous serum. The inoculation day is day 0. The replenishing fluid described in this step is K581 medium containing IL-2 at a concentration of 200 IU / mL.

[0328] 4) Replenish the fluid on day 2: Add the same volume of medium.

[0329] 5) Replenish the fluid on days 4 - 6: Observe the cells every day and add K581 complete medium according to the color of the cell suspension or the cell amount. The volume added each time should not exceed twice the existing volume.

[0330] 6) Count on day 7, adjust the cell density to 0.8 - 1.0×10 6 cells / mL according to the color of the cell suspension and the cell number, and detect the NK phenotype by flow cytometry.

[0331] 7) NK cell killing experiment

[0332] The NK cells cultured with B21-VLP are used as effector cells, and K562 tumor cells are used as target cells. Co-culture them at effector-to-target ratios of 10:1, 3:1, and 1:1 respectively. After 24 h, use a flow analyzer to detect the ratio of effector cells to target cells.

[0333] 3. Experimental results

[0334] The experimental results are as Figure 13 shown. The results show that after 24 h of detecting effector cells and target cells, the ratio of target cells is observed to be less than 1% in all cases, indicating that the NK cells cultured with the B21-VLP constructed in the present invention have strong killing ability against K562 cells.

Claims

1. A virus-like particle B21-VLP expressing mIL21 and 4-1BBL, characterized in that: The B21-VLP is composed of the following operably connected elements connected in sequence: mIL21, T2A, 4-1BBL, T2A, VSV-G; The amino acid sequence of the mIL21 is shown in SEQ ID NO.16, and the amino acid sequence of the 4-1BBL is shown in SEQ ID NO.

17.

2. The B21-VLP according to claim 1, characterized in that The amino acid sequence of VSV-G is shown in SEQ ID NO.18; Optionally, the base sequence of mIL21 is shown as SEQ ID NO.20, and the base sequence of 4-1BBL is shown as SEQ ID NO.21; Optionally, the base sequence of the VSV-G is shown in SEQ ID NO.

22.

3. A method for constructing virus-like particles B21-VLP expressing mIL21 and 4-1BBL, characterized in that: The construction method comprises the following steps: (1) Construction of B21-VSVG envelope plasmid: (2) Use B21-VSVG envelope plasmid to transfect host cells to construct B21-VLP.

4. The construction method according to claim 3, characterized in that: The construction of B21-VSVG envelope plasmid comprises the following steps: (1) obtaining mIL21 and 4-1BBL fragments by gene synthesis, as fragment 1, wherein the amino acid sequence of mIL21 is shown in SEQ ID NO.16, and the amino acid sequence of 4-1BBL is shown in SEQ ID NO.17; (2) Using pMD2.G as the plasmid backbone, the fragment 2 was obtained by digestion with EcoRⅠ restriction endonuclease; (3) Using pMD2.G as a plasmid template, PCR was performed to obtain fragment 3, and primer VSVG-F1 was designed. The amino terminal sequence from the 5' end to the 3' end was as shown in SEQ ID NO.

1. A homologous arm was designed by homologous recombination and added to the 5' end. The amino terminal sequence was as shown in SEQ ID NO.

2. A 3' end primer VSVG-R1 was designed. The amino terminal sequence from the 5' end to the 3' end was as shown in SEQ ID NO.

3. (4) The obtained fragments 1, 2, and 3 are connected using homologous recombinase to obtain a complete plasmid, namely the B21-VSVG envelope plasmid.

5. The construction method according to claim 3, characterized in that: The method of using B21-VSVG envelope plasmid to transfect host cells to construct B21-VLP comprises the following steps: (1) Mixing the envelope plasmid B21-VSVG and the auxiliary plasmids pMDLg and pRSV as liquid A, mixing PEI with the culture medium as liquid B, mixing the liquids A and B to obtain a mixed solution AB, adding the mixed solution AB to the host cell culture medium, and culturing the host cells; (2) Perform fluid replacement after 3-5 hours; (3) Feed after 20-22 hours; (4) 48 h after packaging, the B21-VLPs were harvested.

6. The construction method according to claim 5, characterized in that: The amounts of the envelope plasmid and the auxiliary plasmid are: B21-VSVG (1-10) μg, pMDLg (5-50) μg, pRSV (1-10) μg; Optionally, the amounts of the envelope plasmid and the helper plasmid are: B21-VSVG 5 μg, pMDLg 20 μg, pRSV 5 μg; Optionally, the host cell is 293T cell, 293 cell, HEK293F cell, CHO cell, Vero cell or HeLa cell; Optionally, the host cell is a 293T cell; Optionally, the culture medium is Transient medium, EmCD HEK293 Plus medium, CELL-WISE293 medium CW001, complete medium M293TI, glutamine-free medium M293TIS, glutamine-free medium without phenol red M293TINPR, or union293 medium; Optionally, the culture medium is Transient culture medium; Optionally, when preparing the A solution, the amount of the culture medium is 0.5-5 mL; Optionally, when preparing the A solution, the amount of the culture medium is 1 mL; Optionally, when preparing the B solution, the amounts of PEI and culture medium are 25-125 μL and 0.5-5 mL, respectively; Optionally, when preparing the B solution, the amounts of PEI and culture medium are 75 μL and 1 mL, respectively; Optionally, the feed comprises supplementing glucose and glutamine.

7. A composition comprising the B21-VLP of claim 1 or 2.

8. A culture for expanding NK cells, characterized in that The culture contains the B21-VLPs of claim 1 or 2 or the composition of claim 7.

9. A method for in vitro expansion of NK cells, in vitro culture or stimulation of NK cells, characterized in that: The method comprises: contacting NK cells with the B21-VLP of claim 1 or 2, the composition of claim 7, or the culture of claim 8; Optionally, the NK cells are present in a cord blood mononuclear cell population.

10. Any of the following applications: (1) Use of the B21-VLP of claim 1 or 2, the composition of claim 7 or the culture of claim 8 in in vitro expansion of NK cells, in vitro culture or stimulation of NK cells; (2) Use of NK cells cultured with the B21-VLP described in claim 1 or 2, the composition described in claim 7, or the culture described in claim 8 in the preparation of anti-tumor drugs.

Citation Information

Patent Citations

  • Recombinant vector as well as preparation method and application thereof

    CN108034677A

  • Trophocyte stimulated NK cell expansion method and use thereof

    CN108300697A

  • Recombinant lentiviral expression vector, reconstitution cell and application of reconstitution cell to culturing natural killer cell

    CN109371062A

  • NK trophoblast cell and application thereof

    CN112725284A

  • Method for culturing cord blood-derived natural killer cells using transformed t-cells

    CN113383069A