Auxotrophic escherichia coli for producing N-acetylglucosamine as well as construction method and application of auxotrophic escherichia coli

By constructing nutritionally deficient E. coli, knocking out relevant metabolic genes and introducing recombinant expression vectors, efficient and low-cost N-acetylglucosamine production is achieved, and the problems of high antibiotic use and cost in industrial production are solved.

CN120210084APending Publication Date: 2025-06-27BY HEALTH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410837506.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-06-26
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The prior art has problems such as the use of antibiotics, expensive inducer IPTG and the production of endotoxins in industrial production of N-acetylglucosamine, which leads to high cost and unenvironmental protection.

Method used

Design a nutritionally deficient E. coli to achieve efficient production of N-acetylglucosamine by knocking out relevant metabolic genes and introducing recombinant expression vectors, and avoiding the use of antibiotics.

Benefits of technology

It achieves efficient, low-cost and safe N-acetylglucosamine production, with a fermentation yield of up to 98g/L, solving the problems of high antibiotic use and cost in traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210084A_ABST
    Figure CN120210084A_ABST
Patent Text Reader

Abstract

The invention relates to auxotrophic escherichia coli for producing N-acetylglucosamine as well as a construction method and application of the auxotrophic escherichia coli. NagB, nagA, manX, nagE, nagK and asd genes are deleted in the auxotrophic escherichia coli, the auxotrophic escherichia coli contains a recombinant expression vector, and the recombinant expression vector contains asd, glmS and gna1 genes. According to the invention, an auxotroph engineering bacterium is further constructed on the basis of constructing a high-yield N-acetylglucosamine strain, so that the efficient production of N-acetylglucosamine is realized, the use of antibiotics can be avoided, and the yield of fermented N-acetylglucosamine can reach 98g / L; a new method and a new idea are provided for efficient, low-cost and safe industrial production of the N-acetylglucosamine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and relates to a auxotrophic Escherichia coli for producing N-acetylglucosamine, a construction method thereof, and an application thereof. Background Art

[0002] N-acetylglucosamine (GlcNAc) is an acetylated derivative of glucosamine (GlcN), and is the basic unit of many functional polysaccharides (such as hyaluronic acid, chondroitin sulfate, etc.) in organisms. It is widely present in bacteria, yeasts, filamentous fungi, plants, and animals, and plays a key role in the life activities of organisms. GlcNAc plays an important role in the repair and health care of bone joints and the treatment of osteoarthritis. In addition, GlcNAc can enhance the immune function of the human body, can be used as a food additive, an antioxidant, and a sweetener for diabetic patients, and can also promote the metabolic synthesis of human hyaluronic acid, playing a role in improving the moisture content of the skin. Therefore, GlcNAc is widely used in the fields of medicine, food, and cosmetics, etc.

[0003] At present, the industrial production methods of GlcNAc mainly include acid hydrolysis method, enzymatic hydrolysis method, and microbial fermentation method. Both the acid hydrolysis method and the enzymatic hydrolysis method use chitin extracted from shrimp and crab shells as raw materials, and then obtain GlcNAc through acid hydrolysis or enzymatic hydrolysis. However, both the acid hydrolysis method and the enzymatic hydrolysis method have many problems. For example, the source of chitin raw materials is limited, and GlcNAc produced from chitin extracted from shrimp and crabs is prone to cause allergic reactions; in addition, a large amount of strong acids and alkalis are used in the acid hydrolysis process, causing serious environmental pollution; while the enzymatic hydrolysis method has mild reaction conditions, but has problems such as high price of the required enzymes, long enzymatic hydrolysis time, and low production efficiency; therefore, both the acid hydrolysis method and the enzymatic hydrolysis method are not suitable for future green industrial production. In recent years, with the rapid development of synthetic biology technology, an industrial system for microbial biosynthesis of GlcNAc has been established. However, there are currently problems in industrial fermentation production of GlcNAc such as the use of antibiotics, the use of expensive inducer IPTG, and the production of endotoxins, which will involve high costs and the problem of antibiotic abuse.

[0004] In summary, how to construct a auxotrophic probiotic genetic engineering bacterium with high yield of GlcNAc has become one of the problems to be solved urgently at present. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a auxotrophic Escherichia coli for producing N-acetylglucosamine, a construction method thereof, and an application thereof, realizing high-efficiency production of N-acetylglucosamine, and avoiding the use of antibiotics, laying a foundation for the high-efficiency, low-cost, and safe industrial production of N-acetylglucosamine.

[0006] To achieve this goal, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a auxotrophic Escherichia coli for producing N-acetylglucosamine. In the auxotrophic Escherichia coli, the deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter gene manX, N-acetylglucosamine transporter gene nagE, N-acetylglucosamine kinase gene nagK, and aspartate semialdehyde dehydrogenase gene asd are deleted, and it contains a recombinant expression vector. The recombinant expression vector contains the aspartate semialdehyde dehydrogenase gene asd, glucosamine synthase gene glmS, and glucosamine acetylase gene gna1.

[0008] The present invention designs a brand-new genetically engineered bacterium. Five metabolic genes of N-acetylglucosamine (nagB, nagA, manX, nagE, nagK) are knocked out in Escherichia coli, and the glucosamine N-acetyltransferase gene glmS and glucosamine acetylase gene gna1 are overexpressed to achieve high-efficient production of N-acetylglucosamine. On this basis, the aspartate semialdehyde dehydrogenase gene asd is further knocked out to construct an auxotrophic strain, so that the strain cannot grow in a medium without DAP (diaminopimelic acid). Then, asd is inserted into the recombinant expression vectors of glmS and gna1 to achieve complementation. Therefore, only the strain into which the recombinant expression vector is introduced can grow in a medium without DAP, eliminating the need to use antibiotics as a selection marker and control the fermentation process, achieving high-efficient production of N-acetylglucosamine while avoiding the use of antibiotics, and providing a new method and new idea for the high-efficient, low-cost, and safe industrial production of N-acetylglucosamine.

[0009] Preferably, the initial strain of the auxotrophic Escherichia coli for producing N-acetylglucosamine includes Escherichia coli Nissle1917ΔattB(lacUV5-T7)ΔendAΔompT.

[0010] In the present invention, Escherichia coli Nissle 1917 (Escherichia coli Nissle 1917, EcN) series strains are selected as the initial strains. They do not contain pathogenic factors such as enterotoxin, hemolysin, and cytotoxin. The target products produced using them as chassis cells do not require complex purification methods to remove endotoxins and the like in the samples, which can improve the use safety of the target products.

[0011] Preferably, the initial vector of the recombinant expression vector includes the pRSFDuet vector.

[0012] Preferably, the promoter of the aspartate semialdehyde dehydrogenase gene asd in the recombinant expression vector includes P J23119Promoter, P gapA Promoter or P asd Any one of the promoters.

[0013] Preferably, the nucleotide sequence of the aspartate semialdehyde dehydrogenase gene asd is as shown in SEQ ID NO.1.

[0014] Preferably, the aspartate semialdehyde dehydrogenase gene asd containing P J23119 The nucleotide sequence of the aspartate semialdehyde dehydrogenase gene asd is as shown in SEQ ID NO.2.

[0015] Preferably, the aspartate semialdehyde dehydrogenase gene asd containing P gapA The nucleotide sequence of the aspartate semialdehyde dehydrogenase gene asd is as shown in SEQ ID NO.3.

[0016] Preferably, the aspartate semialdehyde dehydrogenase gene asd containing P asd The nucleotide sequence of the aspartate semialdehyde dehydrogenase gene asd is as shown in SEQ ID NO.4.

[0017] SEQ ID NO.1:

[0018]

[0019] SEQ ID NO.2:

[0020]

[0021] SEQ ID NO.3:

[0022]

[0023] SEQ ID NO.4:

[0024]

[0025] Preferably, the source of the glucosamine synthase gene glmS includes any one of Escherichia coli K-12 MG1655, Bacillus subtilis, or Corynebacterium glutamate.

[0026] Preferably, the source of the glucosamine acetylase gene gna1 includes any one of Saccharomyces cerevisiae, Caenorhabditis elegans, or the one derived from Saccharomyces cerevisiae after codon optimization in Escherichia coli.

[0027] In a second aspect, the present invention provides a method for constructing a auxotrophic Escherichia coli for producing N-acetylglucosamine as described in the first aspect, and the construction method includes:

[0028] Knock out the deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter gene manX, N-acetylglucosamine transporter gene nagE, N-acetylglucosamine kinase gene nagK, and aspartate semialdehyde dehydrogenase gene asd in Escherichia coli to obtain a knocked-out strain; introduce a recombinant vector containing the aspartate semialdehyde dehydrogenase gene asd, glucosamine synthase gene glmS, and glucosamine acetylase gene gna1 into the knocked-out strain.

[0029] Preferably, the preparation method of the recombinant vector includes:

[0030] Insert the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 into the initial vector, and use the aspartate semialdehyde dehydrogenase gene asd and its promoter to replace the resistance gene and promoter on the initial vector.

[0031] It can be understood that the present invention designs a clear genetic modification strategy, and specific strategies can be implemented by using the general gene knockout method and recombinant expression vector construction method in the art. Those skilled in the art can know without special limitation. For example, the CRISPR-Cas9 gene editing technology kit is used to operate and knock out the target gene.

[0032] In a third aspect, the present invention provides the application of the auxotrophic Escherichia coli for producing N-acetylglucosamine as described in the first aspect in the production of N-acetylglucosamine.

[0033] In a fourth aspect, the present invention provides a method for producing N-acetylglucosamine, and the method includes:

[0034] Ferment and culture the auxotrophic Escherichia coli for producing N-acetylglucosamine, and perform product purification to obtain N-acetylglucosamine.

[0035] It can be understood that the present invention has successfully constructed an auxotrophic Escherichia coli for producing N-acetylglucosamine, and the production of N-acetylglucosamine can be achieved by using the general culture method and product purification method in the art.

[0036] Preferably, the fermentation medium for the fermentation culture contains glucose, yeast powder, Na2HPO4·12H2O, KH2PO4, NH4C1, ferric citrate, zinc sulfate heptahydrate, copper sulfate pentahydrate, manganese sulfate monohydrate, sodium borate decahydrate, ammonium molybdate, calcium chloride dihydrate and magnesium sulfate.

[0037] Preferably, the temperature of the fermentation culture is 25 - 35 °C.

[0038] Preferably, the process of the fermentation culture further includes the step of adding or not adding an inducer.

[0039] Preferably, the inducer includes IPTG.

[0040] Preferably, the working concentration of the inducer is 0.1 - 0.5 mM.

[0041] Compared with the prior art, the present invention has at least the following beneficial effects:

[0042] On the basis of constructing a high-yield N-acetylglucosamine strain, the present invention further constructs an auxotrophic engineering bacterium, which realizes the efficient production of N-acetylglucosamine and can avoid the use of antibiotics at the same time. The fermentation yield of N-acetylglucosamine can reach 98 g / L, providing a new method and new idea for the efficient, low-cost and safe industrial production of N-acetylglucosamine. Description of the Drawings

[0043] Figure 1A It is the HPLC result diagram of the GlcNAc standard product;

[0044] Figure 1B It is the HPLC result diagram of the fermentation broth sample;

[0045] Figure 1C It is the MS result diagram of the fermentation broth sample;

[0046] Figure 2 It is the sequencing result diagram after the asd locus of the genome of strain TCBJ-007-0 is knocked out;

[0047] Figure 3Growth curves of Escherichia coli TCBJ-007-0, TCBJ-008-1, TCBJ-008-2, and TCBJ-008-3 in LB medium;

[0048] Figure 4 GlcNAc production graph of the TCBJ121 passaged strain;

[0049] Figure 5 GlcNAc production graph of TCBJ121 in a 1.5 L fermenter. Detailed implementation methods

[0050] The technical solutions of the present invention will be further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of the claimed rights of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0051] For those not specifying specific techniques or conditions in the examples, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For reagents or instruments not specifying the manufacturer, they are all conventional products that can be obtained through regular channels.

[0052] Example 1

[0053] In this example, the construction and yield verification of Escherichia coli TCBJ117 and TCBJ118 were carried out.

[0054] (1) Preparation of Escherichia coli EcNcΔattB(lacUV5-T7)ΔendAΔompT (this method is also described in CN202310516515.6).

[0055] 1) In the original strain, probiotic Escherichia coli Nissle1917 (E. coli Nissle1917), based on the CRISPR / Cas9 gene editing technology, using a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm company, product number E086), the Cas9 fragment was ligated with the double-digested fragment of the pKD46 plasmid by NcoI enzyme / XhoI enzyme to construct the pKD-Cas9 plasmid. The pKD-Cas9 plasmid was transformed into the E. coli Nissle1917 strain, and positive clones were screened and named EcN-Cas9.

[0056] 2) While preparing EcN-Cas9, sgRNAs of the cryptic plasmids pMTU1 and pMTU2 were designed and prepared respectively, and transferred into EcN-Cas9 for the knockout of the cryptic plasmids, thereby constructing an Escherichia coli strain with the cryptic plasmids removed, named EcNc.

[0057] Among them: sgRNA-pMTU1: agttaccggataaggcgcagcgg; sgRNA-pMTU2: gtttggcgcagaacctcggacgg.

[0058] 3) Insert the optimized T7RNAP expression cassette into the genome of Escherichia coli Nissle 1917, and the insertion site of the expression cassette is the attB site on the genome.

[0059] The optimized T7RNAP expression cassette (abbreviated as "lacUV5-T7") includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase (Gene ID: 1261050) sequence located downstream of the spacer sequence downstream of the RBS. The 5' end of the T7RNAP expression cassette sequence is tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaaGGCCACTACTAGAGAAAGAGGAGAAA TACTAG ATGAACACGATTAACATCGCTAAGAAC, where the promoter sequence is "tttacactttatgcttccggctcgtataatg", the operator sequence is "ttgtgagcggataacaa", the RBS sequence is "AAAGAGGAGAAA", the spacer sequences are "GGCCACTACTAGAG" (upstream spacer sequence of the RBS) and "TACTAG" (downstream spacer sequence of the RBS), and "ATGAACACGATTAACATCGCTAAGAAC" is the upstream partial sequence of the coding gene of T7 RNA polymerase (Gene ID: 1261050), and ATG is the start codon. The complete optimized T7RNAP expression cassette sequence is SEQ ID NO.5.

[0060] SEQ ID NO.5:

[0061]

[0062] Refer to step 1) to construct EcNc-Cas9, then co-transform the pUC-sgRNA-attB plasmid and the Donor fragment (the Donor fragment contains the T7 RNAP fragment (i.e., the T7RNAP expression cassette) and homologous arms of approximately 300 bp in length upstream and downstream of the attB site) into EcNc-Cas9 cells, and use the CRISPR / Cas9 system to integrate the T7RNAP fragment into the attB site of the EcNc strain to obtain the strain EcNcΔattB(lacUV5-T7), abbreviated as EcNc-T7.

[0063] Among them, the sgRNA nucleotide sequence targeting the attB site is sgRNA-attB: ctaacttgagcgaaacgggaagg; the Donor fragment is the T7 RNAP fragment (i.e., the T7RNAP expression cassette) and homologous arms of approximately 300 bp in length upstream and downstream of the attB site.

[0064] 4) Knock out the endA and ompT genes in the probiotic Escherichia coli EcNc-T7 strain based on the CRISPR / Cas9 gene editing technology to prepare EcNcΔattB(lacUV5-T7)ΔendAΔompT.

[0065] Design the sgRNAs for the endA and ompT genes respectively. The sgRNA nucleotide sequence of endA is sgRNA-endA: tttttctcaagcgaaagccgcgg; the sgRNA nucleotide sequence of ompT is sgRNA-ompT: tactcctgacaacataaatgcgg. Use the CRISPR / Cas9 knockout system to transform it into the target strain EcNc-T7, that is, knock out the target genes of EcNc-T7 to obtain EcNcΔattB(lacUV5-T7)ΔendAΔompT, and name it "TCBJ117".

[0066] In addition to using the CRISPR / Cas9 gene editing technology, homologous recombination technology can also be used to knock out related genes and plasmids, and the finally obtained strain is the same as TCBJ117.

[0067] (2) Construction of engineering strain TCBJ118

[0068] Using the CRISPR / Cas9 gene editing technology, the nagB, nagA, manX, nagE, and nagK genes in the EcNcΔattB(lacUV5-T7)ΔendAΔompT(TCBJ117) strain were further knocked out to obtain a chassis strain (EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK, named TCBJ-007-0, Table 1). Using the genome of Escherichia coli K-12 MG1655 as a template, the gene fragment of EcglmS was cloned; the gna1 gene derived from Saccharomyces cerevisiae was synthesized and named Scgna1. The EcglmS and Scgna1 gene fragments were ligated to the vector pRSFDuet by homologous recombination to construct the expression plasmid pRSF-EcglmS-Scgna1. pRSF-EcglmS-Scgna1 was transferred into the strain TCBJ-007-0 to obtain a probiotic Escherichia coli engineering strain EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK / pRSF-EcglmS-Scgna1 (named TCBJ118, Table 1).

[0069] Table 1 List of strains

[0070]

[0071] (3) Yield verification of TCBJ118: TCBJ118 was inoculated into 2 mL of LB medium containing Kan and cultured overnight at 37 °C and 220 rpm in a shaking flask for about 15 h to obtain a seed solution; 1 mL of the overnight-cultured seed solution was inoculated into 50 mL of 2YT medium containing Kan, glucose with a final concentration of 80 g / L was added, and the mixture was cultured at 30 °C and a shaking speed of 250 rpm for about 6 h (OD of the bacterial solution 600 was about 0.8). IPTG with a final concentration of 0.1 mM was added, and the fermentation was continued at 25 °C and a shaking speed of 250 rpm for 48 h. After the fermentation was completed, the fermentation supernatant was collected by centrifugation. The supernatant was boiled at 100 °C for 10 min, centrifuged again, the supernatant was diluted 10 times with sterile water, the sample was filtered through a 0.22 μm filter membrane, and the content of GlcNAc was detected by the external standard method using liquid chromatography. The results showed that after 48 h of fermentation, the GlcNAc yield of the strain TCBJ118 reached 10.23 g / L.

[0072] HPLC detection conditions: Chromatographic column: EclipsePlus C18 RRHD 1.8μm 2.1×50mm; Mobile phase: Pump A is H2O + 0.1% formic acid, Pump B is methanol; Elution gradient is shown in Table 2; Column temperature is 30°C.

[0073] Table 2 Liquid phase elution conditions of GlcNAc

[0074] Time min A% B% Flow rate ml / min Upper pressure limit bar 0 40 60 0.3 600 1 40 60 0.3 600 4.5 2 98 0.3 600 7 2 98 0.3 600 7.1 40 60 0.3 600 10 40 60 0.3 600

[0075] MS detection conditions: Ionization mode: Electrospray positive ion mode; Detection mode: Product Ion; Nebulizing gas pressure: 40 psi; Ion spray voltage: 4000 V; Dryer temperature: 350°C; Dry gas flow rate: 8 L / min. Qualitative ion pairs, fragmentation voltage and collision energy are shown in Table 3.

[0076] Table 3 Qualitative ion pairs, fragmentation voltage and collision energy of GlcNAc

[0077]

[0078] The HPLC-MS results of GlcNAc standard and sample are shown in Figure 1A - Figure 1C Figure 1A The peak elution time of GlcNAc standard in [reference] is 13.024 min, Figure 1B The peak elution time of the product peak in the fermentation broth sample is the same as that of the GlcNAc standard; and the MS results of the sample ([reference] Figure 1C ) mainly produce m / z 222.1, 204.1, 168.1 and 138.0, among which 222.1 is the parent ion peak (M+1), and m / z 204.1, 168.1 and 138.0 are the daughter ion peaks, which are consistent with the MS results of GlcNAc reported in the literature, indicating that the product of strain TCBJ118 is GlcNAc.

[0079] sgRNA-nagB (SEQ ID NO.6): 5'ctgactaccgctgaacaggtcgg 3'.

[0080] sgRNA-nagA (SEQ ID NO.7): 5'catcagcgataacaaccgcgtgg 3'.

[0081] Donor-nagB (SEQ ID NO.8):

[0082] gacgccggttcgttaaatgcaatatgaccgtcgttacctacaccgcccataaacagatgaatttttccgtaagaacggattttttcttcatactggcggcattcggcttcgatatccggggcgttgccgttgagaaggttgatattttctgctggaatatcaacgtgatcgaagaaattacggtgcataaagctgtagtagctttccggatgctctttcggcagaccgacatattcgtccatgttgaaggtgacaacgtgcttaaagctgacctggcctgctttatgcatttcgactaacgctttataggtggtcatcggcgtgccgccagtcggcaggcccagtacaaacggacgatcggcagtcggtttgaacgcattgatacgattgacgatatggcgagcagcccatttgttattaggggatcagtctcattattcacctcaataagtaaaatgtaagccgttggcggattaggcatctttaagcgtaacctggatttgcgcagacaggcgtcaatccgacctgattttttgaatgataaaataagttttctggtttagccagtaaaagggagtgatgataacgatatttggtgacaaaactcacaaaagacacgcgtttaatttgcgatacgaattaaattttcacacactctgtagcagatgatctaacaatctgattacagaacatcggcagtacaatttgcagc。

[0083] Donor-nagA(SEQ ID NO.9):

[0084] acgcctggttcggatgttttgccaggtactcgcgcataacgcgcacgccctgtttcatcagctcatcgctggtggtgataagcgtcggcagatagttagtacagcctgatttctcattggctttctgcatgatttccagcgtttccacgctgaccgcttcagcggtgtcgttaaactgtacgccgccgcagccgtttaactgcacatcgataaaaccgggggagagaatggccccgttcagtgaacgttgttcgatctctggcggcagttccgctaccggacagacgcttttaatcaggctcatcaagaaattcgtggccggtaaagatccggccctgggttaatgcatacattctgacccccgattttaaaaaataatgccctgagcaaggagccagggcagggataacaattacagacccttgatattttctgcttctaattcattgaaatatcttaaagtcttaactttcagctccatggtggaaggttcatcgcacaccatgatcgcttttggatgcagttgcagacaactgatggtccacatgtggttcacgcaaccttcaacggcggcctgcagtgccagtgctttctgactacccagcaccagaatcatcacttcttcggcatccagcaatgtaccaacaccgacagtcagggcatattttggcacctgattaacatcgttatcaaagaaacgagagttcgcgacgcgagtgtcatgagtcagggttttgatacgagtacgagaagccagagaagacgccggttcgttaaatgcaatatgaccgtcg。

[0085] sgRNA - manX: (SEQ ID NO.10): 5'ttaggcgagcaggaaaacgtcgg 3'.

[0086] sgRNA - nagE: (SEQ ID NO.11): 5'cgatggcgaagattaatgcgagg 3'.

[0087] sgRNA-nagK: (SEQ ID NO.12): 5'gcgcttggcgtgtttgatagcgg 3'.

[0088] Donor-manX(SEQ ID NO.13):

[0089] ctttgcaaacgaatgtgacaaggatattttacctttcgaaatttctgctaatcgaaagttaaattacggatcttcatcacataaaataattttttcgatatctaaaataaatcgcgaaacgcaggggtttttggttgtagcccttatctgaatcgattcgattgtggacgacgattcaaaaatacatctggcacgttgaggtgttaacgataataaaggaggtagcaagtgaccattgctattgttataggcacacatggttgggctgcagagcagttgcttaaaacggcagaaatgctgctggatcgatttcgttccaggtgaaaatgccgaaacgctgattgaaaagtacaacgctcagttggcaaaactcgacaccactaaaggcgtgctgtttctcgttgatacatggggaggcagcccgttcaatgctgccagccgcattgtcgtcgacaaagagcattatgaagtcattgcaggcgttaacattccaatgctcgtggaaacgttaatggcccgtgatgatgacccaagctttgatgaactggtggcgctggcagtagaaacaggccgtgaaggcgtgaaagcactgaaagccaa.

[0090] Donor-nagE(SEQ ID NO.14):

[0091] cgtttaatttgcgatacgaattaaattttcacacactctgtagcagatgatctaacaatctgattacagaacatcggcagtacaatttgcagcaaaataaaaatacggctttaaacgagccaaatagggttctcgtagggggaataagatgaatattttaggttttttccagcgactcggtagggcgttacagctccctatcgcggtgctgccggtggcggcgctgttgctgcgattcggtcagccagatttacttaacgttgcgtttattgcccaggcgggcggtgcgatttttgataacctgcgtggcatccagctggtcgaaagacagcgcaggtgcggcggcactggcgggtgcggtaggttactttgtgttaaccaaagcgatggtgaccatcaacccagaaattaacatgggtgtactggcgggtatcattaccggtctggttggtggcgcagcctataaccgttggtccgatattaaactgccggacttcctgagcttcttcggcggcaaacgctttgtgccgatcgccaccggcttcttctgtctggtgctggcggccatttttggttacgtctggccgccggtacagcacgcta。

[0092] Donor-nagK(SEQ ID NO.15):

[0093] gttatcggcgtggtggtttcacttaaacttaccccgattattgagtggattgaaaagctgatcggtcatcagttcctctccagcgatatctattttattgacttcttgccatcggaattgcactggctggacgtcttctacgtactggtcacagcattgttgctgagtcttttggcaagttggtatccggcgcggcgcgccagtaatattgaccctgcgcgagtccttagcggccagtaaaggcagtacattaaaacaaggagcggcaatgtattacgggtttgatattggtggaacaaaaatttaataatcggcagttgcagtgggaaaagcgggtgccgacaccgcgtgacagctatgacgcatttttagatgcagtgtgtgagctggtagctgaagctgaccggcgttttggctgtaaaggttctgtcggcatcggtattccgggaatgccggaaacagaagatggtacgctgtatgccgccaatgtccctgctgccagcggtaaaccgctgcgtgccgacctgagcgcacgtcttgatcgcgatgtacgccttgataacgatgccaactgttttgccctttctgaagcatgggatgatgaatttactcaatatccactggtgatggggttgattctcggcaccggcgttggcggcgggctgattttcaacggtagaccaattaccggtaaaagctatattaccggcgagtttggccatatgcgtctgcc。

[0094] EcglmS (SEQ ID NO.16):

[0095]

[0096] Scgnal(SEQ ID NO.17):

[0097] atgagcttacccgatggattttatataaggcgaatggaagagggggatttggaacaggtcactgagacgctaaaggttttgaccaccgtgggcactattacccccgaatccttcagcaaactcataaaatactggaatgaagccacagtatggaatgataacgaagataaaaaaataatgcaatataaccccatggtgattgtggacaagcgcaccgagacggttgccgctacggggaatatcatcatcgaaagaaagatcattcatgaactggggctatgtggccacatcgaggacattgcagtaaactccaagtatcagggccaaggtttgggcaagctcttgattgatcaattggtaactatcggctttgactacggttgttataagattattttagattgcgatgagaaaaatgtcaaattctatgaaaaatgtgggtttagcaacgcaggcgtggaaatgcaaattagaaaatag。

[0098] Example 2

[0099] In this example, the asd gene of the knockout strain TCBJ-007-0 was knocked out.

[0100] Using the CRISPR / Cas9 gene editing technology, sgRNA sequences (SEQ ID NO.18: 5’gttcctgtcagcctttaccgtgg 3’ and SEQ ID NO.19: 5’gttggttttatcggctggcgcgg 3’) of the gene asd (shown in SEQ ID NO.1) were designed, and the sgRNA and the Donor sequence were cloned into the gene editing vector Donor plasmid. The specific experimental procedures included the following steps:

[0101] Donor sequence of asd (SEQ ID NO.20):

[0102] actcgtgtattccgccacccttaaagaatagccaatgctctatttaactcccggtaaatcatgaaacatctgcgcttactcctgtattacgcactagcaggggcgg catcgcgccccagatttaatgaataaagattacgccagttgacgaagcatccgacgcagcggctccgcggccccccacagccctgcaaagatgtgtgctgtataaat gtgccggtctcctcctggcacatctttcaccatacaaaaagcagccaaagtcgcaagt。

[0103] (1) Prepare the electrocompetent cells of strain TCBJ-007-0;

[0104] (2) Transform the pSynbio-Cas9 plasmid into TCBJ-007-0 cells, spread the bacterial solution on a Kan-resistant plate, and culture it at a constant temperature of 37°C;

[0105] (3) Pick monoclonal colonies for PCR verification the next day, and prepare electrocompetent cells EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK-Cas9 from the positive clones;

[0106] (4) Transfer the pSynbio-sgRNA-asd and donor fragments into the electrocompetent cells of EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagK-Cas9, spread the bacterial solution on a Kan+Spec+DAP (2,6-diaminopimelic acid)-resistant plate, and culture it at a constant temperature of 37°C;

[0107] (5) Pick monoclonal colonies for large-scale culture the next day, amplify the target gene fragment using primers (asd-donor-F’5’aggtaaggctgtgaatactcgtgt 3’ and asd-donor-R’5’cgcattactgatggcttcgctat 3’), and identify it by agarose gel electrophoresis and sequencing; Recover the correct band by agarose gel electrophoresis and verify it by sequencing. The sequence of the knocked-out fragment is consistent with the donor fragment.

[0108] The sequencing identification result after knocking out the asd gene of strain TCBJ-007-0 is as Figure 2As shown, after sequencing verification, the knocked-out fragment sequence was consistent with the donor-designed fragment, and the strain EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagKΔasd was obtained and named TCBJ-008-0.

[0109] Example 3

[0110] In this example, the promoter of the asd gene was screened.

[0111] (1) Construction of the complementation plasmid: Using primers P J23119 -F’(5’gtgagcgaggaagcggaagagcgctgcatgcttga 3’) and asd-R’PCR(5’ccgacgacaagctgacgaccgggtctc 3’), the P J23119 promoter and the asd gene (P J23119 -asd, SEQ ID NO.2) were amplified; using primers P gapA -F’(5’gtgagcgaggaagcggaagagcgctgcatgcgct3’) and asd-R’PCR, the P gapA promoter and the asd gene (P gapA -asd, SEQ ID NO.3) were amplified; using primers P asd -F’(5’gtgagcgaggaagcggaagagcgctgcatgccgtc 3’) and asd-R’PCR, the P asd promoter and the asd gene (P asd -asd, SEQ ID NO.4) were amplified; using the plasmid pRSFDuet as a template and the homologous recombination kit (ProLigation-Free Cloning Kit, abm, product number E086), P J23119 -asd, P gapA -asd or P asd -asd were used to replace the Amp promoter and the kan gene of pRSFDuet, and the recombinant plasmids pRSF-P J23119 -asd, pRSF-P gapA -asd, pRSF-P asd -asd were obtained respectively.

[0112] (2) Construction of the complementation strain: The recombinant plasmids pRSF-P J23119 -asd, pRSF-P gapA -asd, pRSF-P asd-asd was separately transformed into the strain TCBJ-008-0 constructed in Example 2 to obtain a series of complemented engineering strains, namely EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagKΔasd / pRSF-P J23119 -asd, EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagKΔasd / pRSF-P gapA -asd, EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagKΔasd / pRSF P asd -asd, which were respectively named strain TCBJ-008-1, TCBJ-008-2, and TCBJ-008-3.

[0113] (3) Verification of the growth of the complemented strains: The growth curves of strains TCBJ-007-0, TCBJ-008-1, TCBJ-008-2, and TCBJ-008-3 were verified. The strains were inoculated into 2 mL of LB medium and cultured overnight at 37 °C and 220 rpm in a shaker flask for about 15 h to obtain seed liquid; 1 mL of the overnight-cultured seed liquid was inoculated into 50 mL of LB medium, glucose with a final concentration of 80 g / L was added, and the culture was carried out at 30 °C and 250 rpm for about 48 h, and the OD of the bacterial liquid was detected. 600nm . The results are as Figure 3 shown. Among them, the growth curve of strain TCBJ-008-3 is similar to that of strain TCBJ-007-0. Therefore, strain TCBJ-008-3 is a suitable auxotrophic chassis cell for GlcNAc synthesis.

[0114] Example 4

[0115] In this example, the construction of an auxotrophic GlcNAc engineering bacterium and the verification of its yield were carried out.

[0116] (1) Construction of the auxotrophic plasmid: Using primers P asd -F’(5’gtgagcgaggaagcggaagagcgctgcatgccgtc 3’) and asd-R’PCR(5’ccgacgacaagctgacgaccgggtctc 3’) to amplify the P asd promoter and the asd gene (P asd -asd); Using plasmid pRSF-EcglmS-Scgna1 as a template, using P asd- The Amp promoter and kan gene of pRSF-EcglmS-Scgna1 were replaced with the -asd fragment to obtain the recombinant plasmid pRSF-EcglmS-Scgna1-P asd -asd

[0117] (2) Construction of auxotrophic strains: The recombinant plasmid pRSF-EcglmS-Scgna1-P asd -asd was transformed into the strain TCBJ-008-0 constructed in Example 2 to obtain the auxotrophic probiotic Escherichia coli engineering strain EcNcΔattB(lacUV5-T7)ΔendAΔompTΔnagBΔnagAΔmanXΔnagEΔnagKΔasd / pRSF-EcglmS-Scgna1-P asd -asd, named TCBJ121

[0118] (3) Verification of the yield of strain TCBJ121: Specifically, the fermentation included: The recombinant Escherichia coli TCBJ121 was cultured overnight at 37 °C and 220 rpm in 2 mL of LB medium for about 15 h. 1 mL of the overnight cultured seed solution was transferred into 50 mL of LB medium, and glucose with a final concentration of 40 g / L was added. The culture was carried out at 30 °C and a shaker speed of 250 rpm for about 6 h (the OD of the bacterial solution 600 was about 0.8). IPTG with a final concentration of 0.1 mM was added, and the fermentation was continued at 25 °C and a shaker speed of 250 rpm for 48 - 72 h. After the fermentation was completed, the fermentation supernatant was collected by centrifugation. The supernatant was boiled at 100 °C for 10 min, centrifuged again, and the supernatant was diluted 10 times with sterile water. The sample was filtered through a 0.22 μm filter membrane, and the GlcNAc content was detected by the external standard method using liquid chromatography. The results in Table 4 showed that the yield of TCBJ121 was the same as that of strain TCBJ118, indicating that the yields of the auxotrophic strain and the resistant strain were the same. That is, without the use of antibiotics, the GlcNAc yield could still reach a relatively high level, solving the problems of high-cost antibiotic use and antibiotic abuse

[0119] Table 4 GlcNAc yields of strains TCBJ121 and TCBJ118

[0120]

[0121] Example 5

[0122] This example analyzed the passage stability of strain TCBJ121

[0123] (1) Subculture of strain TCBJ121: The TCBJ121 strain obtained after transformation in step (2) of Example 4 is the primary strain (the 1st generation strain). Pick a single colony from the primary strain petri dish and inoculate it into LB liquid medium at 37°C with shaking at 200 rpm. On the second day, inoculate it into LB liquid medium at an inoculation amount of 1% and continuously shake and culture at 37°C. Transfer the culture to a new tube every 12 hours, and each transfer is recorded as 1 generation. Obtain bacterial solutions of different generations and store them at -80°C.

[0124] (2) Microscopic examination of strain TCBJ121: Use an inoculation loop to pick a small amount of pure-cultured bacteria from the 1st, 5th, 10th, 15th, 20th, 25th, and 30th generations respectively, perform Gram staining, and observe the staining and morphology of bacteria of different generations under a microscope. The morphology of TCBJ121 under the microscope is basically the same, all being Gram-negative bacilli, typical Escherichia coli colonies, and no contaminating bacteria grow.

[0125] (3) Detection of plasmid retention rate: Appropriately dilute the bacterial solutions of the 1st, 5th, 10th, 15th, 20th, 25th, and 30th generations respectively, spread them on LB medium containing DAP, and culture overnight at 37°C. Then pick 100 single colonies respectively onto LB medium with and without DAP, and culture overnight at 37°C to calculate the plasmid retention rate during the subculture of the engineered strain TCBJ121. Plasmid retention rate % = number of colonies on LB plate without DAP / number of colonies on LB plate with DAP × 100%. The plasmid retention rate of the engineered strain TCBJ121 is shown in Table 5, indicating that the plasmid has good stability after 30 subcultures, and the plasmid loss rate at the 30th generation is 10%.

[0126] (4) Yield verification of subcultured strains: The verification method refers to step (3) in Example 4. The results are as Figure 4 shown. After the strain TCBJ121 is subcultured 30 times, the GlcNAc yield has no obvious change, indicating that the strain TCBJ121 has good GlcNAc yield stability in the first 30 generations.

[0127] Table 5 Plasmid retention rate of subcultured strains of TCBJ121

[0128]

[0129]

[0130] Example 6

[0131] This example uses a fermenter to verify the GlcNAc yield of strain TCBJ121.

[0132] The fermentation medium is an inorganic salt medium: 2 g / L of yeast powder, 15.6 g / L of Na2HPO4·12H2O, 3 g / L of KH2PO4, and 1 g / L of NH4C1. When inoculating, add: 1 g / L of magnesium sulfate, 1 mL / L of nutrient solution (containing 10 g / L of ferric citrate, 2.25 g / L of zinc sulfate heptahydrate, 1 g / L of copper sulfate pentahydrate, 0.35 g / L of manganese sulfate monohydrate, 0.23 g / L of sodium borate decahydrate, 0.11 g / L of ammonium molybdate, and 2 g / L of calcium chloride dihydrate), 10 g / L of glucose, and the inoculation amount is 0.75%. The initial fermentation temperature is 30 °C, OD 600 nm Induce when OD reaches 16, the IPTG induction concentration is 0.2 mM, and the induction temperature is 25 °C. The feeding material is 600 g / L of glucose, 1 g / L of magnesium sulfate heptahydrate, 1 mL / L of nutrient solution, and the alkali supplement is ammonia water plus an equal volume of sterile water. The fermentation time is 86 h. Centrifuge the strain fermentation broth at 10000 rpm for 1 min to obtain the supernatant of the fermentation broth; dilute the supernatant of the fermentation broth by 10 times and then filter it through a 0.22 μm aqueous filter membrane. Detect the diluted fermentation supernatant by HPLC.

[0133] HPLC detection conditions: Agilent RID differential refractive index detector; mobile phase: 0.5 mM dilute sulfuric acid; column: HPX-87H (Bio-Rad); column temperature: 40 °C; flow rate is 0.5 mL / min, injection volume is 10 μL, and detection time is 30 min.

[0134] The GlcNAc production and OD of strain TCBJ121 in a 1.5 L fermenter 600nm See Figure 5 . After 86 h of fermentation, the GlcNAc production reaches 98 g / L.

[0135] In summary, on the basis of constructing a high-yield N-acetylglucosamine strain, the present invention further constructs a auxotrophic engineering bacterium, which realizes the efficient production of N-acetylglucosamine while avoiding the use of antibiotics. The fermentation N-acetylglucosamine production can reach 98 g / L, providing a new method and new idea for the efficient, low-cost and safe industrial production of N-acetylglucosamine.

[0136] The applicant declares that the above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. An auxotrophic Escherichia coli for producing N-acetylglucosamine, characterized in that: The auxotrophic Escherichia coli lacks the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, the acetylglucosamine kinase gene nagK and the aspartate semialdehyde dehydrogenase gene asd, and contains a recombinant expression vector, wherein the recombinant expression vector contains the aspartate semialdehyde dehydrogenase gene asd, the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1.

2. The N-acetylglucosamine-producing auxotrophic Escherichia coli according to claim 1, characterized in that The initial strain of the N-acetylglucosamine-producing auxotrophic Escherichia coli includes Escherichia coli Nissle1917ΔattB(lacUV5-T7)ΔendAΔompT.

3. The N-acetylglucosamine-producing auxotrophic Escherichia coli according to claim 1 or 2, characterized in that: The initial vector of the recombinant expression vector includes the pRSFDuet vector.

4. The auxotrophic Escherichia coli for producing N-acetylglucosamine according to any one of claims 1 to 3, characterized in that The promoter of the aspartate semialdehyde dehydrogenase gene asd in the recombinant expression vector includes P J23119 Promoter, P gapA Promoter or P asd Any one of the promoters.

5. The N-acetylglucosamine-producing auxotrophic Escherichia coli according to any one of claims 1 to 4, characterized in that The source of the glucosamine synthase gene glmS includes any one of Escherichia coli K-12MG1655, Bacillus subtilis or Corynebacterium glutamicum; Preferably, the glucosamine acetylase gene gna1 is derived from any one of Saccharomyces cerevisiae, Caenorhabditis elegans, or Saccharomyces cerevisiae after being codon-optimized in Escherichia coli.

6. A method for constructing an auxotrophic Escherichia coli for producing N-acetylglucosamine according to any one of claims 1 to 5, characterized in that: The construction method comprises: knocking out the deaminase gene nagB, the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, the acetylglucosamine kinase gene nagK and the aspartate semialdehyde dehydrogenase gene asd in Escherichia coli to obtain a knockout strain; The recombinant vector containing the aspartate semialdehyde dehydrogenase gene asd, the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1 was introduced into the knockout strain.

7. The method for constructing an auxotrophic Escherichia coli for producing N-acetylglucosamine according to claim 6, characterized in that: The preparation method of the recombinant vector comprises: The glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 were inserted into the original vector, and the aspartate semialdehyde dehydrogenase gene asd and its promoter were used to replace the resistance gene and promoter on the original vector.

8. Use of the N-acetylglucosamine-producing auxotrophic Escherichia coli according to any one of claims 1 to 5 in producing N-acetylglucosamine.

9. A method for producing N-acetylglucosamine, characterized in that: The method comprises: Fermentation culture of the N-acetylglucosamine-producing auxotrophic Escherichia coli according to any one of claims 1 to 5, and product purification to obtain N-acetylglucosamine.

10. The method for producing N-acetylglucosamine according to claim 9, characterized in that: The fermentation medium of the fermentation culture contains glucose, yeast powder, Na2HPO4·12H2O, KH2PO4, NH4C1, ferric citrate, zinc sulfate heptahydrate, copper sulfate pentahydrate, manganese sulfate monohydrate, sodium borate decahydrate, ammonium molybdate, calcium chloride dihydrate and magnesium sulfate; Preferably, the fermentation culture temperature is 25-35°C; Preferably, the fermentation culture process further comprises the step of adding an inducer; Preferably, the inducing agent comprises IPTG; Preferably, the working concentration of the inducer is 0.1-0.5 mM.

Citation Information

Patent Citations

  • T7 expression system-based Nissel 1917 engineering bacterium as well as preparation method and application of T7 expression system-based Nissel 1917 engineering bacterium

    CN118931930A