Hybridoma cell strain and monoclonal antibody for detecting or identifying MDV-1 and application thereof

Abstract

The present application belongs to the field of veterinary biotechnology detection, and particularly relates to a hybridoma cell strain for detecting or identifying MDV-1, a monoclonal antibody and application thereof. The present application takes pp38 protein of MDV-1 as an immunogen to screen a hybridoma cell strain MDV-1 Mab-pp38-E2 with a preservation number of CCTCC NO: C202501, and the monoclonal antibody generated by the hybridoma cell strain can recognize different serum type I chicken Marek's disease virus strains, does not have cross reactions with serum type II chicken Marek's disease virus, serum type III chicken Marek's disease virus, chicken egg drop syndrome virus (EDSV) and other common avian disease viruses, has good specificity and sensitivity, can be used for exogenous virus detection of serum type I chicken Marek's disease virus in avian virus live vaccines, and can also be used for clinical identification, virus content determination and epidemiological investigation of serum type I chicken Marek's disease virus.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of veterinary biotechnology detection, and particularly relates to a hybridoma cell strain and a monoclonal antibody for detecting or identifying MDV-1 and application thereof. BACKGROUND

[0002] Marek disease (MD) is a highly contagious and neoplastic disease caused by Marek disease virus (MDV), which is characterized by lymphoid hyperplasia and tumor formation. MDV can be divided into three serotypes, i.e. MDV-1, MDV-2 and MDV-3. MDV-1 includes all oncogenic virulent strains (such as GA strain), artificially attenuated vaccine strains (such as CVI988, 814 strain) and meq gene deletion MDV-1 vaccine strains. MDV-2 is a non-pathogenic natural attenuated strain (such as SB-1); MDV-3 is a herpesvirus of turkeys (HVT). In recent years, due to the existence of chicken infectious anemia, avian leukemia and other immunosuppressive diseases in chicken flocks, and the increasing virulence of MDV and the tendency of evolution to stronger virulence, MD still occurs in chicken flocks although MD vaccine is widely used, which has caused huge economic losses to the poultry industry.

[0003] At present, the method for detecting MDV mainly includes agar diffusion test for detecting MDV antibody. However, the chicken examination method must be used to obtain chicken serum for detection in the MDV agar diffusion test for detecting antibody, and there are problems such as time-consuming, high cost, low sensitivity of the method, missed detection and the like. The method is only used for detecting agar diffusion test antibody, and cannot detect MDV antigen, and cannot distinguish and detect MDV-1, MDV-2 and MDV-3.

[0004] The indirect immunofluorescence method (IFA) has the characteristics of rapidness, simplicity, sensitivity, specificity, low cost and the like, and has been included in the Veterinary Pharmacopoeia of the People's Republic of China (Volume III) for antigen detection of avian reticuloendotheliosis virus (REV) and fowl adenovirus group I (FadV-1). However, there is no IFA detection method for type I MDV, and it is particularly important in the field to screen a monoclonal antibody with high specificity and high sensitivity for type I MDV and realize IFA detection of type I MDV. SUMMARY

[0005] The present application aims to provide a hybridoma cell strain and a monoclonal antibody for detecting or identifying MDV-1 and application thereof, which specifically recognize MDV-1 and do not have cross-reaction with MDV-2, MDV-3, chicken egg drop syndrome virus (EDSV) and other common avian disease viruses, and have high sensitivity.

[0006] The application provides a hybridoma cell strain MDV-1Mab-pp38-E2 for detecting or identifying a serotype I chicken Marek's disease virus, and the preservation number is CCTCC NO: C202501.

[0007] The application further provides a monoclonal antibody for detecting or identifying the serotype I chicken Marek's disease virus, wherein the monoclonal antibody is secreted by the hybridoma cell strain MDV-1Mab-pp38-E2 or a subculture cell strain thereof.

[0008] The application further provides application of the hybridoma cell strain MDV-1Mab-pp38-E2 or the monoclonal antibody in preparation of a product for detecting or identifying the serotype I chicken Marek's disease virus.

[0009] Preferably, the serotype I chicken Marek's disease virus includes one or more of the serotype I chicken Marek's disease virus CVI988 strain, the serotype I chicken Marek's disease virus 814 strain, the serotype I chicken Marek's disease virus Jing-1 strain and the serotype I chicken Marek's disease virus Md-5 strain.

[0010] The application further provides a kit for detecting or identifying the serotype I chicken Marek's disease virus, wherein the kit comprises the monoclonal antibody.

[0011] Preferably, the kit further comprises a fluorescently labeled anti-mouse antibody, a diluent and a washing solution.

[0012] Preferably, the diluent and the washing solution respectively comprise a phosphate buffer solution; the phosphate buffer solution has a pH value of 7.2-7.4 and a concentration of 9-11 mM.

[0013] The application further provides application of the hybridoma cell strain MDV-1Mab-pp38-E2 or the monoclonal antibody or the kit in detection of the pp38 protein of the serotype I chicken Marek's disease virus.

[0014] The application further provides application of the hybridoma cell strain MDV-1Mab-pp38-E2 or the monoclonal antibody or the kit in detection of one or more of the purity, the safety and the illegal addition of a live virus vaccine for poultry.

[0015] Preferably, the detection of the safety of the live virus vaccine for poultry comprises detection and / or monitoring of the concentration and / or the plaque number of the serotype I chicken Marek's disease virus in the live virus vaccine for poultry.

[0016] Beneficial effects:

[0017] The application provides a hybridoma cell strain MDV-1Mab-pp38-E2 for detecting or identifying a serum I type chicken Marek's disease virus, and the preservation number is CCTCC NO: C202501. The monoclonal antibody secreted by the hybridoma cell strain MDV-1Mab-pp38-E2 can recognize different serum I type chicken Marek's disease virus strains, and does not have cross reaction with serum II type chicken Marek's disease virus, serum III type chicken Marek's disease virus, chicken egg drop syndrome virus (EDSV) and other common avian disease viruses, has good specificity and sensitivity, and can be used for exogenous virus detection of serum I type chicken Marek's disease virus in avian virus live vaccine, and can also be used for clinical identification, virus content determination and epidemiological investigation of the serum I type chicken Marek's disease virus.

[0018] Biological preservation information

[0019] The hybridoma cell strain MDV-1Mab-pp38-E2 is classified as a hybridoma cell, and was preserved in the China Center for Type Culture Collection on February 8, 2025, and the preservation address is Wuhan University, Wuhan, China; the preservation name is MDV-1Mab-pp38-E2, and the preservation number is CCTCC NO: C202501; BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0021] Figure 1 It is an SDS-PAGE detection result graph of small amount expression of MDV-1-pp38 recombinant protein, wherein M is Marker, 1 is after IPTG induction, and 2 is before IPTG induction;

[0022] Figure 2 It is an SDS-PAGE detection result graph of large amount expression of MDV-1-pp38 recombinant protein, wherein M is Marker, 1 is supernatant after ultrasonic, and 2 is precipitate after ultrasonic;

[0023] Figure 3 It is an SDS-PAGE detection result graph of MDV-1-pp38 recombinant protein after purification, wherein M is Marker, and 1-3 are protein supernatants after purification;

[0024] Figure 4 It is a result graph of detecting MDV-1 CVI988 strain by using the indirect immunofluorescence kit of Example 4;

[0025] Figure 5 It is a result graph of detecting MDV-1814 strain by using the indirect immunofluorescence kit of Example 4;

[0026] Figure 6 Figure for the result of detecting MDV-1 Jing-1 strain by the indirect immunofluorescence kit of Example 4;

[0027] Figure 7 Figure for the result of detecting MDV-1 Md-5 strain by the indirect immunofluorescence kit of Example 4;

[0028] Figure 8 Figure for the result of detecting MDV-3 FC126 strain by the indirect immunofluorescence kit of Example 4;

[0029] Figure 9 Figure for the result of detecting MDV-2 SB-1 strain by the indirect immunofluorescence kit of Example 4;

[0030] Figure 10 Figure for the result of detecting NDV Clone30 strain by the indirect immunofluorescence kit of Example 4;

[0031] Figure 11 Figure for the result of detecting POX quail attenuated strain by the indirect immunofluorescence kit of Example 4;

[0032] Figure 12 Figure for the result of detecting IBV H120 strain by the indirect immunofluorescence kit of Example 4;

[0033] Figure 13 Figure for the result of detecting IBDV B87 strain by the indirect immunofluorescence kit of Example 4;

[0034] Figure 14 Figure for the result of detecting EDSV K911 strain by the indirect immunofluorescence kit of Example 4;

[0035] Figure 15 Figure for the result of detecting ALV RA V-1 strain by the indirect immunofluorescence kit of Example 4;

[0036] Figure 16 Figure for the result of detecting ALV RA V-2 strain by the indirect immunofluorescence kit of Example 4;

[0037] Figure 17 Figure for the result of detecting AIV (H9N2 subtype) AV1571 strain by the indirect immunofluorescence kit of Example 4;

[0038] Figure 18 Figure for the result of detecting FAdV GY strain by the indirect immunofluorescence kit of Example 4;

[0039] Figure 19 Figure for the result of detecting CIAV AV1550 strain by the indirect immunofluorescence kit of Example 4;

[0040] Figure 20 Figure for detection result of ILTV I LT / 13 strain by indirect immunofluorescence kit of Example 4;

[0041] Figure 21 Figure for detection result of ARV Reo S1133 strain by indirect immunofluorescence kit of Example 4. DETAILED DESCRIPTION

[0042] The application provides a hybridoma cell strain MDV-1Mab-pp38-E2 for detecting or identifying a serum I type chicken Marek's disease virus, and the preservation number is CCTCC NO: C202501.

[0043] The application further provides a monoclonal antibody for detecting or identifying a serum I type chicken Marek's disease virus, which is obtained by secretion of the hybridoma cell strain MDV-1Mab-pp38-E2 or a passaged cell strain thereof.

[0044] As an embodiment, the passaged cell strain of the hybridoma cell strain MDV-1Mab-pp38-E2 includes a cell strain passaged for less than 30 times; as another embodiment, the passaged cell strain of the hybridoma cell strain MDV-1Mab-pp38-E2 includes a cell strain passaged for 30 times. The application has the advantages of keeping the purity and stability of the monoclonal antibody by limiting the number of passages.

[0045] The pp38 protein is highly conservative in different serum I type chicken Marek's disease virus (MDV-1) strains, the pp38 protein is prepared based on the serum I type chicken Marek's disease virus (MDV-1), the mouse is immunized by taking the pp38 protein as an immunogen, the spleen cell suspension of the immunized mouse is collected, and then the hybridoma cell strain MDV-1Mab-pp38-E2 is obtained by fusing, culturing and screening the SP2 / 0 cell. The monoclonal antibody secreted by the hybridoma cell strain MDV-1Mab-pp38-E2 can specifically recognize different MDV-1 strains, and does not have cross reaction with MDV-2, MDV-3, chicken egg drop syndrome virus (EDSV) and other common avian disease viruses, and has high sensitivity.

[0046] In view of the above advantages, the hybridoma cell strain MDV-1Mab-pp38-E2 or the monoclonal antibody in the application also belongs to the protection scope of the application in the application of preparing a product for detecting or identifying a serum I type chicken Marek's disease virus.

[0047] As an implementation form, the product of the present application comprises reagents and / or kits. As an implementation form, the kit of the present application is an indirect immunofluorescence detection kit.

[0048] As an implementation form, the method for detecting or identifying the serum type I chicken Marek's disease virus by using the product of the present application comprises the following steps: performing first incubation on the chicken embryo fibroblasts inoculated with the sample to be detected by using the monoclonal antibody, and obtaining a first incubation product after washing; the monoclonal antibody is the monoclonal antibody secreted by the hybridoma cell strain MDV-1Mab-pp38-E2 described in the above technical solution; performing second incubation on the first incubation product by using the FITC-labeled goat anti-mouse antibody, and obtaining a second incubation product after washing; performing staining on the second incubation product, observing under the wavelength of 490 nm, and judging according to the fluorescence staining result: when specific green fluorescence appears, it is judged that the sample to be detected contains the serum type I chicken Marek's disease virus; when specific green fluorescence does not appear, it is judged that the sample to be detected does not contain the serum type I chicken Marek's disease virus. As an implementation form, the sample to be detected is inoculated into CEF (chicken embryo fibroblasts) for adsorption and culture to obtain the chicken embryo fibroblasts inoculated with the sample to be detected. As an implementation form, the adsorption time of the present application is 50-70 min; as another implementation form, the adsorption time of the present application is 60 min. As an implementation form, the culture temperature of the present application is 37℃. As an implementation form, the culture time of the present application is 2-4 days; as another implementation form, the culture time of the present application is 3 days. The method provided by the present application can be used for detecting MDV-1 virus without cross reaction to other viruses, and has the advantages of convenience, high efficiency, strong operability, high specificity and sensitivity. Popularization and use of the technical solution in the present application are beneficial to further guarantee the purity and safety of the live virus vaccine for poultry, thereby improving the quality of the vaccine, and can also be used for clinical detection, virus content determination and epidemiological investigation of MDV-1.

[0049] As an implementation form, the serum type I chicken Marek's disease virus of the present application comprises one or more of the serum type I chicken Marek's disease virus CVI988 strain, the serum type I chicken Marek's disease virus 814 strain, the serum type I chicken Marek's disease virus Jing-1 strain and the serum type I chicken Marek's disease virus Md-5 strain; as another implementation form, the serum type I chicken Marek's disease virus of the present application comprises the serum type I chicken Marek's disease virus CVI988 strain, the serum type I chicken Marek's disease virus 814 strain, the serum type I chicken Marek's disease virus Jing-1 strain or the serum type I chicken Marek's disease virus Md-5 strain.

[0050] The application further provides a kit for detecting or identifying the serotype I chicken Marek's disease virus, which comprises the monoclonal antibody in the technical solution.

[0051] As an implementation form, the kit further comprises a fluorescently labeled anti-mouse antibody, a diluent and a washing solution. As an implementation form, the fluorescent labeling comprises FITC labeling or CY3 labeling. As an implementation form, the anti-mouse antibody comprises an anti-mouse antibody. As an implementation form, the anti-mouse antibody comprises a goat anti-mouse antibody or a rabbit anti-mouse antibody.

[0052] As an implementation form, the kit further comprises a color developing solution. As an implementation form, the diluent and the washing solution each comprise a phosphate buffer. As an implementation form, the phosphate buffer has a pH value of 7.2-7.4; as another implementation form, the phosphate buffer has a pH value of 7.3. As an implementation form, the phosphate buffer has a concentration of 9-11 mM; as another implementation form, the phosphate buffer has a concentration of 10 mM. As an implementation form, the color developing solution comprises a citric acid buffer containing 1% A solution and 10% B solution; the A solution comprises 1 wt.% TMB in DMSO, and the B solution comprises 0.1 wt.% H2O2 aqueous solution.

[0053] The application further provides an application of the hybridoma cell strain MDV-1Mab-pp38-E2 or the monoclonal antibody or the kit in detecting or identifying the pp38 protein of the serotype I chicken Marek's disease virus.

[0054] The application further provides an application of the hybridoma cell strain MDV-1Mab-pp38-E2 or the monoclonal antibody or the kit in one or more of the following: detecting the purity, safety and illegal addition of the avian virus live vaccine.

[0055] As an implementation form, the application of the kit in detecting the safety of the avian virus live vaccine comprises detecting and / or monitoring the concentration and / or plaque number of the serotype I chicken Marek's disease virus in the avian virus live vaccine.

[0056] In one embodiment, the poultry live virus vaccine of the present invention includes one or more of the following: fowlpox live vaccine, turkey herpesvirus live vaccine, Newcastle disease live vaccine, avian encephalomyelitis and fowlpox bivalent live vaccine, infectious bronchitis live vaccine, infectious laryngotracheitis recombinant fowlpox virus genetically engineered vaccine, and infectious bursal disease live vaccine; in another embodiment, the poultry live virus vaccine of the present invention is fowlpox live vaccine, turkey herpesvirus live vaccine, Newcastle disease live vaccine, avian encephalomyelitis and fowlpox bivalent live vaccine, infectious bronchitis live vaccine, infectious laryngotracheitis recombinant fowlpox virus genetically engineered vaccine, and infectious bursal disease live vaccine.

[0057] In one embodiment, the fowlpox live vaccine of the present invention is a quail-attenuated live fowlpox vaccine strain. In one embodiment, the turkey herpesvirus live vaccine of the present invention is an HVTFc-126 clone strain. In one embodiment, the Newcastle disease live vaccine of the present invention is a Newcastle disease live vaccine strain Clone30. In one embodiment, the avian encephalomyelitis and fowlpox bivalent live vaccine of the present invention is a combination of avian encephalomyelitis and fowlpox bivalent live vaccine strain YBF02 and a quail-attenuated live strain. In one embodiment, the infectious bronchitis live vaccine of the present invention is an infectious bronchitis live vaccine strain H120. In one embodiment, the Newcastle disease live vaccine of the present invention is a Newcastle disease live vaccine strain CS2. In one embodiment, the infectious bursal disease live vaccine of the present invention is an infectious bursal disease live vaccine strain B87.

[0058] When the safety of a live avian virus vaccine is tested using the hybridoma cell line MDV-1Mab-pp38-E2, the monoclonal antibody, or the kit described in the above technical solution, if no specific green fluorescence appears, it indicates that the live avian virus vaccine is not infected with MDV-1 and is safe.

[0059] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a hybridoma cell line and monoclonal antibody for detecting or identifying MDV-1 and their applications, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0060] Example 1

[0061] MDV-1pp38 protein sequence analysis

[0062] (1) Reference sequences of different MDV-1 strains were downloaded from NCBI. Analysis revealed that the VP2 protein showed high homology among different strains. pp38 of the MDV-1CVI988 strain was used for comprehensive secondary analysis and antigenicity analysis. The results showed that the 60-221aa region of the MDV-1pp38 protein was highly conserved and exhibited very low antigenicity, making it a potential candidate fragment for protein expression.

[0063] (2) Based on the secondary structure analysis and antigenicity of the protein sequence, a nucleotide fragment (486 bp) from the 60–221 aa region of MDV-1CVI988 strain (Genbank accession number: AQN77164.1) was selected and sequenced after codon optimization. EcoRI (5'-GAATTC-3') and XhoI (5'-CTCGAG-3') restriction enzyme sites were added to the 5' and 3' ends to obtain the MDV-1pp38 protein recombinant epitope, which was used for vector cloning. The sequence of the MDV-1pp38 protein recombinant epitope was synthesized at Beijing Liuhe Huada Protein R&D Center Co., Ltd., and the specific sequence is: 5'- GAATTC GATCGGGTCCAG AGGGACCGGTGGAGATTCAGTTCTCCGCCCTCACTCTGGAGTCACGGGGAAGGGGGCTATTCCAATAAAGGGTGATGGGAAGGCGATAGAATGCCAGGAGCTAACCGGAGAGGGAGAGTGGCTGTCACAGTGGGGGGAGCTACCGCCTGAGCCCCGGAGGTCAGGGAATGAACATCTTGACGAAAGTCGGTATGCGAAACAAACCGAAAGGGGTAGCTCTACGGGGAAAGAAGAG GGAGATGGTATGAAGCAGATGGGGGAGCTTGCCCAGCAGTGCGAAGGAGGAACATATGCGGACTTGCTTGTCGAAGCAGAGCAAGCTGTTGTACATTCCGTTCGCGCATTAATGCTGGCCGAAAGACAAAACCCAAATATATTGGGGGAGCATTTGAATAAAAAACGGGTTCTTGTACAACGACCCCGTACTATTCTATCCGTGGAGTCAGAGAATGCAACAAATGCGTTCTTATATG CTCGAG -3'(SEQ ID NO:1); where the underlined part represents the added EcoRI and XhoI restriction sites.

[0064] Example 2

[0065] Construction, expression, and purification of recombinant expression plasmids

[0066] 1. Construction of recombinant expression plasmids

[0067] The SEQ ID NO:1 sequence and plasmid pET30a in Example 1 were double-digested with restriction endonucleases EcoRI and XhoI, respectively. The purified and recovered fragments and the digestion products of the expression vector were ligated with a DNA Ligation Kit to obtain a recombinant expression plasmid, which was then transformed into competent cells (BL21).

[0068] 2. Low-level expression of MDV-1-pp38 recombinant protein

[0069] (1) Select the transformed BL21 clones that were positive by PCR in step 1 and put them into 1.5 mL of LB liquid medium containing 50 μg / mL kanamycin resistance. Incubate at 37 °C and 200 r / min until the OD of the culture medium reaches the target value. 600 The value was 0.6–0.8. IPTG was added to the culture medium to induce induction. The final concentration of IPTG in the culture medium was 0.5 mM. The induction temperature was 37 °C, the rotation speed was 200 r / min, and the induction time was 2 h.

[0070] (2) Take 1 mL of the induced bacterial culture, centrifuge at 12000 r / min for 1 min, discard the supernatant, and disperse the precipitate with 50 μL of 10 mM Tris-HCl (pH 8.0) solution (the amount of buffer added depends on the amount of bacterial cells). Add an equal volume of 2× loading buffer, incubate at 100℃ for 5 min, and then perform agarose gel electrophoresis. The results showed a specific target band of recombinant MDV-1pp38 protein at a size of approximately 30 kDa. Figure 1 This indicates that MDV-1pp38 protein expression was successful.

[0071] 3. High expression of MDV-1pp38 recombinant protein

[0072] (1) The transformed BL21 obtained in step 1 was identified by PCR, and the positive BL21 was cultured. The cultured bacterial solution was transferred to 250 mL of LB liquid medium containing 50 μg / mL kanamycin resistance at a volume ratio of 1:50, and cultured with shaking at 37℃ and 200 r / min until the OD of the culture medium was reached. 600 The value was 0.6–0.8. IPTG was added to the culture medium to induce induction. The final concentration of IPTG in the culture medium was 0.5 mM, the induction temperature was 37 °C, and the induction time was 3 h.

[0073] (2) Centrifuge the induced bacterial solution for 6 min at a speed of 8000 r / min, discard the supernatant to obtain bacterial cells; perform ultrasonic disruption on the obtained bacterial cells. The specific process is as follows: blow the obtained bacterial cells with 30 mL of 10 mM Tris-HCl (pH value of 8.0) solution and then perform ultrasonic disruption. The ultrasonic disruption power is 500 W, and the ultrasonic disruption is performed 180 times, each time for 5 seconds, with a 5-second interval before the next ultrasonic disruption.

[0074] (3) Electrophoretic detection was performed on the products obtained from ultrasonic disruption. The specific procedure was as follows: 100 μL of the ultrasonically disrupted bacterial suspension was centrifuged at 12000 r / min for 10 min. After centrifugation, 50 μL of supernatant and the resulting precipitate were retained. The precipitate was dispersed with 50 μL of 10 mM Tris-HCl solution (pH 8.0). The supernatant and the solution obtained after dispersing the precipitate were respectively subjected to SDS-PAGE detection. The results showed that a large amount of the target protein ( Figure 2 This indicates that the MDV-1pp38 protein of the recombinant bacteria is expressed in the form of inclusion bodies.

[0075] 4. Purification of MDV-1pp38 recombinant protein

[0076] Resuspend the precipitate obtained after ultrasonic disruption and centrifugation in step 3 using 20–30 mL of 10 mM Tris-HCl (pH 8.0) solution, and let it stand for 10 min. Centrifuge at 12000 rpm for 10 min, transfer the supernatant to another tube for storage, and resuspend the precipitate in 20–30 mL of 10 mM Tris-HCl (pH 8.0) solution, and let it stand for 10 min to obtain a bacterial suspension. Centrifuge the obtained bacterial suspension at 12000 rpm for 10 min, discard the supernatant, and obtain the first precipitate. Repeat the above resuspension and centrifugation steps once for the first precipitate to obtain the second precipitate. The precipitate was first resuspended in a small amount of 10mM Tris-HCl (pH 8.0) solution, then the protein was dissolved in 5-10 mL of 10mM Tris-HCl (pH 8.0) solution containing 8M urea. The mixture was centrifuged at 12000 rpm for 10 min, and the supernatant was collected. 50 μL of the sample was then subjected to SDS-PAGE electrophoresis. The results showed a large amount of purified MDV-1-pp38 protein (…). Figure 3 Using BSA (bovine serum albumin) as a standard, the purified protein concentration was estimated to be >0.5 mg / mL and the purity >85% by SDS-PAGE gel scanning analysis.

[0077] Example 3

[0078] Preparation of monoclonal antibodies

[0079] 1. Immunity in mice

[0080] The purified MDV-1-pp38 protein from Example 2 was emulsified with Freund's complete adjuvant at a 1:1 volume ratio. Four SPF-grade BALB / c female mice were subcutaneously injected with 60 μg of MDV-1-pp38 protein per mouse (this was the primary immunization). Booster immunizations were administered subcutaneously at 2, 4, and 6 weeks after the primary immunization, with a dose of 30 μg of MDV-1-pp38 protein per mouse. The intervals between the primary and first booster immunizations were 14 days, as were between the first and second booster immunizations and the second and third booster immunizations. Ten days after the third booster immunization, blood was collected from the orbital sinus, and serum titers were measured using indirect ELISA. Mice with high serum titers (ELISA antibody titer of 1:12800) were selected and given a single intraperitoneal injection of 50 μg of immunogen (MDV-1-pp38 protein) as a pulse immunization.

[0081] 2. Cell fusion

[0082] Three days after intraperitoneal injection of immunization shock, mouse spleens were aseptically harvested and prepared into a spleen cell suspension. An equal volume of the immunized spleen cell suspension was mixed with SP2 / 0 cells, and cell fusion was performed using the standard 50% PEG method. The resulting fused cells were then placed in five 96-well plates and selectively cultured in HAT medium (purchased from Sigma).

[0083] 3. Cloning and screening of hybridoma cells

[0084] 3.1 The cultures from the 96-well plate described in step 2 were screened using an ELISA plate coated with MDV-1-pp38 protein. The specific steps are as follows:

[0085] (1) Coating ELISA plates: Dilute the purified MDV-1-pp38 protein from Example 2 with sodium carbonate-sodium bicarbonate buffer at pH 9.6 to a final concentration of 2 μg / mL. Add 100 μL of diluted MDV-1-pp38 protein to each well of the ELISA plate and incubate overnight at 4°C; then wash three times with PBST (PBS containing 0.05% Tween-20).

[0086] (2) Blocking: Add 200 μL of PBS containing 2% milk to each well of the coated ELISA plate, incubate at 37°C for 2 h, and then wash 3 times with PBST (PBS containing 0.05% Tween-20).

[0087] (3) Incubation of primary antibody: After blocking, add the hybridoma cell culture supernatant obtained after cell fusion in step 2, negative control (SP2 / 0 culture supernatant), blank control (PBS), and positive control (MDV-1 positive serum diluted 1000 times with PBS) as primary antibody, 100 μL / well, and incubate at 37℃ for 1 h.

[0088] (4) Washing: After incubating with the primary antibody, wash the ELISA plate (step (3)) with PBST (PBS containing 0.05% Tween-20) for a total of 3 times.

[0089] (5) Incubation of secondary antibody: After washing, add 100 μL of goat anti-mouse IgG / HRP diluted 20,000 times with PBS to each ELISA plate as secondary antibody, and incubate at 37°C for 1 h.

[0090] (6) Washing: Wash the ELISA plate after incubation with secondary antibody in step (5) with PBST (PBS containing 0.05% Tween-20) for a total of 3 times.

[0091] (7) Color development: Add 100 μL / well of color development solution (citric acid buffer containing 1% solution A and 10% solution B; solution A: TMB is prepared to a mass concentration of 1% with DMSO; solution B: H2O2 aqueous solution with a mass concentration of 0.1%) and the color development time is about 5 min.

[0092] (8) Add 50 μL of stop solution (containing 2M sulfuric acid) to each well to terminate the process.

[0093] (9) Reading: The absorbance was measured at two wavelengths (450nm, 630nm), and the data was recorded and saved. The results are shown in Table 1.

[0094] 3.2 The cultures in the 96-well plate described in step 2 were screened by ELISA plates coated with His tag protein. The specific steps were similar to those in 3.1, except that in step (1) when coating the ELISA plate, the purified MDV-1-pp38 protein was replaced with His tag protein; in step (3) when incubating the primary antibody, the positive control was serum collected from mice immunized with pp38 recombinant protein or MDV-1 positive serum. The results are shown in Table 1.

[0095] Table 1. Results of ELISA screening for hybridoma cell lines

[0096]

[0097] Note: A high absorbance value for the target protein and a low absorbance value for the tag protein indicate a high titer of the hybridoma cell line.

[0098] As shown in Table 1, this embodiment screened three ELISA-positive hybridoma cell lines, E2, H3, and G4, for further screening. Among them, the E2 hybridoma cell line had the highest titer.

[0099] 4. Indirect immunofluorescence detection

[0100] 4.1 Preparation of positive virus plates: The viral solutions of different serotype 1 chicken Marek's disease virus (MDV-1) strains in Table 2 were diluted with M199 culture medium containing 2% newborn calf serum to 100 PFU / 0.1 mL and inoculated into 96-well plates containing chicken embryo fibroblasts (CEF). After about 3 days, the plates were fixed with cold methanol for 15 min. CEF cells were set up as a control for later use.

[0101] Table 2 Information on different MDV-1 strains and control strains

[0102]

[0103]

[0104] Note: The above virus strains are from the National Veterinary Microbiology Culture Collection Center. For details, please refer to the China Veterinary Drug Information Network, Microbial Culture Collection, and Microbial Culture Search.

[0105] 4.2 Fluorescent staining

[0106] (1) Fixation: After the positive virus plate is prepared, discard the cell culture medium in the 96-well plate, add about 250 μL PBS to each well, wash the cell surface once, discard as much PBS as possible, then add 100 μL cold methanol to each well, fix at room temperature for 10-15 min, discard the methanol, and air dry naturally for 2-5 min.

[0107] (2) Add primary antibody (monoclonal antibody): After fixing the 96-well plate, wash the cell surface once with PBS (pH 7.2). Use the supernatant of the three positive hybridoma cell lines (D10, H3 and G4) obtained by ELISA screening in step 3 as primary antibody. Dilute the supernatant 10 times with PBS and add 50 μL to each well of the positive virus plate (washed with PBS once before use). Incubate at 37°C in the dark for 1 h.

[0108] (3) Washing: After adding primary antibody to the 96-well plate, discard the monoclonal antibody in the wells, wash 5 times with PBS, adding 0.3 mL of washing buffer to each well each time, and gently shake to wash.

[0109] (4) Fluorescent secondary antibody staining: Discard as much washing buffer as possible, add 50 μL of fluorescently labeled goat anti-mouse IgG diluted with PBS to each well, and incubate at 37°C in the dark for 1 h. The volume ratio of fluorescently labeled goat anti-mouse IgG diluted with PBS is 1:100 to 1:200.

[0110] (5) Washing: The method is the same as step (3).

[0111] (6) Observation and result determination: Under a fluorescence inverted microscope with blue excitation light (wavelength 490nm), the cells were observed to have complete cell morphology. When specific green fluorescence appeared in the field of view of the inoculation well, and when magnified to 200-400 times, the nucleus and cytoplasm of the infected cells were stained, the well was determined to be positive for MDV-1 detection. When no specific green fluorescence appeared in the inoculation well, the field of view was dark, indicating that the cells were not infected, and the well was determined to be negative for MDV-1 detection. As a result, a cell line with good reactivity to the whole virus of a different strain from MDV-1 was screened. This cell line expressed a monoclonal antibody against the MDV-1 pp38 protein and was named MDV-1Mab-pp38-E2.

[0112] 5. Identification of hybridoma cells

[0113] 5.1 Cultivation Characteristics

[0114] Hybridoma cell line MDV-1Mab-pp38-D16 was cultured in M199 medium containing 10%–15% fetal bovine serum at 37°C in a 5% CO2 incubator. The cell morphology of the hybridoma cell line was examined under a microscope. The cells should be uniform in morphology, which indicates that the cells are in good condition.

[0115] 5.2 Purity Test

[0116] According to the methods in the appendix of the current Chinese Veterinary Pharmacopoeia (edited by the Chinese Veterinary Pharmacopoeia Committee, Veterinary Pharmacopoeia of the People's Republic of China, 2020 edition, China Agriculture Press, 2020, hereinafter referred to as the Chinese Veterinary Pharmacopoeia), the hybridoma cell line MDV-1Mab-pp38-D16 was tested for sterility, mycoplasma, and exogenous virus, and the results all met the requirements.

[0117] 5.3 Nucleic acid examination

[0118] The chromosome number of the hybridoma cell line MDV-1Mab-pp38-D16, which had been cultured for 24 hours, was examined using the colchicine method, and the chromosome characteristics were observed to be consistent with the staining characteristics of hybridoma cells.

[0119] 5.4 Ascites titer determination

[0120] (1) Preparation of ascites fluid: 8-10 week old BALB / c mice were intraperitoneally injected with 0.5 mL of phenazine per mouse. 7-10 days later, the mice were intraperitoneally injected with 10 mL of phenazine. 6 ~10 70.5 mL of MDV-1Mab-pp38-D16 hybridoma cells per mouse was used. After 7–10 days, the mice were observed. When the abdomen of the mice became significantly distended and they had difficulty moving, ascites fluid was collected. The fluid was centrifuged at 3000 rpm for 10 min, and the supernatant was collected and stored at -40°C. If ascites fluid recurred after 2–3 days, it could be collected again. This ascites fluid was purified using Protein-A affinity to obtain mouse anti-MDV-1 monoclonal antibody.

[0121] (2) The ascites fluid that produces mouse anti-MDV-1 monoclonal antibody was serially diluted from a volume ratio of 1:100 to 1:16000, and the fluorescent antibody titer of the ascites fluid was determined to be 1:2000 according to the indirect immunofluorescence detection method in step 4.

[0122] Example 4

[0123] The indirect immunofluorescence kit for detecting MDV-1 included a monoclonal antibody against MDV-1, a commercially available FITC-labeled goat anti-mouse antibody (purchased from Sigma, catalog number F2057), sample diluent, and washing buffer. Both the diluent and washing buffer were 10 mM pH 7.2 phosphate-buffered saline (PBS). The monoclonal antibody against MDV-1 was produced from the hybridoma cell line MDV-1Mab-pp38-D16 obtained in Example 3.

[0124] The steps and judgment criteria for detecting MDV-1 using this indirect immunofluorescence kit are as follows:

[0125] 1. Sample inoculation

[0126] 100 μL of the sample to be tested was seeded into a 96-well plate containing confluent chicken embryo fibroblasts (CEF) and cultured at 37°C for about 3 days.

[0127] 2. Fluorescent staining and result interpretation

[0128] (1) Fixation: After 1 hour, discard the cell culture medium in the 96-well cell plate, add about 0.3 mL of PBS (pH 7.2) to each well and gently wash the cell surface once. Discard as much PBS as possible, then add 0.2 mL of cold methanol to each well, fix at room temperature for 15 min, discard the methanol, and air dry for 5 min.

[0129] (2) Add primary antibody: After air drying, wash the cell surface once with PBS (pH 7.2), then add 50 μL of MDV-1 monoclonal antibody to each well and incubate at 37°C for 1 h. The added MDV-1 monoclonal antibody is diluted with PBS (pH 7.2-7.4) at a volume ratio of 1:100.

[0130] (3) Washing: Discard the MDV-1 monoclonal antibody, wash 5 times with PBS (pH 7.2), add 0.3 mL of washing buffer to each well each time, and gently shake to wash.

[0131] (4) Fluorescent secondary antibody staining: Discard as much washing buffer as possible, add 50 μL of FITC-labeled goat anti-mouse IgG to each well, and incubate at 37°C for 1 h. Dilute the added FITC-labeled goat anti-mouse IgG with PBS (pH 7.2–7.4) at a volume ratio of 1:100.

[0132] (5) Washing: The method is the same as step (3).

[0133] (6) Observation and Judgment: Under a fluorescence inverted microscope with blue excitation light (wavelength 490nm), the cells were observed to have complete cell morphology. When specific green fluorescence appeared in the field of view of the inoculation well, and the cell nucleus and cytoplasm of the infected cells were visible when magnified to 200-400 times, the MDV-1 test of that well was determined to be positive. When no specific green fluorescence appeared in the inoculation well, the field of view was dark, indicating that the cells were not infected, and the MDV-1 test of that well was determined to be negative.

[0134] Example 5

[0135] Specific detection

[0136] Using the indirect immunofluorescence kit from Example 4, and following the established steps and judgment criteria, different MDV-1, MDV-2, MDV-3, Newcastle disease virus (NDV), fowlpox virus (POX), infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV), egg drop syndrome virus (EDSV), avian leukosis virus (ALV), infectious laryngotracheitis virus (ILTV), and avian ororeovirus (ARV) were detected. The staining of virus-infected cells was observed to determine the specificity of this indirect immunofluorescence method.

[0137] Specific detection results showed that the indirect immunofluorescence kit of Example 4 could specifically identify and detect different MDV-1 strains. Figures 4 to 7 The reaction results were all positive, and compared with serum type 3 MDV strain ( Figure 8 ) and serum type 2 strain ( Figure 9 There was no reaction to any of them, and they were also found to be unresponsive to other common avian viruses such as NDV. Figure 10 ), POX Figure 11 ), IBV ( Figure 12 ), IBDV ( Figure 13 ), EDSV Figure 14 ), ALV( Figures 15 to 16 ), AIV Figure 17 ),FAdV(Figure 18 CIAV Figure 19 ), ILTV Figure 20 ) and ARV ( Figure 21 All reactions were negative, demonstrating that the established method has good specificity, and this indirect immunofluorescence kit can be used for the specific detection of MDV-1.

[0138] Example 6

[0139] Sensitivity detection

[0140] (1) MDV-1 (CVI988 strain) was diluted to 80 PFU / 100 μL, and then serially diluted to 40 PFU / 100 μL, 20 PFU / 100 μL, 10 PFU / 100 μL, 5 PFU / 100 μL, 2.5 PFU / 100 μL, 1.25 PFU / 100 μL, and 0.625 PFU / 100 μL. Samples at these eight dilutions were inoculated into a confluent CEF layer at 100 μL / well, with four replicates per sample. CEF was also used as a negative control. Using the indirect immunofluorescence kit from Example 4, detection was performed according to the established procedures and criteria. The results showed that for each dose gradient, the MDV-1 detection result was positive when the MDV-1 infection dose was greater than or equal to 2.5 PFU.

[0141] (2) MDV-1 (814 strains) was diluted to 80 PFU / 100 μL, and then serially diluted to 40 PFU / 100 μL, 20 PFU / 100 μL, 10 PFU / 100 μL, 5 PFU / 100 μL, 2.5 PFU / 100 μL, 1.25 PFU / 100 μL, and 0.625 PFU / 100 μL. Samples at these eight dilutions were inoculated into a confluent CEF layer at 100 μL / well, with four replicates per sample. CEF was also used as a negative control. Using the indirect immunofluorescence kit from Example 4, detection was performed according to the established procedures and criteria. The results showed that for each dose gradient, the MDV-1 detection result was positive when the MDV-1 infection dose was greater than or equal to 2.5 PFU.

[0142] Combining steps (1) and (2), it can be seen that the limit of detection for MDV-1 contamination using the indirect immunofluorescence kit of Example 4 is 2.5 PFU.

[0143] Example 7

[0144] (1) Exogenous virus testing for avian viral live vaccines

[0145] Eight key poultry live vaccines produced by domestic manufacturers were selected (Table 3). MDV-1 was detected by indirect immunofluorescence (IFA) using the indirect immunofluorescence kit in Example 4. Serological testing for MDV-1 contamination was performed on the selected poultry live vaccines according to the 2020 edition of the Chinese Veterinary Pharmacopoeia, Part III. A PBS group was set as a negative control, and an MDV-1 infected group (CVI988 strain) was set as a positive control. Specific test results are shown in Table 3.

[0146] Table 3 Results of Exogenous Virus Detection in Enterprise Vaccines

[0147]

[0148] As can be seen from Table 3, the results of serological testing and the detection using the indirect immunofluorescence kit in Example 4 are consistent. All selected poultry live vaccines are free of MDV-1 contamination. The negative control is MDV-1 negative and the positive control is MDV-1 positive.

[0149] (2) Detection of illegal additives in MDV live vaccine

[0150] Ten batches of MDV HVT live vaccines from five domestic manufacturers were selected, and MDV-1 was detected using the indirect immunofluorescence kit in Example 4. The specific detection results are shown in Table 4.

[0151] Table 4. Detection Results of Illegal Additives in Enterprise Vaccines

[0152]

[0153]

[0154] As shown in Table 4, none of the selected MDV live vaccines were contaminated with MDV-1. The cell control was negative for MDV-1, and the positive control was positive for MDV-1.

[0155] (3) Plaque count of MDV live vaccine

[0156] Eight domestic manufacturers of live MDV vaccines were selected, and MDV-1 plaque counting was performed using the indirect immunofluorescence kit in Example 4. The specific detection results are shown in Table 5.

[0157] Table 5. Results of Plaque Count Detection for Enterprise Vaccines

[0158]

[0159] As shown in Table 5, the plaque count results of the selected MDV live vaccine all met the requirements and were higher than those obtained by visual observation, indicating that the IFA method is more accurate.

[0160] (4) Identification of MDV live vaccines

[0161] Eight domestic manufacturers of MDV-1 live vaccines were selected, with the MDV-1 group serving as a positive control. The vaccines were tested using the indirect immunofluorescence kit in Example 4, and the specific test results are shown in Table 6.

[0162] Table 6. Identification Results of MDV Live Vaccine

[0163]

[0164] As shown in Table 6, the identification test results of the selected MDV live vaccines all meet the requirements, indicating that the quality of the live vaccines meets the requirements of MDV live vaccines.

[0165] As can be seen from the above, the anti-MDV-1 monoclonal antibody produced using the hybridoma cell line MDV-1Mab-pp38-D16 of this invention can simultaneously recognize different strains of MDV-1 without cross-reacting with viruses such as egg drop syndrome virus (EDSV). It has good sensitivity and specificity and can be used not only for the detection of exogenous MDV-1 in avian viral live vaccines (cell examination method), but also for the clinical detection and epidemiological investigation of MDV-1.

[0166] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A hybridoma cell line MDV-1Mab-pp38-E2 for detecting or identifying serum type I chicken Marek's disease virus, with accession number CCTCC NO:C202501.

2. A monoclonal antibody for detecting or identifying serum type I chicken Marek's disease virus, characterized in that, The monoclonal antibody is secreted by the hybridoma cell line of claim 1 or its passaged cell line.

3. The use of the hybridoma cell line MDV-1Mab-pp38-E2 of claim 1 or the monoclonal antibody of claim 2 in the preparation of products for detecting or identifying serum type I chicken Marek's disease virus.

4. The application according to claim 3, characterized in that, The serotype I Marek's disease virus includes one or more of the following: serotype I Marek's disease virus strain CVI988, serotype I Marek's disease virus strain 814, serotype I Marek's disease virus strain Jing-1, and serotype I Marek's disease virus strain Md-5.

5. A kit for detecting or identifying serum type I chicken Marek's disease virus, characterized in that, The kit includes the monoclonal antibody of claim 2.

6. The reagent kit according to claim 5, characterized in that, The kit also includes fluorescently labeled anti-mouse antibodies, diluent, and washing solution.

7. The kit according to claim 5 or 6, characterized in that, The kit also includes a positive control; The positive control is serum collected from mice immunized with pp38 recombinant protein or MDV-1 positive serum. The amino acid sequence of the recombinant pp38 protein is shown in region 60-221aa of the pp38 sequence in Genbank accession number AQN77164.

1.

8. The reagent kit according to claim 6, characterized in that, The diluent and washing solution each comprise a phosphate buffer; the phosphate buffer has a pH of 7.2-7.4 and a concentration of 9-11 mM.

9. The use of the hybridoma cell line MDV-1Mab-pp38-E2 of claim 1, or the monoclonal antibody of claim 2, or the kit of any one of claims 5 to 8 in the preparation of a product for detecting or identifying serum type I chicken Marek's disease virus pp38 protein.

10. The use of the hybridoma cell line MDV-1Mab-pp38-E2 of claim 1, or the monoclonal antibody of claim 2, or the kit of any one of claims 5 to 8, in detecting the safety of avian live virus vaccines; The safety testing of avian viral live vaccines includes detecting and / or monitoring the concentration and / or number of serum type I Marek's disease virus in the avian viral live vaccine.

Images