Primer and kit for detecting citrus shingle viroid based on RPA-CRISPR-Cas12b and application of primer and kit for detecting citrus shingle viroid based on RPA-CRISPR-Cas12b

Abstract

The invention discloses a primer and a kit for detecting a citrus exocortis viroid based on RPA-CRISPR-Cas12b and application of the primer and the kit, and relates to the technical field of citrus pathogen detection. The invention develops an isothermal amplification detection method based on RPA and CRISPR for common CEVd pathogen targets in citrus, gets rid of the dependence of a traditional molecular biological method on a complex instrument and equipment platform, and greatly simplifies a detection platform; through system establishment and verification, the total detection time of the CEVd target is shortened to be within half an hour; meanwhile, a verification test result shows that the detection method developed by the invention has relatively good sensitivity and specificity, and an actual sample verification result is consistent with a result of an RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method.

Description

Technical Field

[0001] The present invention relates to the technical field of citrus pathogen detection, and specifically relates to primers, kits and applications for detecting Citrus exocortis viroid based on RPA-CRISPR-Cas12b. Background Art

[0002] Citrus exocortis is a disease that occurs in citrus caused by Citrus exocortis viroid (CEVd). This disease mainly damages citrus varieties grafted with Poncirus trifoliata, sweet orange and lemon as rootstocks. Summer oranges show a trend of rapid spread, and about 30% of the summer orange orchards with a disease plant rate of 100% are affected. Since Poncirus trifoliata is widely used as a rootstock in many regions of China, this disease is a potentially devastating disease for citrus varieties grafted with Poncirus trifoliata, especially posing a greater threat to the development of navel oranges.

[0003] One of the traditional detection methods for important graft-transmissible pathogens in citrus is the indicator plant identification method, which is quite time-consuming. Currently, rapid detection methods for single pathogens have been established for the above-mentioned pathogens, including serological methods, RT-PCR / qPCR and detection methods based on loop-mediated isothermal nucleic acid amplification technology, etc. Among them, serological detection is a commonly used method for detecting common citrus viruses.

[0004] In CRISPR detection, the trans-cleavage activity of a specific CRISPR / Cas system is used to detect target nucleic acids. Specifically, in a specific CRISPR / Cas system, after the spacer of the artificially synthesized single guide RNA (sgRNA) specifically binds to the target sequence, the trans-cleavage activity of the Cas protein can be activated, thereby cleaving the fluorescently labeled probe (ssDNA or ssRNA) in the system to generate a fluorescent signal, realizing the detection of target nucleic acids. The CRISPR detection technology has high sensitivity and high specificity, and can quickly and accurately detect target nucleic acids under isothermal conditions, which is an ideal nucleic acid detection platform. Currently, CRISPR / Cas systems with trans-cleavage activity such as Cas13, Cas12a and Cas12b have been discovered. Compared with Cas12a, AaCas12b has a wider temperature tolerance range, and it has good detection activity in the temperature range of 37-65°C, and is more suitable for synchronous isothermal amplification reactions such as RPA and LAMP.

[0005] Therefore, the present invention has developed an isothermal amplification detection method based on RPA and CRISPR for the CEVd target to get rid of the dependence on complex instrument equipment platforms by traditional molecular biology methods and greatly simplify the detection platform. Summary of the Invention

[0006] The object of the present invention is to provide primers, kits and their applications for detecting citrus exocortis viroid based on RPA-CRISPR-Cas12b to solve the above technical problems.

[0007] To achieve the above object, the technical solution of the present invention is as follows:

[0008] The present invention provides sgRNAs for detecting citrus exocortis viroid, and the sgRNAs are one of CEVd-127rev, CEVd-134rev, CEVd-150forw, CEVd-94forw and CEVd-241rev; the nucleotide sequence of CEVd-127rev is shown in SEQ ID NO:1, the nucleotide sequence of CEVd-134rev is shown in SEQ ID NO:2, the nucleotide sequence of CEVd-150forw is shown in SEQ ID NO:3, the nucleotide sequence of CEVd-94forw is shown in SEQ ID NO:4, and the nucleotide sequence of CEVd-241rev is shown in SEQ ID NO:5.

[0009] The present invention also provides a detection system for detecting citrus exocortis viroid based on RPA-CRISPR-Cas12b, including an RPA amplification reaction system and a Cas12b detection reaction system; the Cas12b detection reaction system includes any one of the sgRNAs shown in SEQ ID NOs: 1-5.

[0010] Preferably, the Cas12b detection reaction system further includes SynSor AaCas12b, 10×AaCas12b Buffer and SynSor CRISPR ssDNA Reporter (12b-FAM).

[0011] Preferably, the RPA amplification reaction system includes RPA primers, and the RPA primers include: CEVd-RPA-F3 with a nucleotide sequence shown in SEQ ID NO:6, CEVd-RPA-R1 with a nucleotide sequence shown in SEQ ID NO:7, CEVd-RPA-F4 with a nucleotide sequence shown in SEQ ID NO:8, CEVd-RPA-R2 with a nucleotide sequence shown in SEQ ID NO:9, and CEVd-RPA-F5 with a nucleotide sequence shown in SEQ ID NO:10.

[0012] Preferably, the RPA primer pairs are used in the following combinations: the upstream primer CEVd-RPA-F3 and the downstream primer CEVd-RPA-R1; the upstream primer CEVd-RPA-F3 and the downstream primer CEVd-RPA-R2; the upstream primer CEVd-RPA-F4 and the downstream primer CEVd-RPA-R1; the upstream primer CEVd-RPA-F4 and the downstream primer CEVd-RPA-R2; the upstream primer CEVd-RPA-F5 and the downstream primer CEVd-RPA-R1; the upstream primer CEVd-RPA-F5 and the downstream primer CEVd-RPA-R2; or the upstream primers CEVd-RPA-F3, CEVd-RPA-F4, CEVd-RPA-F5 and the downstream primers CEVd-RPA-R1, CEVd-RPA-R2 are used together.

[0013] The present invention also provides a kit for detecting citrus exocortis viroid based on RPA-CRISPR-Cas12b, which includes the detection system for detecting citrus exocortis viroid based on RPA-CRISPR-Cas12b as described above.

[0014] The present invention also provides the application of the kit for detecting citrus exocortis viroid based on RPA-CRISPR-Cas12b in the detection of citrus exocortis viroid.

[0015] The present invention also provides a method for detecting citrus exocortis viroid based on RPA-CRISPR-Cas12b, which comprises the following steps:

[0016] S1. Extract total RNA from the sample to be tested and reverse transcribe it into cDNA;

[0017] S2. Using the cDNA obtained in step S1 as a template, perform RPA isothermal amplification with the RPA primer pairs as described above to obtain RPA amplification products;

[0018] S3. Using the RPA amplification products obtained in step S2 as a template, add them to the Cas12b detection reaction system to perform CRISPR reaction;

[0019] The Cas12b detection reaction system includes any one of the sgRNAs as described in SEQ ID NO: 1-5, SynSorAaCas12b, 10×AaCas12b Buffer, and SynSor CRISPR ssDNA Reporter (12b-FAM);

[0020] S4. After the CRISPR reaction is completed, read the detection signal and determine the detection result according to the detection signal.

[0021] In the present invention, the judgment criterion is that the water template is used as a negative control, and whether there is a significant difference between the detection data and the negative control data is detected. If there is no significant difference, it is judged as negative, and if there is a significant difference, it is judged as positive.

[0022] Preferably, the Cas12b detection reaction system in step S3 is specifically 2 μL of 2.5 μM SynSor AaCas12b, 1 μL of 100 ng / μL SynSor sgRNA, 5 μL of 10×AaCas12b Buffer, 0.5 μL of SynSor CRISPR ssDNAReporter(12b-FAM), and water is added to make up to 50 μL.

[0023] The present invention also provides the application of the method for detecting citrus exocortis viroid based on RPA-CRISPR-Cas12b in biological quarantine, and the biological quarantine uses citrus leaves as biological quarantine materials.

[0024] In summary, compared with the prior art, the solution of the present invention has the following beneficial effects:

[0025] Aiming at the common CEVd pathogen target in citrus, the present invention has developed an isothermal amplification detection method based on RPA and CRISPR, getting rid of the dependence on complex instrument equipment platforms of traditional molecular biology methods and greatly simplifying the detection platform; through system establishment and verification, the overall detection time of the CEVd target is shortened to within half an hour; at the same time, the verification test results show that the detection method developed by the present invention has good sensitivity and specificity, and the verification results of actual samples are consistent with the results of the RT-PCR method. Description of the Drawings

[0026] Figure 1 It is a diagram of the screening results of the CEVd target sgRNA in the present invention (NTC is the negative control, and CEVd-127rev, CEVd-134rev, CEVd-150forw, CEVd-94forw, and CEVd-241rev are all sgRNAs);

[0027] Figure 2 It is a diagram of the screening results of the CEVd target RPA primers in the present invention (NTC is the negative control, and CEVd-RPA-F3R1, CEVd-RPA-F3R2, CEVd-RPA-F4R1, CEVd-RPA-F4R2, CEVd-RPA-F5R2, and CEVd-RPA-F5R2 are all primer combinations);

[0028] Figure 3It is the result graph of CEVd target sensitivity verification in the present invention (NTC is the negative control, CEVd is Citrus exocortis viroid, CTV is Citrus tristeza virus, and CTLV is Citrus tatter leaf virus);

[0029] Figure 4 It is the result graph of CEVd target specificity verification in the present invention (NTC is the negative control, 9.42E+00 represents 9.42×10 0 、9.42E-01 represents 9.42×10 -1 、9.42E-02 represents 9.42×10 -2 、9.42E-03 represents 9.42×10 -3 、9.42E-04 represents 9.42×10 -4 and 9.42E-05 represents 9.42×10 -5 ; * indicates p<0.05, ns indicates no statistical significance);

[0030] Figure 5 It is the result graph of CEVd target citrus leaf sample detection in the present invention (NTC is the negative control, CEVd is Citrus exocortis viroid, CTV is Citrus tristeza virus, and CTLV is Citrus tatter leaf virus). Detailed implementation manners

[0031] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in combination with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0032] Example 1 Design of sgRNA

[0033] According to the commonly used target regions of Citrus exocortis viroid (CEVd) in citrus pathogens in the literature, combined with the host background genome to be avoided, bioinformatics algorithms are used to score the design of sgRNA from angles such as the PAM position, GC%, internal dimer structure, fragment structure openness, base position preference, and specificity. The scoring is understood in terms of the success probability, and 3 candidate fragments with a score of more than 40 are retained. If the scores are generally lower than 40, the number of candidate fragments needs to be increased to improve the success probability; if the sequence in the spacer has the risk of destroying the secondary structure of the backbone, it will be directly excluded from the candidate list to avoid the risks of specificity and sensitivity.

[0034] Based on the above design principles, sgRNAs were designed for each selected region. The spacer sequences of the designed sgRNAs were analyzed for coverage and specificity using NCBI primer-BLAST. The alignment results showed that the designed sgRNA spacer sequences had a 100% coverage within the detected species, indicating good inclusiveness; the number of bases matching across species was <15 nt, indicating good specificity. In this example, the sgRNAs in Table 1 were selected for synthesis.

[0035] Among them, the nucleotide sequence of CEVd diploid (in the plasmid template, CEVd diploid was inserted between NcoI and SpeI of the pGEM-T vector) is shown as follows:

[0036] CGGGATCTTTCTTGAGGTTCCTGTGGTGCTCACCTGACCCTGCAGGCAGGAAAAGAAAAAAGAGGCGGCGGGGAAGAAGTCCTTCAGGGATCCCCGGGGAAACCTGGAGGAAGTCGAGGTCGGGGGGGTACAGCTGCTTCGGTCGCCGCGGATCACTGGCGTCCAGCGGAGAAACAGGAGCTCGTCTCCTTCCTTTCGCTGCTGGCTCCACATCCGATCGTCGCTGAAGCGCCACGCCCCCTCGCCCGGAGCTTCTCTCTGGCTACTACCCGGTGGATACAACTGAAGCTTCAACCCCAAACCGCTTTTCTTATATCTTCACTGCTCTCCGGGCGAGGGTGAAAGCCCTCGGAACCCTAGATTGGGTCCCTCGGGATCTTTCTTGAGGTTCCTGTGGTGCTCACCTGACCCTGCAGGCAGGAAAAGAAAAAAGAGGCGGCGGGGAAGAAGTCCTTCAGGGATCCCCGGGGAAACCTGGAGGAAGTCGAGGTCGGGGGGGTACAGCTGCTTCGGTCGCCGCGGATCACTGGCGTCCAGCGGAGAAACAGGAGCTCGTCTCCTTCCTTTCGCTGCTGGCTCCACATCCGATCGTCGCTGAAGCGCCACGCCCCCTCGCCCGGAGCTTCTCTCTGGCTACTACCCGGTGGATACAACTGAAGCTTCAACCCCAAACCGCTTTTCTTATATCTTCACTGCTCTCCGGGCGAGGGTGAAAGCCCTCGGAACCCTAGATTGGGTCCCT。

[0037] sgRNA information used in Table 1

[0038]

[0039]

[0040] Note: The underlined part is the spacer region of the sgRNA.

[0041] Verification of sgRNA performance in Example 2

[0042] In this example, the fluorescence intensity of the amplification products of each sgRNA and template designed in Example 1 was measured in the CRISPR reaction.

[0043] 1 PCR primer design

[0044] According to the position where the sgRNA is designed, regions within 100 bp upstream and downstream of the sgRNA are selected to design PCR primers (see Table 2). Commonly used software for designing PCR primers is used for primer design, and the primer length is controlled within 20 - 25 bp. If there are multiple sgRNA design sites within the same target fragment, the PCR amplification product (fragment length controlled within 500 bp) will contain all sgRNA binding sites, enabling the performance verification of all sgRNAs under the same template.

[0045] Table 2 Specific primers for template amplification

[0046]

[0047] 2 Template amplification verification

[0048] PCR amplification was performed using the template DNA and the corresponding primers to obtain a high - concentration PCR product.

[0049] PCR reaction system: 44 μL of 1.1× Gold Mix (Green), 2 μL each of the upstream primer / downstream primer (10 μM), 2 μL of plasmid template or genomic / cDNA template, and water was added to make up to 50 μL.

[0050] PCR reaction program: Pre - denaturation at 98°C for 2 min, denaturation at 98°C for 10 sec, annealing at 50°C for 15 sec, extension at 72°C for 10 sec, 30 cycles, final extension at 72°C for 5 min, and incubation at 10°C for storage.

[0051] 3 sgRNA verification

[0052] Configure the CRISPR system: 2 μL of SynSor AaCas12b (2.5 μM), 1 μL of SynSor sgRNA (100 ng / μL), 5 μL of 10× AaCas12b Buffer, 0.5 μL of SynSor CRISPR ssDNA Reporter (12b - FAM), and water was added to make up to 50 μL.

[0053] Take 1 μL of the PCR amplification product and mix it with the CRISPR system. Set the reaction at 43°C for 15 min in a qPCR instrument, and collect FAM fluorescence signals every minute. According to the curve change of the fluorescence signal, a preliminary verification of the sgRNA performance or specificity is carried out. There should be a significant difference between the end points where the fluorescence value curves of the target amplification product and the negative control stop rising.

[0054] The calculation formula for the growth rate of fluorescence intensity is as follows:

[0055]

[0056] Among them, Fluorescence Slope represents the fluorescence growth rate in the present invention, Rn represents the fluorescence signal at the nth minute, R1 represents the fluorescence signal at the first minute, and n represents the reaction minute number.

[0057] The results show that the sgRNA effects of the CEVd targets from high to low are: CEVd-134rev, CEVd-150forw, CEVd-127rev, CEVd-241rev, CEVd-94forw (see Figure 1 ).

[0058] Example 3 Design and verification of PRA primers

[0059] 1 Design of RPA primers

[0060] Within the detection target range, fragments with a length of 30-35 bases are selected as RPA primer candidates; to ensure stability and specificity, the GC content of the RPA primers should be between 40% and 60%, and the RPA amplification fragment is usually 100-200bp. Based on this primer design principle, upstream primers or downstream primers are designed in the present invention (see Table 3), and NCBI primer-BLAST is used for verification of amplification coverage and specificity.

[0061] Table 3 RPA primer table

[0062]

[0063] 2 Screening of RPA primers

[0064] CEVd-134rev with better sgRNA verification performance in Example 2 is used for RPA primer screening.

[0065] Cross-primer performance verification is carried out on the upstream primers CEVd-RPA-F3, CEVd-RPA-F4, CEVd-RPA-F5 and the downstream primers CEVd-RPA-R1, CEVd-RPA-R2 synthesized in the present invention. The results show that the effects of CEVd target primer screening CEVd-RPA-F3 / CEVd-RPA-R1 and CEVd-RPA-F5 / CEVd-RPA-R2 are close (see Figure 2 ).

[0066] Example 4 Verification of the sensitivity of the citrus pathogen detection system

[0067] The plasmid with gradient dilution was used to verify the sensitivity of the relatively well-screened PAR primer CEVd-RPA-F3 / CEVd-RPA-R1 in Example 3. The detection limits of each primer and its corresponding target were judged based on the significant analysis of the sensitivity verification experiment results.

[0068] Plasmid samples with a concentration gradient from 9.42E-05 to 9.42E+00 ng were used for the sensitivity verification of citrus exocortis viroid. According to the sensitivity verification results (see Figure 3 ), and combined with the significant difference analysis, the lowest detectable sample of the CEVd target per reaction was 9.42 pg.

[0069] Specificity verification of the citrus pathogen detection system in Example 5

[0070] The relatively well-screened PAR primer CEVd-RPA-F3 / CEVd-RPA-R1 in Example 3 was used to verify the target specificity of three pathogens, CEVd, CTLV, and CTV.

[0071] The CEVd target system only produced positive results in the detection of the CEVd target. The detection of CTV and CTLV plasmid DNA showed negative results, indicating good specificity of this target (see Figure 4 ).

[0072] Verification of samples in Example 6

[0073] The RPA primers determined by screening in Example 3 for the detection of citrus exocortis viroid, the detection system established based on the above primers, and the existing RT-PCR method were used to detect and verify 22 citrus leaf samples. The target plasmid sample was used as the positive control, and ddH2O was used as the negative control. Each sample was repeated 2 times.

[0074] The specific RT-PCR method was as follows: Using the extracted total RNA of the sample as the template, cDNA was reverse transcribed. The system was: dNTPMix (10 mM) 1 μL, 5×M-MLV buffer 4 μL, M-MLV reverse transcriptase (200 U·μl -1 , PROMEGA) 0.5 μL, RNase inhibitor (40 U·μl -1 , PROMEGA) 0.5 μL, random hexamer primer (10 μM) 0.5 μL, Oligo(dT)18 primer (10 μM) 0.5 μL, and made up to 20 μL with sterilized ddH2O. After mixing, it was incubated at 37 °C for 1 h to synthesize cDNA.

[0075] PCR reaction system: 1 μL of cDNA, 7.5 μL of 2× Taq mix (A005-100, Kangrun Bio), 0.6 μL of CEVd-F (5'-CCGGGGATCCCTGAAGGACTT-3', concentration 10 μM), 0.6 μL of CEVd-R (5'-GGAAACCTGGAGGAAGTCGAG-3', concentration 10 μM), made up to 15 μL with sterilized ddH2O, expected fragment size 375 bp; reaction conditions: pre-denaturation at 94 °C for 3 min, denaturation at 94 °C for 30 sec, annealing at 56 °C for 30 sec, extension at 72 °C for 30 sec, 35 cycles; further extension at 72 °C for 10 min, analyzed by 1% agarose gel electrophoresis.

[0076] The results showed that positive results could be detected in the CEVd target system in all except Lgo, Yho, Lg-Y3, and Lg-Y5 (see Figure 5 ), and it was consistent with the results of the RT-PCR method.

[0077] In summary, in the present invention, the CEVd target sgRNA uses CEVd-134, combined with the primers CEVd-RPA-F3 / R1, the lowest detection limit is 9.42 pg, and it is specific for the pathogens CTLV and CTV; the results in the actual sample detection are consistent with the results of the RT-PCR method.

[0078] The above-described embodiments only represent the preferred embodiments of the present invention, and the description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the appended claims.

Claims

1. An sgRNA for detecting citrus bark crack virus, characterized in that: The sgRNA is one of CEVd-127rev, CEVd-134rev, CEVd-150forw, CEVd-94forw and CEVd-241rev; the nucleotide sequence of the CEVd-127rev is shown in SEQ ID NO: 1, the nucleotide sequence of the CEVd-134rev is shown in SEQ ID NO: 2, the nucleotide sequence of the CEVd-150forw is shown in SEQ ID NO: 3, the nucleotide sequence of the CEVd-94forw is shown in SEQ ID NO: 4, and the nucleotide sequence of the CEVd-241rev is shown in SEQ ID NO:

5.

2. A detection system for citrus bark crack virus based on RPA-CRISPR-Cas12b, characterized in that: It comprises an RPA amplification reaction system and a Cas12b detection reaction system; the Cas12b detection reaction system comprises the sgRNA according to claim 1.

3. The detection system according to claim 2, wherein the Cas12b detection reaction system also includes SynSorAaCas12b, 10×AaCas12b Buffer and SynSor CRISPR ssDNA Reporter.

4. The detection system according to claim 2, characterized in that The RPA amplification reaction system also includes RPA primers, which include: CEVd-RPA-F3 with a nucleotide sequence as shown in SEQ ID NO:6, CEVd-RPA-R1 with a nucleotide sequence as shown in SEQ ID NO:7, CEVd-RPA-F4 with a nucleotide sequence as shown in SEQ ID NO:8, CEVd-RPA-R2 with a nucleotide sequence as shown in SEQ ID NO:9, and CEVd-RPA-F5 with a nucleotide sequence as shown in SEQ ID NO:

10.

5. The detection system according to claim 4, characterized in that: The pairing mode of the RPA primers is that the upstream primer CEVd-RPA-F3 and the downstream primer CEVd-RPA-R1 are paired for use, or the upstream primer CEVd-RPA-F3 and the downstream primer CEVd-RPA-R2 are paired for use, or the upstream primer CEVd-RPA-F4 and the downstream primer CEVd-RPA-R1 are paired for use, or the upstream primer CEVd-RPA-F4 and the downstream primer CEVd-RPA-R2 are paired for use, or the upstream primer CEVd-RPA-F5 and the downstream primer CEVd-RPA-R1 are paired for use, or the upstream primer CEVd-RPA-F5 and the downstream primer CEVd-RPA-R2 are paired for use, or the upstream primers CEVd-RPA-F3, CEVd-RPA-F4, CEVd-RPA-F5 and the downstream primers CEVd-RPA-R1 and CEVd-RPA-R2 are used together.

6. A kit for detecting citrus bark crack virus based on RPA-CRISPR-Cas12b, characterized in that: It comprises a detection system for detecting citrus bark viruses based on RPA-CRISPR-Cas12b as described in any one of claims 2-5.

7. Use of the kit for detecting citrus bark crack viroids based on RPA-CRISPR-Cas12b as claimed in claim 6 in the detection of citrus bark crack viroids.

8. A method for detecting citrus bark crack virus based on RPA-CRISPR-Cas12b, characterized in that: The steps include: S1, extract total RNA from the sample to be tested and reverse transcribe it into cDNA; S2, using the cDNA of step S1 as a template, performing RPA isothermal amplification using the RPA primer pair described in claim 4 or 5 to obtain an RPA amplification product; S3, using the RPA amplification product obtained in step S2 as a template, adding the Cas12b detection reaction system to perform CRISPR reaction; The Cas12b detection reaction system comprises the sgRNA, SynSor AaCas12b, 10×AaCas12b Buffer and SynSor CRISPR ssDNA Reporter according to claim 3; S4. After the CRISPR reaction is completed, the detection signal is read and the detection result is determined based on the detection signal.

9. The method according to claim 8, characterized in that The Cas12b detection reaction system in step S3 is specifically 2.5μM SynSor AaCas12b 2μL, 100ng / μL SynSor sgRNA 1μL, 10×AaCas12b Buffer 5μL, SynSorCRISPR ssDNA Reporter 0.5μL and water to 50μL.

10. Use of the method according to claim 8 or 9 in biological quarantine, characterized in that: The biological quarantine uses citrus leaves as biological quarantine materials.

Images