Application of aldehyde oxidase gene and dsRNA thereof in prevention and treatment of tomato leaf miner
By designing dsRNA targeting aldehyde oxidase genes and using RNAi technology to silencing the expression of aldehyde oxidase genes, the problem of difficulty in effectively preventing and treating tomato leaf moths in the existing technology is solved, and the effect of significantly reducing the survival rate and pupal weight of larvae is achieved, while ensuring safety for non-target organisms.
Patent Information
- Application Number
- CN202510424359.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to effectively control the tomato leaf moth, especially in reducing the survival rate of larvae and controlling the weight of the pupal.
By designing dsRNA targeting aldehyde oxidase (AOX) gene, the expression of aldehyde oxidase gene is silenced by RNAi technology, thereby reducing the survival rate and pupal weight of tomato leaf moth.
It significantly inhibited the survival rate and pupal weight of tomato slutaceous moth on tomatoes, and had no effect on non-target biological slutaceous slutaceous bugs, ensuring environmental and biosecurity.
Smart Images

Figure CN120210208A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and specifically relates to the use of aldehyde oxidase gene and its dsRNA in the control of Background Art
[0002] The tomato leafminer ( Tuta absoluta ), belonging to the order Lepidoptera Lepidoptera Gelechiidae Gelechiinae , also known as tomato gelechiid, tomato leafminer, South American tomato leafminer, is a major newly emerging invasive pest originating from South America. It has now spread to more than 100 countries and regions around the world and is listed as a world quarantine pest.
[0003] Aldehyde oxidase (AOX) is a subfamily of the molybdo-flavoenzyme family (MFE), which can oxidize toxic aldehyde substances formed in the body into non-toxic acids to relieve the toxicity of aldehyde substances to the body, and can also hydroxylate nitrogen-containing heterocyclic compounds.
[0004] RNAi (RNA interference) is a molecular biology technique that specifically degrades target gene mRNA through double-stranded RNA (dsRNA) molecules, resulting in target gene silencing. The RNAi technique relies on interfering with specific functional genes to reduce adaptability or cause insect death to achieve the purpose of prevention and control. It shows great potential in the field of agricultural pest control and has high specificity and safety. It is considered a new generation of green and safe pest control strategy. Summary of the Invention
[0005] Aiming at the above deficiencies in the prior art, the present invention provides the use of an aldehyde oxidase gene and its dsRNA in the control of tomato leafminer. Through dsRNA, the expression of the aldehyde oxidase gene can be effectively silenced, and the survival rate of tomato leafminer larvae can be reduced, thereby achieving the purpose of controlling tomato leafminer.
[0006] To achieve the above object, the technical solution adopted by the present invention to solve its technical problems is: The object of the present invention is to provide a dsRNA for controlling tomato leafminer, the nucleic acid sequence of which is shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and it can target and inhibit the expression of the aldehyde oxidase gene.
[0007] Furthermore, the aldehyde oxidase gene is KAJ2951445.1, KAJ2951736.1 or KAJ2948179.1.
[0008] Another object of the present invention is to provide a recombinant vector comprising the above dsRNA.
[0009] Another object of the present invention is to provide a cell line comprising the above dsRNA or recombinant vector.
[0010] Another object of the present invention is to provide an engineered bacterium comprising the above dsRNA or recombinant vector.
[0011] Another object of the present invention is to provide the use of the above dsRNA in the preparation of a preparation for controlling Tuta absoluta.
[0012] Another object of the present invention is to provide the use of the above aldehyde oxidase gene as a target in the screening of a preparation for controlling Tuta absoluta.
[0013] Furthermore, the preparation uses a substance that inhibits the expression of the aldehyde oxidase gene as an active ingredient, including shRNA, siRNA, ASO, small molecule compounds or small molecule polypeptides.
[0014] Another object of the present invention is to provide the use of the above aldehyde oxidase gene expression inhibitor in the preparation of a preparation for controlling Tuta absoluta.
[0015] Another object of the present invention is to provide a preparation for controlling Tuta absoluta, which uses the above dsRNA or aldehyde oxidase gene expression inhibitor as an active ingredient.
[0016] Another object of the present invention is to provide a primer set for amplifying the above dsRNA, and its sequences are shown in SEQ ID NO.4 - 9; Among them, the primer set sequence for amplifying the dsRNA shown in SEQ ID NO.1 is SEQ ID NO.4 and 5; The primer set sequence for amplifying the dsRNA shown in SEQ ID NO.2 is SEQ ID NO.6 and 7; The primer set sequence for amplifying the dsRNA shown in SEQ ID NO.3 is SEQ ID NO.8 and 9.
[0017] Advantages of the present invention: The present invention has identified 3 AOX genes related to the feeding of Tuta absoluta on host plants. After delivering the dsRNA of the target gene into the body of Tuta absoluta by the soaking method, the expression of the target gene is significantly inhibited, and the survival rate and pupal weight of Tuta absoluta on tomatoes are significantly reduced. At the same time, the dsRNA has no effect on the non - target organism, Nesidiocoris tenuis.
[0018] The present invention clarifies that the AOX gene plays a key role in the process of the tomato leafminer feeding on host plants, and is safe for non-target organisms and the environment. It provides a target gene for controlling the tomato leafminer based on RNAi, and provides further research methods and basis for reducing the damage of the tomato leafminer. Brief Description of the Drawings
[0019] Figure 1 It is the expression pattern of AOX at different developmental stages of the tomato leafminer; Figure 2 It is the expression pattern of AOX in different tissues of the tomato leafminer; Figure 3 It is the effect of dsRNA of AOX on the survival of tomato leafminer larvae; Figure 4 It is the effect of dsRNA of AOX on the predatory bug Detailed Embodiments
[0020] The following describes the detailed embodiments of the present invention to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the detailed embodiments. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions and creations using the concept of the present invention are within the scope of protection.
[0021] Example 1 Design of Quantitative Primers for AOX in the Tomato Leafminer 1. Based on the genome of the tomato leafminer, using the aldehyde oxidase in the oral secretion proteome of Trichoplusia ni and Spodoptera frugiperda as query sequences, 3 aldehyde oxidase genes of the tomato leafminer (KAJ2951445.1, KAJ2951736.1, KAJ2948179.1) were identified by TBLASTN, and real-time fluorescence quantitative PCR (qPCR) primers were designed using primer-blast (Table 1).
[0022] Table 1 Quantitative Primer Sequences for AOX in the Tomato Leafminer Gene accession number Primer name Sequence (5'-3') KAJ2951445.1 qKAJ2951445-F ATTTCCCCAACATTCATCCA qKAJ2951445-R GCACCTCCTCGTCAAGACTC KAJ2948179.1 qKAJ2958179-F TTCCTCCTTAGCCACAACAG qKAJ2958179-R TCGAGACTCGTATTCTGCAT KAJ2951736.1 qKAJ2951736-F GGCAAAAGATTGCCTTGCCA qKAJ2951736-R CGGAAATCCTCCAGCTGTGT 2. Analysis of the Expression Pattern of AOX in Different Tissues of the Tomato Leafminer Samples of different tissues (head, cuticle, intestine, ovary, fat body and Malpighian tubules) of the tomato leafminer were collected, total RNA was extracted using TRIzol, and reverse transcribed into cDNA using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix of TransGen Biotech, and the expression pattern of aldehyde oxidase was detected using qPCR.
[0023] The qPCR reaction was carried out using the Bio-Rad CFX96 connect system. A 20.0 μL final volume of the PCR detection was prepared with 1.0 μL of cDNA template, 10.0 μL of 2×TransStart Green qPCR SuperMix (Transgen), 200 μM of each gene-specific primer (Table 1), and 0.4 μL of Passive Reference Dye (Transgen).
[0024] The qPCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 40 cycles; finally, melting curve analysis was performed at 60 - 95°C. Each treatment or control was repeated four times, and two technical replicates were carried out for each repeat. EF1α (GenBank accession number: MZ054826) was selected as the internal reference gene. Standard curves were constructed using five serial dilutions of cDNA to verify the amplification efficiency, and the relative mRNA expression levels were calculated using the 2-ΔΔCT method (△△CT = (Ct target - Ct reference)treatment - (Ct target - Ct reference)control).
[0025] As Figure 1 shown, KAJ2951445.1, KAJ2951736.1, and KAJ2948179.1 were expressed in different tissues of Tuta absoluta. Among them, KAJ2951445.1 was highly expressed in the 1st, 2nd, and 3rd instar larvae, KAJ2951736.1 was highly expressed in the 1st, 3rd, and 4th instar larvae, and KAJ2948179.1 was highly expressed in the 1st instar larvae.
[0026] 3. Expression patterns of AOX in different developmental stages of Tuta absoluta Samples at different developmental stages (eggs, larvae, pupae, adults) were collected, and total RNA was extracted using TRIzol. The total RNA was reverse transcribed into cDNA using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit from TransGen Biotech. The expression patterns of aldehyde oxidase were detected by qPCR, and the results are shown in ® . Figure 2
[0027] As Figure 2 shown, KAJ2951445.1 was highly expressed in the head, midgut, and hindgut, KAJ2951736.1 was highly expressed in the midgut and hindgut, and KAJ2948179.1 was highly expressed in the head and foregut.
[0028] Example 2 dsRNA and Its Effect on Tuta absoluta 1. dsRNA fragments and primers targeting these 3 aldehyde oxidase genes were designed respectively. The primer sequences are shown in Table 2, and the dsRNA fragments are as follows: dsRNA sequence of KAJ2951445.1: CCAAAGACATACCAGGAGATAATACTTTCACACCGCTCAATATTCCTATTGTAGTAGTTATGAATGAGGAAATTTTATGTTCTGGAAAAGTCTTGTTTTACGGACAACCTGCAGGAATCATTGTAGCTGACAGAGAAAAGACGGCTATTAAAGCTGCAAGACTCGTTAAAATAAAGTACACTTCAGAAAGCAAGACGAAGCCTATGCTAACAGCTGAAGACGTCCTTGCGTCTCCTGAAAGAGACCAAAGAACCCACCAAGATGCAGTAATAGAAGCAAAAGAAACTGGGCATAATGTGAAAACTGTGATATTTGGAGATATTTCATTTCCCTCGCAATATCACTACACAATGGAACCTC (SEQ ID NO.1).
[0029] dsRNA sequence of KAJ2951736.1: CGAAGAGGATTGCGAAGATTCAAAATGGTGTATTATTTCAAAAGAACATGTCAAAGTACCGCATGTTATTGAAATCGATCTAAAAGATGAAAGAATGTGGTTTAAAGTCAACGAAGTGCAAGATATATTTAAGATTTTGAAAGAAAAAGGAGATGAATCGTATATGCTTGTTGCTGGTAACACAGGAAAAGGTGCCTACCCAATAGAAACATATCCTCGAATCTTGATTGACGTCGCCGATGTATCAGCTTTGAAAGGATACACAGTAGATCAGAACCTAGTCGTGGGTGCTGGAACGACTTTGACTGAAGTTATGGATATTTTTGAACGGATGAGCCTACAGCAATATTTCGAGTATTTGCAAAAGCTGGTTGACCATTTGAAGTTAGTCGCGCA (SEQ ID NO.2).
[0030] dsRNA sequence of KAJ2948179.1: CAGCGTCCTATATGATGACTGATAAAGAAAAGGATTTGTCTAATTACAATGCTTATTCAGTTACAATTTTGGAAACTGAGCTTGATGCTCTGACTGGAAGATACGAAATACTAAGAACTGATATACTTGAAGATGTTGGATTAAGTACTAATCCCACCGTAGATGTTGGTCAGGTCGAAGGAGCATTTGTCCAGGGTTTAGGATACTTTACAACAGAAAAGCTAGTTTATGATGAAAAAACCGGCAAATTGTTAACTAATAGATCCCTCAACTACCACGTGCCATTAGGTCTAGATATTCCTGCAGATTTCAGAGTCAAATTTAGACGCAATGAGAAAAATAAGAAAGGAGTGCTTGGTTCGAAAGCTGTAGG (SEQ ID NO.3).
[0031] Table 2 dsRNA primer sequences of Tuta absoluta AOX Gene accession number Primer name Sequence (5'-3') KAJ2951445.1 dsKAJ2951445-F taatacgactcactatagggCCAAAGACATACCAGGAGATAA (SEQ ID NO.4) dsKAJ2951445-R taatacgactcactatagggGAGGTTCCATTGTGTAGTGATA (SEQ ID NO.5) KAJ2951736.1 dsKAJ2951736-F taatacgactcactatagggCAGCGTCCTATATGATGAC (SEQ ID NO.6) dsKAJ2951736-R taatacgactcactatagggCCTACAGCTTTCGAACCAA (SEQ ID NO.7) KAJ2948179.1 dsKAJ2958179-F taatacgactcactatagggCGAAGAGGATTGCGAAGATT (SEQ ID NO.8) dsKAJ2958179-R taatacgactcactatagggTGCGCGACTAACTTCAAATG (SEQ ID NO.9) T7 promoter: taatacgactcactataggg.
[0032] 2. Effect of AOX gene on the survival of Tuta absoluta larvae Specific primers were designed according to the sequences of KAJ2951445.1, KAJ2951736.1 and KAJ2948179.1, and the T7 promoter was added (Table 2). Using the cDNA of Tuta absoluta as a template, the PCR product was amplified by PCR, purified with an agarose gel DNA recovery kit (Tiangen), and dsRNA was synthesized and purified using the Transcript Aid T7 High Yield Transcription Kit according to the instructions.
[0033] dsRNA delivery was completed using the soaking method. Third-instar larvae of Tuta absoluta with plump morphology, consistent size, and uniform development were selected and starved for 4 h. They were placed in 1.5 mL centrifuge tubes, and dsRNA completed by incubating with the nanomaterial CQDs was added to completely immerse the test insects. dsGFP was used as a control. 20 test insects were treated in each group, and 4 biological replicates were set. After standing for 20 min, the dsRNA in the centrifuge tubes was aspirated with a pipette, and the test insects were gently transferred to fresh tomato leaves for feeding and placed in an artificial climate chamber. The status of the larvae was observed every 24 h, the death status of the larvae was recorded, and the mortality rate was statistically analyzed. After the larvae developed into pupae, the pupal weight was weighed, and the expression levels of each gene were detected at the same time. The results are shown in Figure 3 。
[0034] As Figure 3 shown, soaking dsRNA can silence the expression of genes KAJ2951445.1, KAJ2951736.1, and KAJ2948179.1, and the survival rate and pupal weight of Tuta absoluta decreased, indicating that genes KAJ2951445.1, KAJ2951736.1, and KAJ2948179.1 play a key role in the feeding process of Tuta absoluta.
[0035] 3. Safety assessment of Nesidiocoris tenuis dsRNA of genes KAJ2951445.1, KAJ2951736.1, and KAJ2948179.1 was mixed with 15% sucrose solution in equal volume. 10 μL of the mixed solution was dropped into a cotton ball, and the cotton ball was placed at the bottom of a 1.5 mL centrifuge tube. Single adult Nesidiocoris tenuis were picked and placed in the centrifuge tube for feeding. dsRNA was added every 12 h. After 48 h, it was replaced with 10% sucrose solution. The survival of Nesidiocoris tenuis was statistically analyzed every 24 h. The results are shown in Figure 4 。
[0036] As Figure 4 shown, dsRNA of genes KAJ2951445.1, KAJ2951736.1, and KAJ2948179.1 has no effect on the predatory natural enemy Nesidiocoris tenuis of Tuta absoluta, indicating that dsRNA of the target gene AOX has no effect on non-target organisms.
[0037] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the examples, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.
Claims
1. A dsRNA for controlling tomato leafminer, characterized in that: The nucleic acid sequence of the dsRNA is shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, and it targets and inhibits the expression of the aldehyde oxidase gene.
2. The dsRNA according to claim 1, characterized in that The aldehyde oxidase gene is KAJ2951445.1, KAJ2951736.1 or KAJ2948179.
1.
3. A recombinant vector, characterized in that: Comprising the dsRNA of claim 1.
4. A cell line, characterized in that Comprising the dsRNA according to claim 1 or the recombinant vector according to claim 3.
5. An engineered bacterium, characterized in that: Comprising the dsRNA according to claim 1 or the recombinant vector according to claim 3.
6. Use of the dsRNA according to claim 1 in preparing a preparation for controlling tomato leafminer.
7. Use of the aldehyde oxidase gene of claim 1 as a target in screening preparations for controlling tomato leafminer.
8. Use of an aldehyde oxidase gene expression inhibitor in the preparation of a preparation for controlling tomato leafminer.
9. A preparation for controlling tomato leafminer, characterized in that: The preparation contains the dsRNA according to claim 1 or the aldehyde oxidase gene expression inhibitor according to claim 8 as an active ingredient.
10. A primer set for amplifying the dsRNA according to claim 1, characterized in that: The sequences of the primer sets are shown in SEQ ID NOs. 4 to 9; Wherein, the primer set sequence for amplifying the dsRNA shown in SEQ ID NO.1 is SEQ ID NO.4 and 5; The primer set sequences for amplifying the dsRNA shown in SEQ ID NO. 2 are SEQ ID NOs. 6 and 7; The primer set sequences for amplifying the dsRNA shown in SEQ ID NO.3 are SEQ ID NOs.8 and 9.