Cascade amplification double miRNA detection method based on Cas12a closed crRNA and deoxyribozyme and application
Through the cascade amplification detection method based on Cas12a blocked crRNA and deoxyribozyme, the problem that the prior art is difficult to detect two miRNAs efficiently at the same time is solved, and the detection effect is achieved with fast, simple, strong specificity and high sensitivity is improved, and the accuracy of cancer diagnosis is improved.
Patent Information
- Application Number
- CN202510216163.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-26
- Publication Date
- 2025-06-27
AI Technical Summary
It is difficult for the prior art to efficiently detect two or more miRNAs simultaneously, especially when detecting low-abundance miRNAs, there are limitations in sensitivity and specificity, and conventional detection methods have limitations on rapid and on-site detection.
The cascade amplification detection method based on Cas12a blocked crRNA and deoxyribozyme was adopted to design specific crRNA, activator Act and deoxyribozyme sequences to achieve the detection of two miRNAs in one tube at a time. The method includes extracting the miRNA to be tested, preparing the crRNA/activator Act hybrid nucleic acid double-strand, and a Cas12a-based cascade amplification detection process, using fluorescent signals to report the presence of miRNA.
It realizes fast, simple, strong specificity and high sensitivity dual miRNA detection, improves the accuracy of cancer diagnosis, and can conduct on-site testing in areas with limited resources.
Smart Images

Figure CN120210329A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a cascade amplification dual miRNA detection method and application based on Cas12a-capped crRNA and deoxyribozyme. Background Art
[0002] MicroRNA (miRNA) is a class of endogenous non-coding small RNAs, about 22 nucleotides in length, and widely exists in eukaryotes. Since it was first discovered in Caenorhabditis elegans in 1993, the regulatory role of miRNA in organisms has been gradually revealed. They regulate gene expression by specifically binding to the 3' untranslated region (3'UTR) of target mRNA, thus playing a key role in various physiological and pathological processes such as cell proliferation, differentiation, apoptosis, and the development, immunity, and metabolism of organisms. For example, in the occurrence and development of tumors, certain miRNAs act as tumor suppressors or oncogenic factors, affecting the growth and metastasis of tumor cells by regulating cell cycle, apoptosis, angiogenesis, etc. In addition, miRNA is also involved in the regulatory mechanisms of various diseases such as cardiovascular diseases, neurodegenerative diseases, and metabolic diseases. Therefore, detecting the expression level of miRNA, for example, in tumor diagnosis, the expression level of specific miRNA can be used as a potential biomarker for early detection, typing, and prognosis evaluation of tumors, which is of great significance for studying the pathogenesis of diseases, diagnosing diseases, evaluating curative effects, and guiding individualized treatment.
[0003] At present, the detection methods of miRNAs mainly include Northern blot, quantitative real-time PCR (qRT-PCR), microarray chips, and high-throughput sequencing, etc. Northern blot is a classic miRNA detection method. By hybridizing a probe labeled with a radioactive isotope to the miRNA, the size and relative abundance of the miRNA can be detected. However, its sensitivity is low, the operation is complex, it takes a long time, and it is difficult to achieve high-throughput detection. qRT-PCR is the most widely used miRNA detection method at present, with the advantages of high sensitivity, strong specificity, and simple operation, and it can accurately quantify the expression level of miRNAs. However, qRT-PCR requires the design of specific primers. For members of the highly homologous miRNA family, primer design is relatively difficult, and when detecting low-abundance miRNAs, it is easily interfered by background signals. Microarray chip technology can achieve high-throughput detection of a large number of miRNAs, but its cost is high, and there are also certain limitations in sensitivity and specificity when detecting low-abundance miRNAs. High-throughput sequencing technology can comprehensively and unbiasedly detect the miRNA expression profile, but its cost is even higher, the data analysis is complex, and there are still certain challenges when detecting low-abundance miRNAs. In addition, most of these conventional detection methods require complex sample processing and instrument equipment, which have certain limitations for the application scenarios of rapid and on-site detection of miRNAs.
[0004] The CRISPR / Cas system is a natural immune mechanism derived from bacteria and archaea and has been developed as a powerful gene editing tool in recent years. In addition to gene editing, the CRISPR / Cas system also shows great potential in the field of nucleic acid detection. For example, the CRISPR / Cas13 system is an RNA-guided RNA enzyme that can specifically recognize and cleave target RNA. Based on the CRISPR / Cas13-based SHERLOCK (Specific High-sensitivity Enzymatic Reporter UnLOCKing) detection technology, by combining Cas13 with a fluorescent reporter gene, sensitive detection of RNA is achieved. The recently developed SAHARA system (Split Activator for Highly Accessible RNA Analysis) can also achieve the detection of RNA by Cas12a through a split activator. CRISPR / Cas-based detection technologies have the advantages of high sensitivity, strong specificity, simple operation, isothermal rapidity, low cost, etc., and are expected to be widely used in clinical diagnosis, on-site detection, and areas with limited resources. Its application in miRNA detection not only provides a new tool for studying the functions and regulatory mechanisms of miRNAs but also brings new hope for the early diagnosis and precise treatment of diseases. However, at present, most of the signal reports based on Cas12 and Cas13 rely on their trans-cleavage of fluorescent reporter groups, and this trans-cleavage activity is non-specific. Therefore, it is difficult to achieve multiplex detection of two miRNAs in a single tube through a single Cas system.
[0005] Therefore, developing a method that can simultaneously detect two or more miRNAs is of great significance for miRNA function research, the diagnosis and treatment of various tumor diseases. Summary of the Invention
[0006] Based on this, the present invention provides a cascade amplification dual-miRNA detection method based on Cas12a-blocked crRNA and deoxyribozyme. The detection method provided by the present invention simultaneously detects two RNAs in a single tube. This single-tube multiplex mode has the advantages of rapidity, simplicity, strong specificity, high sensitivity, etc., and improves the accuracy of cancer diagnosis.
[0007] The technical solution adopted by the present invention is specifically as follows:
[0008] A cascade amplification dual-miRNA detection method based on Cas12a-blocked crRNA and deoxyribozyme, comprising the following steps:
[0009] S1. Extraction of nucleic acid miRNA from the sample to be tested;
[0010] S2. Prepare the crRNA / activator Act hybrid nucleic acid duplex for standby; wherein, the nucleotide sequence of the crRNA is as shown in SEQ ID NO.3; the nucleotide sequence of the activator Act is as shown in SEQ ID NO.4;
[0011] S3. Based on Cas12a, block the cascade amplification detection of double miRNAs by crRNA and deoxyribozyme: sequentially add the miRNA extracted in step S1 to premix A, premix B containing the crRNA / activator Act hybrid nucleic acid duplex obtained in step S2, and premix C, and further react to detect the fluorescence signal, thus obtaining the result.
[0012] Preferably, the miRNA of the nucleic acid of the sample to be measured in step S1 includes miRNA1 and miRNA2, wherein, miRNA1 is miRNA-21, and its nucleotide sequence is as shown in SEQ ID NO.1; miRNA2 is miRNA-210, and its nucleotide sequence is as shown in SEQ ID NO.2.
[0013] Preferably, the hybrid nucleic acid duplex in step S2 is obtained by mixing crRNA and activator Act in a ratio of 1:1, annealing in 1×reaction buffer 1, and then slowly cooling to room temperature.
[0014] Preferably, the specific process of the cascade amplification detection of double miRNAs in step S3 is as follows:
[0015] (1) Add the miRNA sample to premix A, and react on a PCR analysis system to obtain PCR reaction solution I;
[0016] (2) Add premix B containing the crRNA / activator Act hybrid nucleic acid duplex obtained in step S2 to the PCR reaction solution I obtained in step (1), react on a PCR analysis system, collect the fluorescence signal, and obtain PCR reaction solution II.
[0017] (3) Take the PCR reaction solution II obtained in step (2) and add it to premix C for reaction, then detect the fluorescence signal and analyze the result.
[0018] Preferably, the premix A in step (1) includes Klenow Fragment, dNTPs, P1, reaction buffer 1, λ endonuclease, reaction buffer 2 and sterile ultrapure water; the nucleotide sequence of the P1 is as shown in SEQ ID NO.5.
[0019] Preferably, the premix B in step (2) includes Act / crRNA hybrid duplex, Cas12a, Reportor1, P2, Klenow Fragment, nicking endonuclease (Nb.BbvCI), dNTPs, reaction buffer1, reaction buffer 3 and sterilized ultrapure water; the nucleotide sequence of Reportor1 is as shown in SEQ ID NO.6; the nucleotide sequence of P2 is as shown in SEQ ID NO.7.
[0020] Preferably, the premix C in step (3) includes Reportor2, reaction buffer 4 and sterilized ultrapure water; the nucleotide sequence of Reportor2 is as shown in SEQ ID NO.8.
[0021] The present invention also provides an application of the detection method in the simultaneous detection of two tumor miRNAs.
[0022] The present invention also provides a dual-miRNA detection kit, including the premix A, the premix B and the premix C.
[0023] Deoxyribozyme, also known as DNA enzyme, is a class of single-stranded DNA molecules with catalytic functions. Different from protein enzymes and RNA enzymes, deoxyribozymes are composed of DNA and can specifically recognize and cleave RNA molecules. The catalytic mechanism of deoxyribozymes mainly depends on their unique three-dimensional structure. By specifically binding to RNA substrates, a catalytic active center is formed, thereby realizing the cleavage of RNA. Deoxyribozymes have many unique properties, such as high stability, easy synthesis and modification, and reusability. In the field of biomedicine, deoxyribozymes show broad application prospects. For example, in gene regulation research, deoxyribozymes can specifically cleave target RNA and inhibit gene expression, thereby studying the functions of genes. In disease treatment, deoxyribozymes can be used as gene silencing tools to cleave the RNA of pathogenic genes and inhibit their expression, providing new ideas for the treatment of genetic diseases and cancers. In addition, deoxyribozymes can also be used for the construction of biosensors. By specifically binding to target molecules, the detection of biomolecules can be achieved. For example, biosensors based on deoxyribozymes have been used to detect miRNA, and sensitive detection of miRNA has been realized through the combination of the catalytic activity of deoxyribozymes and fluorescence signals. The research and application of deoxyribozymes provide new tools and methods for the detection and regulation of nucleic acid molecules, and promote the development of biomedical science. Therefore, the present invention uses deoxyribozymes to cleave RNA.
[0024] The technical principle of the present invention is as follows ( Figure 1):First, the DNA sequence of P1 was designed according to the miRNA1 sequence, and the 5'-end of P1 was phosphorylated. After miRNA1 and P1 bound, it extended under the action of polymerase, and then λ exonuclease was added to obtain the S1 fragment. The S1 fragment bound to the 3'-end of the activator Act, which could relieve the blocking effect of Act on the crRNA hairpin region and activate the cis-cleavage activity and trans-cleavage activity of Cas12a. The cis-cleavage activity cleaved the 5'-end of Act, releasing the S2 sequence (the S2 sequence was the sequence generated after Cas12a cleaved Act and was part of Act). In addition, the trans-cleavage of the reporter Reporter1 modified with ROX and BHQ2 could detect the fluorescence signal to characterize the presence of miRNA1. When miRNA1 was absent, Act could block crRNA and would not activate the cis- and trans-cleavage activities of Cas12a. The P2 probe carried the recognition site of the nicking endonuclease Nb.BbvCI. When miRNA2 was present, the free S2 and P2 probe in the system could be bound together, increasing the Tm value to trigger the 3'-end extension of S2. Thus, the S3 fragment was generated and released under the action of polymerase and nicking endonuclease. The S3 fragment was designed as a DNAzyme, which could cleave the RNA substrate Reporter2 modified with CY5 and BHQ2 in the presence of magnesium ions, generating a fluorescence signal. Generally speaking, when the ROX channel detected a signal, it characterized the presence of miRNA1, and when the CY5 channel detected a signal, it characterized the co-presence of miRNA1 and miRNA2.
[0025] The sequences involved in the present invention are as follows:
[0026] miRNA1: Its nucleotide sequence is
[0027] miRNA2: Its nucleotide sequence is
[0028] P1: Its nucleotide sequence is
[0029] S1: Its nucleotide sequence is
[0030] crRNA: Its nucleotide sequence is
[0031] Act: Its nucleotide sequence is
[0032] Reporter1: Its nucleotide sequence is 5'-ROX-CCCCCC-BHQ2-3' (SEQ ID NO.6);
[0033] S2: Its nucleotide sequence is
[0034] P2: Its nucleotide sequence is
[0035] S3: Its nucleotide sequence is
[0036] Reporter2: Its nucleotide sequence is 5'-CY5-ACAUGCACCGUUACCCCAA-BHQ2-3' (SEQ ID NO.8).
[0037] The miRNA1 and miRNA2 are the nucleic acid sequences of miR-21 and miR-210 respectively. Research shows that miR-21 can be used as an endogenous miRNA marker to distinguish breast cancer cells from normal cells, while miR-210 can be used to identify the subtype characteristics of triple-negative breast cancer (TNBC).
[0038] For the P1 sequence, its 5' end is phosphorylated, and its 3' (bold part) is complementary to miRNA1. When miRNA1 is present, it can serve as a primer. Under the action of polymerase and exonuclease, the product S1 is obtained. The bold underlined sequence at the 3' end of the S1 sequence is complementary to the bold underlined sequence at the 3' end of Act. After binding to Act, it can relieve the blocking effect of Act on crRNA.
[0039] The crRNA is an unmodified ordinary Cas12a crRNA sequence, which consists of a 21nt repeat region (hairpin region) (double underlined) and a 20nt spacer region (wavy underlined). For the Act sequence, the italicized sequence at its 5' end is the S2 sequence (1). To protect the 5' end of Act from trans-cleavage degradation, locked nucleic acid modifications are added to some bases (emphasized) at the 5' end of Act. A wavy underlined sequence in the middle is complementary to the spacer region of crRNA (2), and another bold sequence is complementary to a part of the hairpin region of crRNA (3). A toehold sequence is left at the 3' end (4). When S1 binds to the (3) and (4) parts of Act, it can relieve the blocking effect of Act on crRNA. Activate the cis- and trans-cleavage activities of Cas12a. The cis-cleavage of Act by Cas12a releases the -OH at the 3' end of the S2 sequence. The trans-cleavage activity of Cas12a can cleave Reporter1, releasing a fluorescent signal.
[0040] The 5'-end and 3'-end of the Reporter1 sequence are respectively attached with a fluorescent group ROX and a quenching group BHQ2, and can be trans-cleaved by Cas12a to generate a fluorescent signal in the ROX channel for detection. For the S2 sequence, its 5'-end is complementary to miRNA2, and the underlined sequence at its 3'-end is complementary to P2. When miRNA2 is absent, the Tm value of the paired bases of S2 and P2 is too low to stably bind. When miRNA2 is present, it can bridge S2 and P2 together, increase the Tm value, and enable the 3'-end of S2 to amplify along P2. Under the action of the nicking endonuclease, the S3 product is generated.
[0041] For the P2 sequence, the underlined sequence at its 3'-end is complementary to the underlined sequence at the 5'-end of miRNA2, its 5'-end is complementary to the S3 sequence, and it has a nicking endonuclease Nb.BbvCI recognition site (5'-CCTCA GC-3') in the middle. When S2 amplifies along P2, under the action of the nicking endonuclease, the S3 sequence is cleaved and released. The S3 sequence is a 10-23 deoxyribozyme, which can bind to Reportor2 and cleave Reportor2 in the presence of magnesium ions. Reportor2 is an RNA substrate with CY5 and BHQ2 at its two ends respectively, and can generate a fluorescent signal in the CY5 channel for detection after being cleaved by the deoxyribozyme.
[0042] Therefore, on the one hand, the present invention provides a new idea for detecting miRNA by the Cas12a system, and on the other hand, it solves the problem that it is difficult to detect two miRNAs in the existing CRISPR / Cas one-tube system. The cascade amplification strategy sequences adopted by the present invention are screened and optimized, and have the advantages of simple operation, high sensitivity, strong specificity, short detection time, etc., and can be extended and applied to the detection of other miRNA targets.
[0043] Compared with the prior art, the technical advantages of the present invention are as follows:
[0044] (1) The amplification step has universality. The present invention has created a cascade amplification detection method based on Cas12a-blocked crRNA and deoxyribozyme. Some sequences involved in this method, such as crRNA, Reportor1, Reportor2, S1, S3, etc. are universal sequences, and a small number of sequences need to be designed according to the target. Therefore, it is very easy to be extended and applied to the detection of other miRNAs, and only the sequence design of the corresponding primers needs to be modified according to different miRNAs;
[0045] (2) High specificity: Using miRNA as an amplification primer or a linking scaffold, high-specificity detection of the target is achieved according to the principle of base complementary pairing;
[0046] (3) Quick, simple and short detection time: Simple operation. The target can be added to the premixed solution for detection reaction, and the reaction time is within 2 hours.
[0047] (4) Isothermal amplification and reaction: The amplification reaction, CRISPR / Cas12a reaction and deoxyribozyme cleavage reaction involved in the invention are all carried out at 37 °C, without the need for complex temperature-changing instrument equipment, with low cost and wider application scenarios.
[0048] (5) High sensitivity: Using amplification reaction and CRISPR / Cas for cascade amplification to greatly increase sensitivity.
[0049] (6) Multiplex detection: By reading the fluorescence value changes of two channels to simultaneously detect 2 miRNAs, the accuracy of cancer subtype diagnosis is improved. Description of the Drawings
[0050] Figure 1 It is the schematic diagram of the technical solution of the present invention;
[0051] Figure 2 It is the diagram showing the effect of different lengths of Act activator on the trans-cleavage activity of inhibiting the CRISPR / Cas12a system;
[0052] Figure 3 It is the amplification effect diagram of different combinations of lengths of S2 and P2;
[0053] Figure 4 It is the specific detection result diagram of different miRNA targets;
[0054] Figure 5 It is the detection result diagram of miRNAs extracted from different cells. Detailed Embodiments
[0055] The present invention will be further elaborated below in conjunction with embodiments. These embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. For the experimental methods without specific conditions in the following examples, they are usually carried out according to the conventional conditions in the art or according to the conditions recommended by the manufacturer; the raw materials, reagents, etc. used, unless otherwise specified, are all raw materials and reagents that can be obtained from conventional markets and other commercial channels. Any non-substantial changes and substitutions made by those skilled in the art based on the present invention fall within the scope of protection required by the present invention. Example 1 Sequence Design of the Cascade Amplification Detection Method Based on Cas12a Blocking crRNA and Deoxyribozyme
[0056] First, download the sequences of miRNA21 (miRNA1) and miRNA210 (miRNA2) from the NCBI database for subsequent sequence design. Among them,
[0057] The nucleotide sequence of miRNA21 is 5'-UAGCUUAUCAGACUGAUGUUGA-3' (SEQ ID NO.1);
[0058] miRNA210: Its nucleotide sequence is 5'-CUGUGCGUGUGACAGCGGCUGA-3' (SEQ ID NO.2);
[0059] Since a key step in the present invention is the deblocking of crRNA, the blocking of crRNA is extremely important. Therefore, the spacer region of the crRNA sequence was first designed, and then the Act sequence was designed. In addition to being complementary to the spacer region of the crRNA sequence, a part of the Act sequence matches different lengths of the hairpin region of crRNA to screen for Act sequences with excellent blocking effects. The crRNA sequence and Act sequences of different lengths are as follows:
[0060] crRNA: Its nucleotide sequence is 5'-UAAUUUCUACUAAGUGUAGAUCCAAUUC AAUGUAGACAGAC-3' (SEQ ID NO.3);
[0061] Act-1: GTCTGTCTACATTGAATTGGAACTTACTATCTCA;
[0062] Act-2:
[0063] Act-3:
[0064] Act-4:
[0065] Act-5:
[0066] Reporter1 was used to measure the trans-cleavage activity of Cas12a.
[0067] Reporter1: Its nucleotide sequence is 5'-ROX-CCCCCC-BHQ2-3'.
[0068] Prepare 10×reaction buffer 1 according to the formula and concentration in Table 1 below:
[0069]
[0070] Prepare the CRISPR mixture according to the formula and concentration in Table 2 below:
[0071] Component Final concentration Volume / μL 10×reaction buffer 1 1× 2 Cas12a 100 nM 1 crRNA 100 nM 1 Reporter1 1 μM 1 <![CDATA[ddH2O]]> / 10 Total 15
[0072] Add 5 μL of Act with a final concentration of 1 μM and different lengths to the prepared CRISPR mixture, with a total volume of 20 μL. React on the Hongshi SLAN-96S fully automatic medical PCR analysis system, and the reaction conditions are: 37 °C, 30 min. Detect the fluorescence signal and analyze the results. As Figure 2 shown, Act-4 and Act-5 can effectively inhibit the activity of Cas12a. Therefore, when designing the Act sequence, 10 bases are selected for the part complementary to the crRNA hairpin region.
[0073] Another key step of the present invention is that miRNA2 acts as a bridge to connect S2 and P2 for amplification. When miRNA2 is absent, it is necessary to ensure that S2 and P2 cannot stably bind. Therefore, the base lengths of S2 and P2 that match are screened. The S2 sequences and P2 sequences of different lengths are as follows:
[0074] S2-1: Its nucleotide sequence is
[0075] S2-2: Its nucleotide sequence is
[0076] S2-3: Its nucleotide sequence is
[0077] P2-1: Its nucleotide sequence is
[0078] P2-2: Its nucleotide sequence is
[0079] P2-3: Its nucleotide sequence is
[0080] Use Reporter2 to report whether the deoxyribozyme sequence is amplified.
[0081] The nucleotide sequence of Reporter2 is 5'-CY5-ACAUGCACCGUUACCCCAA-BHQ2-3'.
[0082] Prepare 10×reaction buffer 3 and reaction buffer 4 according to the formula and concentration in Table 3 below:
[0083]
[0084]
[0085] Prepare the amplification premix and the deoxyribozyme reaction premix according to the formulation and concentration in Table 4 below:
[0086]
[0087] Prepare 2 sets of amplification premixes, add 1 μL of miRNA2 and 1 μL of ddH2O respectively, and then add 1 μL of S2 with a final concentration of 100 nM and 1 μL of P2 with a final concentration of 100 nM with different lengths to the two sets respectively, with a total volume of 20 μL. React on the Hongshi SLAN-96S fully automatic medical PCR analysis system, and the reaction conditions are: 37 °C, 30 min. After the reaction is completed, take 10 μL of the reaction solution and add it to 40 μL of the deoxyribozyme reaction premix, and the reaction conditions are: 37 °C, 30 min. Detect the fluorescence signal and analyze the results. As Figure 3 shown, due to too few complementary base pairs, S2-1 and P2-1 are difficult to amplify deoxyribozyme in the presence of miRNA2. S2-3 and P2-3 can amplify deoxyribozyme even in the absence of miRNA2 due to more complementary base pairs and a larger Tm value. While S2-2 and P2-2 can amplify deoxyribozyme in the presence of miRNA2 and cannot be amplified in the absence of miRNA2, meeting the requirements. Therefore, it is appropriate for S2 and P2 to match 6 bases in design.
[0088] According to the sequence length requirements screened above, considering factors such as GC content, Tm value, and secondary structure, finally design two probes P1 and P2 and Act for blocking crRNA to detect miRNA21 and miRNA210:
[0089] P1: Its nucleotide sequence is
[0090] Act: Its nucleotide sequence is
[0091] P2: Its nucleotide sequence is To ensure the quality of the primers and molecular beacon probes, all sequences were entrusted to Beijing Tsingke Biotechnology Co., Ltd. for synthesis with the HPLC purity standard.
[0092] Example 2 Specificity Analysis of the Cascade Amplification Detection Method Based on Cas12a Blocking crRNA and Deoxyribozyme
[0093] The detection method includes the following process:
[0094] S1. Sample processing: Take miR-21, miR-210, miR-155, and miR-205 and synthesize RNA and dilute them to the same concentration (1 μM) as the targets for specificity analysis. The targets include single targets and mixed targets, and the target design numbers are shown in Table 5 below:
[0095] Table 5 Target composition involved in the present invention
[0096]
[0097]
[0098] S2. Preparation of crRNA / Act hybrid nucleic acid double strand: The crRNA / Act hybrid nucleic acid double strand is formed by mixing crRNA and Act in a ratio of 1:1, annealing at 90 °C for 3 min in 1× reaction buffer 1, and then slowly cooling to room temperature.
[0099] Meanwhile, prepare 10× reaction buffer 1, 10× reaction buffer 3, and reaction buffer 4 according to the formulations and concentrations in Tables 1 and 3 of Example 1. Prepare 10× reaction buffer 2 according to the formulation and concentration in Table 6 below.
[0100] Table 6 Formulation of 10× reaction buffer 2
[0101]
[0102] Prepare premix A, premix B, and premix C according to the formulations and concentrations in Table 7 below.
[0103] Table 7 Preparation process of each premix in the present invention
[0104]
[0105]
[0106] S3. Add 5 μL of miRNA sample to premix A, with a total volume of 20 μL, and perform the reaction on the Hongshi SLAN-96S fully automatic medical PCR analysis system. The reaction conditions are: 37 °C, 40 min. After the reaction is completed, inactivate the enzyme at 75 °C for 5 min to terminate the reaction;
[0107] Add premix B to the above reaction solution, with a total volume of 40 μL, and perform the reaction on the Hongshi SLAN-96S fully automatic medical PCR analysis system. The reaction conditions are: 37 °C, 40 min. Collect the fluorescence signal and analyze the results;
[0108] After the reaction was completed, 10 μL of the reaction solution was added to 40 μL of the C premix. Reaction conditions: 37 °C, 30 min. Detect the fluorescence signal and analyze the results.
[0109] The experimental results are as Figure 4 shown. When only miRNA21 was present, there was a fluorescence signal in the ROX channel. When both miRNA21 and miRNA210 were present, there were fluorescence signals in both the ROX channel and the CY5 channel. When miRNA21 was absent, there was no fluorescence signal in either channel. This indicates that the dual-miRNA detection system based on the Cas12a-mediated blocking of crRNA and deoxyribozyme cascade amplification has excellent specificity.
[0110] Example 3 Application of the detection method of the present invention in detecting breast cancer cells
[0111] Some studies have found that miRNA210 and miRNA21 can be used as diagnostic biomarkers for breast cancer. Among them, miR-21 acts as an oncogene in breast cancer. It is overexpressed in all types of breast cancer cells and can be used to distinguish breast cancer cells from normal cells. In addition, miRNA210 has also been used to identify specific subtypes of triple-negative breast cancer (TNBC), which is highly expressed in TNBC. Based on these studies, the present invention selected the human normal mammary epithelial cell line MCF-10A, the human breast cancer cell line MCF-7, and the human triple-negative breast cancer cell line MDA-MB-231 for RNA extraction and detection.
[0112] S1. Sample treatment: Use the Cell / Tissue miRNA Kit of Yeasen Biotechnology (Shanghai) Co., Ltd. to extract the total miRNA of MCF-10A, MCF-7, and MDA-MB-231.
[0113] S2. Prepare the buffer and premix using the reaction buffer and premix formulations in Example 2. All reactions were carried out on the Hongshi SLAN-96S fully automatic medical PCR analysis system. First, add 5 μL of the miRNA sample to 15 μL of premix A, with a total volume of 20 μL. Reaction conditions: 37 °C, 40 min. After the reaction was completed, inactivate the enzyme by heating at 75 °C for 5 min to terminate the reaction. Add 20 μL of premix B to the above reaction solution, with a total volume of 40 μL, and carry out the reaction on the Hongshi SLAN-96S fully automatic medical PCR analysis system. Reaction conditions: 37 °C, 40 min. Collect the fluorescence signal. After the reaction was completed, take 10 μL of the reaction solution and add it to 40 μL of premix C. Reaction conditions: 37 °C, 30 min. Detect the fluorescence signal and analyze the results.
[0114] The experimental results are asFigure 5 As shown, MDA-MB-231 cells highly expressing miR-210 and miR-21 produced significant fluorescence signals in both the ROX channel and the CY5 channel. MCF-7 cells highly expressing only miR-21 produced significant fluorescence signals only in the ROX channel. MCF-10A cells with low expression of both miRNAs produced lower fluorescence signals in both channels. Therefore, the dual-miRNA system based on the cascade amplification detection of Cas12a-blocked crRNA and deoxyribozyme can specifically distinguish triple-negative breast cancer subtypes from breast cancer. Accurate diagnosis is very important for improving the prognosis of TNBC patients with poor prognosis.
Claims
1. A detection method for cascade amplification of dual miRNA based on Cas12a-blocked crRNA and deoxyribozyme, characterized in that, The process includes the following: S1. Extraction of miRNA from the sample to be tested; S2. Prepare a crRNA / activator Act hybrid nucleic acid duplex for standby use; wherein the nucleotide sequence of the crRNA is shown in SEQ ID NO.3; and the nucleotide sequence of the activator Act is shown in SEQ ID NO.4; S3. Cascade amplification based on Cas12a-blocked crRNA and deoxyribozyme to detect the miRNA extracted in step S1: The miRNA extracted in step S1 is added to the premix A, the premix B containing the crRNA / activator Act hybrid nucleic acid duplex obtained in step S2, and the premix C in sequence, and further reacted to detect the fluorescent signal.
2. The detection method according to claim 1, characterized in that In step S1, the sample nucleic acid miRNA to be tested includes miRNA1 and miRNA2, wherein miRNA1 is miRNA-21, whose nucleotide sequence is shown in SEQ ID NO.1, and miRNA2 is miRNA-210, whose nucleotide sequence is shown in SEQ ID NO.
2.
3. The detection method according to claim 1, characterized in that The hybrid nucleic acid double strand in step S2 is obtained by mixing crRNA and activator Act in a 1:1 ratio, annealing in 1×reaction buffer 1, and then slowly cooling to room temperature.
4. The detection method according to claim 1, characterized in that The specific process of cascade amplification detection of dual miRNAs described in step S3 is as follows: (1) adding the miRNA sample extracted in step S1 to the premixed solution A, and performing a reaction on a PCR analysis system to obtain a PCR reaction solution I; (2) adding the premix B containing the crRNA / activator Act hybrid nucleic acid duplex obtained in step S2 to the PCR reaction solution I obtained in step (1), performing the reaction on a PCR analysis system, collecting the fluorescent signal, and obtaining a PCR reaction solution II; (3) Take the PCR reaction solution II obtained in step (2) and add it to the premixed solution C for reaction, then detect the fluorescence signal and analyze the results.
5. The detection method according to claim 4, characterized in that: The premix A in step (1) comprises Klenow Fragment, dNTPs, P1, reaction buffer 1, λ endonuclease, reaction buffer 2 and sterilized ultrapure water; the nucleotide sequence of P1 is shown in SEQ ID NO.
5.
6. The detection method according to claim 4, characterized in that: The premix B described in step (2) includes Act / crRNA hybrid duplex, Cas12a, Reportor1, P2, Klenow Fragment, nicking endonuclease, dNTPs, reaction buffer 1, reaction buffer 3 and sterile ultrapure water; the nucleotide sequence of Reportor1 is shown in SEQ ID NO.6; the nucleotide sequence of P2 is shown in SEQ ID NO.
7.
7. The detection method according to claim 4, characterized in that: The premixed solution C described in step (3) includes Reportor2, reaction buffer 4 and sterilized ultrapure water; the nucleotide sequence of Reportor2 is shown in SEQ ID NO.
8.
8. Use of the detection method according to any one of claims 1 to 7 in the simultaneous detection of two tumor miRNAs.