Kit for detecting cat hypertrophic cardiomyopathy and application
By providing a kit for detecting hypertrophic cardiomyopathy in cats, using multiple Taqman-MGB real-time fluorescence quantitative PCR technology, the problem of cumbersome, long cycle and high cost of detecting gene mutations in cats in the prior art is solved, and the detection effect of fast, low cost and high sensitivity is achieved.
Patent Information
- Application Number
- CN202510310947.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-06-27
AI Technical Summary
The method for detecting gene mutations of cat hypertrophic cardiomyopathy in the prior art is cumbersome to operate, has a long detection cycle, is high cost, and is not suitable for large-scale clinical promotion.
A kit for detecting hypertrophic cardiomyopathy in cats is provided. It uses a dual-tube PCR premix solution, including amplification buffer, dNTPs, DNA polymerase and primer probe sets. Through multiple Taqman-MGB real-time fluorescence quantitative PCR technology, it can quickly distinguish wild type, heterozygous mutant and homozygous mutant of four related genes of hypertrophic cardiomyopathy in cats.
It has achieved rapid and low-cost gene mutation detection of cat hypertrophic cardiomyopathy, with simple operation, shortened detection time to 30 minutes, high detection sensitivity and low cost, and is suitable for large-scale clinical promotion.
Smart Images

Figure CN120210353A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to a kit for detecting feline hypertrophic cardiomyopathy and its application, belonging to the technical field of gene mutation detection. Background Art
[0002] Feline hypertrophic cardiomyopathy (HCM) is one of the most common heart diseases in domestic cats. Affected cats are at risk of sudden cardiac death, congestive heart failure, and systemic arterial thromboembolism. Feline HCM increasingly appears in specific breeds, and is prone to occur in Maine Coons, Ragdolls, Norwegian Forest Cats, American Shorthairs, Persian Cats, Exotic Shorthairs, British Shorthairs, Scottish Fold Cats, and Devon Rex Cats. In the initial stage of the disease, affected cats usually show no symptoms, but can be diagnosed by echocardiogram. The symptoms usually start to appear in subadult and adult cats. The initial symptoms are mainly manifested in congestive heart failure, pulmonary edema, and hind limb muscle spasms, hind limb ischemia, weak pulse, etc. caused by arterial thrombosis. Affected cats usually die of sudden cardiac death.
[0003] In most cases, the cause of feline HCM is unknown. However, some factors such as viral diseases and genetic gene mutations are suspected to be pathogenic, and it seems more common in middle-aged and young male cats. In some specific breeds such as Maine Coons, HCM shows an obvious genetic tendency, indicating that genes may play an important role in the development of the disease. Statistical reports show that British Shorthairs, American Shorthairs, Exotic Shorthairs, Scottish Fold Cats, Norwegian Forest Cats, Bengal Cats, and Persian Cats have a genetic predisposition to the disease. Mutant genes causing hypertrophic cardiomyopathy have been identified in Maine Coons, Ragdolls, Sphynx Cats, and Domestic Shorthairs, and cardiomyopathy can be screened by gene detection.
[0004] Analysis of cardiac death according to genotype shows that the time of cardiac death in homozygous cats is significantly shortened, and there is no significant difference in the survival time between heterozygous cats and wild cats, indicating that the disease is an incompletely dominant genetic disease, that is, the incidence of the disease is positively correlated with the number of pathogenic genes carried. According to statistics, the probability of a cat carrying one pathogenic gene developing hypertrophic cardiomyopathy is 1.8 times that of a normal cat; when carrying two pathogenic genes, this probability increases to 18 times.
[0005] For veterinarians, HCM has attracted much attention because of its high incidence rate and its tendency to cause sudden death and thromboembolic events, which often occur in seemingly healthy cats. For breeders of purebred cats, they hope to reduce the incidence of HCM by establishing breeding programs. For scientists, cats as a research model for HCM help to better understand human HCM. Therefore, breeders of purebred cats should conduct genetic testing on all breeding cats and try to avoid individuals carrying disease-causing genes (carriers and homozygotes) from participating in breeding. The prevalence of HCM is relatively high, but the disease-causing genes can be eliminated through simple genetic testing. Hypertrophic cardiomyopathy in domestic cats remains an incurable disease, so the best way to prevent the disease is to prevent cats carrying disease-causing genes from breeding.
[0006] In the prior art, there are few methods for detecting HCM gene mutations in cats. Generally, the method reported in the literature is DNA sequencing. After amplifying the target fragment, the amplified product is sequenced, and then the sequencing result is compared with the relevant sequences in the database. This method is cumbersome to operate, has a long detection cycle, high cost, and is prone to cross-contamination during open-cap operation, so it is not suitable for large-scale clinical promotion.
[0007] Based on the above situation, there is an urgent need for a new method that can quickly and low-cost detect HCM gene mutations in cats to provide technical support for clinical diagnosis and treatment. Summary of the Invention
[0008] The purpose of the present application is to provide a kit and application for detecting feline hypertrophic cardiomyopathy, which can quickly distinguish the wild type, heterozygous mutant type, and homozygous mutant type of four related genes of feline hypertrophic cardiomyopathy at the same time.
[0009] To achieve the above purpose, the present application provides the following technical solutions: In the first aspect, the present application provides a kit for detecting feline hypertrophic cardiomyopathy, which includes a double-tube PCR premix. Each tube of the PCR premix includes: Amplification buffer, dNTPs, DNA polymerase, and a primer-probe group; The primer-probe group of one tube of the PCR premix includes the following two groups, and the primer-probe group of the other tube of the PCR premix includes the other two groups: The first primer group for detecting the c.91G>C [A31P] mutation of feline MYBPC3; The second primer group for detecting the c.2453C>T [R818W] mutation of feline MYBPC3; The third primer group for detecting the c.7384G>C [G2462R] mutation of feline ALMS1; The fourth primer set for detecting the cat MYH7 c.5647G>A [E1883K] mutation; and, Probe sets respectively applicable to each primer set, including: Wild-type probe and mutant probe for the cat MYBPC3 c.91G>C [A31P] mutation; Wild-type probe and mutant probe for the cat MYBPC3 c.2453C>T [R818W] mutation; Wild-type probe and mutant probe for the cat ALMS1 c.7384G>C [G2462R] mutation; Wild-type probe and mutant probe for the cat MYH7 c.5647G>A [E1883K] mutation; In one or more feasible embodiments, the first primer set includes the upstream primer F1 shown in SEQ ID NO:1 and the downstream primer R1 shown in SEQ ID NO:2; The second primer set includes the upstream primer F2 shown in SEQ ID NO:3 and the downstream primer R2 shown in SEQ ID NO:4; The third primer set includes the upstream primer F3 shown in SEQ ID NO:5 and the downstream primer R3 shown in SEQ ID NO:6; The fourth primer set includes the upstream primer F4 shown in SEQ ID NO:7 and the downstream primer R4 shown in SEQ ID NO:8.
[0010] In one or more feasible embodiments, the probe set includes: The first probe set, applicable to the first primer set, includes the wild-type probe WT-P1 shown in SEQ ID NO:9 and the mutant probe M-P1 shown in SEQ ID NO:10; The second probe set, applicable to the second primer set, includes the wild-type probe WT-P2 shown in SEQ ID NO:11 and the mutant probe M-P2 shown in SEQ ID NO:12; The third probe set, applicable to the third primer set, includes the wild-type probe WT-P3 shown in SEQ ID NO:13 and the mutant probe M-P3 shown in SEQ ID NO:14; and, The fourth probe set, applicable to the fourth primer set, includes the wild-type probe WT-P4 shown in SEQ ID NO:15 and the mutant probe M-P4 shown in SEQ ID NO:16.
[0011] In one or more feasible embodiments, adding an enhancer can improve the specificity of mutant probes and wild-type probes. The PCR premix further includes a PCR enhancer, and the PCR enhancer includes one or more of ficoll, formamide, BSA, and DMSO.
[0012] In one or more feasible embodiments, each of the probe sets is labeled with a different fluorescent group.
[0013] In one or more feasible embodiments, the probes in each of the probe sets are Taqman-MGB probes, and the fluorescent labeling groups are respectively one of FAM, VIC, ROX, or CY5.
[0014] In one or more feasible embodiments, the kit further includes a sample preservation solution, a positive control product, and a negative control product.
[0015] In one or more feasible embodiments, the positive control product contains MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] mutant sequences, and can be a purified PCR product or an artificial plasmid embedded with MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] mutant sequences; and / or, the negative control product contains MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] wild-type sequences, and can be a purified PCR product or an artificial plasmid embedded with MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] wild-type sequences.
[0016] In a second aspect, the present application provides the use of the kit according to the first aspect in the detection of cat genes for non-diagnostic purposes.
[0017] In one or more feasible embodiments, increasing the annealing temperature can improve the specificity of mutant probes and wild-type probes. Applied to real-time fluorescence PCR, the PCR amplification program is 95 °C for 1 min; 95 °C for 10 sec, 63 °C for 8 sec, 45 cycles.
[0018] In one or more feasible embodiments, adding a PCR enhancer can facilitate DNA template denaturation, improve primer binding specificity, and inhibit non-specific amplification. The PCR enhancer is one or more of ficoll, formamide, BSA, and DMSO.
[0019] Through the embodiments of the present application, the beneficial effects of the present application are as follows: 1. Comprehensive detection sites: The present invention adopts multiplex Taqman-MGB real-time fluorescence quantitative PCR technology, and improves the specificity of mutant probes and wild-type probes by primer-probe design, PCR enhancer screening, and annealing temperature optimization. Different mutants and wild-types use different fluorescence-labeled probes. During detection, according to the real-time fluorescence quantitative PCR amplification curve, four related gene mutation sites of feline hypertrophic cardiomyopathy can be detected simultaneously.
[0020] 2. Simple operation: The reagents are pre-packaged in single tubes with single doses. The sample does not need to be extracted, and the amplification product does not need to be sequenced to verify the result. The detection can be completed directly by adding the sample in one step.
[0021] 3. Fast: The amplification program is 95 °C for 1 min (1 cycle); 95 °C for 10 sec, 63 °C for 8 sec (45 cycles). The detection can be completed in only 30 minutes, shortening the diagnosis time.
[0022] 4. High detection sensitivity: The lowest detection limit of the DNA sample is 0.05 pg / μL.
[0023] 5. Low detection cost: Only 1 PCR instrument is needed to complete the corresponding detection. The detection results are automatically interpreted by the instrument, and the results are objective and have good specificity.
[0024] The above description is only an overview of the technical solution of the present application. In order to be able to understand the technical means of the present application more clearly and implement it according to the content of the specification, the following describes in detail with the preferred embodiments of the present application and in conjunction with the accompanying drawings as follows. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1A - 1H It is the amplification curve of the negative control product (normal) in one or more embodiments of the present application; Figure 2A - 2H It is the amplification curve of the sample carrying the MYBPC3 c.91G>C [A31P] homozygous mutation (type I high-risk pathogenic) in one or more embodiments of the present application; Figure 3A - 3H It is the amplification curve of the sample carrying the ALMS1 c.7384G>C [G2462R] heterozygous mutation (type III low-risk pathogenic) in one or more embodiments of the present application; Figure 4A - 4HAmplification curve of samples carrying the homozygous mutation of ALMS1 c.7384G>C [G2462R] (high pathogenic risk type III) in one or more embodiments of the present application; Figure 5A - 5H Amplification curve of samples carrying the homozygous mutation of MYBPC3 c.2453C>T [R818W] (high pathogenic risk type II) in one or more embodiments of the present application. Detailed implementation manners
[0026] The following uses specific specific examples to illustrate the implementation manners of the present application. Those skilled in the art can easily understand other advantages and effects of the present application from the content disclosed in this specification. The present application can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present application. It should be noted that, without conflict, the following embodiments and the features in the embodiments can be combined with each other.
[0027] It should be noted that the diagrams provided in the following embodiments only illustrate the basic concept of the present application in a schematic manner. Therefore, only the components related to the present application are shown in the diagrams, rather than being drawn according to the number, shape, and size of the components in actual implementation. The type, quantity, and proportion of each component in actual implementation can be arbitrarily changed, and the component layout type may also be more complex.
[0028] For the purpose of illustration, some exemplary embodiments of the present application are described. It should be understood that the present application can be implemented in other ways not specifically shown in the drawings.
[0029] For veterinarians, HCM has attracted much attention because of its high incidence and the easy occurrence of sudden death and thromboembolic events, which often occur in seemingly healthy cats. For breeders of purebred cats, they hope to reduce the incidence of HCM by establishing breeding programs. For scientists, cats as a research model for HCM help to better understand human HCM. Therefore, breeders of purebred cats should conduct genetic testing on all breeding cats and try to avoid individuals carrying pathogenic genes (carriers and homozygotes) from participating in breeding. The prevalence of feline hypertrophic cardiomyopathy is relatively high, but the pathogenic genes can be eliminated through simple genetic testing. Hypertrophic cardiomyopathy existing in domestic cats is still an incurable disease. Therefore, the best way to prevent this disease is to prevent cats carrying pathogenic genes from participating in breeding.
[0030] Therefore, the present application provides a kit for detecting feline hypertrophic cardiomyopathy, which includes a double-tube PCR premix, and each tube of the PCR premix includes: Amplification buffer, dNTPs, DNA polymerase, and primer-probe group; One of the primer-probe sets of the PCR premix includes the following two sets, and the primer-probe set of the other tube of the PCR premix includes another two sets: The first primer set for detecting the cat MYBPC3 c.91G>C [A31P] mutation; The second primer set for detecting the cat MYBPC3 c.2453C>T [R818W] mutation; The third primer set for detecting the cat ALMS1 c.7384G>C [G2462R] mutation; and, The fourth primer set for detecting the cat MYH7 c.5647G>A [E1883K] mutation; The probe sets respectively applicable to each primer set include: The wild-type probe and mutant probe for the cat MYBPC3 c.91G>C [A31P] mutation; The wild-type probe and mutant probe for the cat MYBPC3 c.2453C>T [R818W] mutation; The wild-type probe and mutant probe for the cat ALMS1 c.7384G>C [G2462R] mutation; The wild-type probe and mutant probe for the cat MYH7 c.5647G>A [E1883K] mutation; Specifically, the first primer set includes the upstream primer F1 shown in SEQ ID NO:1 and the downstream primer R1 shown in SEQ ID NO:2; the second primer set includes the upstream primer F2 shown in SEQ ID NO:3 and the downstream primer R2 shown in SEQ ID NO:4; the third primer set includes the upstream primer F3 shown in SEQ ID NO:5 and the downstream primer R3 shown in SEQ ID NO:6; the fourth primer set includes the upstream primer F4 shown in SEQ ID NO:7 and the downstream primer R4 shown in SEQ ID NO:8.
[0031] The probe groups include: a first probe group, applicable to the first primer group, including a wild-type probe WT-P1 as shown in SEQ ID NO:9 and a mutant probe M-P1 as shown in SEQ ID NO:10; a second probe group, applicable to the second primer group, including a wild-type probe WT-P2 as shown in SEQ ID NO:11 and a mutant probe M-P2 as shown in SEQ ID NO:12; a third probe group, applicable to the third primer group, including a wild-type probe WT-P3 as shown in SEQ ID NO:13 and a mutant probe M-P3 as shown in SEQ ID NO:14; and a fourth probe group, applicable to the fourth primer group, including a wild-type probe WT-P4 as shown in SEQ ID NO:15 and a mutant probe M-P4 as shown in SEQ ID NO:16.
[0032] It can be understood that each of the probe groups is labeled with a different fluorescent group. In one embodiment, the four probes in each PCR reaction tube are Taqman-MGB probes, and the fluorescent labeling groups are FAM, VIC, ROX, and CY5 respectively.
[0033] Specifically, each primer and probe group is shown in Table 1.
[0034] Table 1 Names of primer sets and probe sets Sequence 5’ - 3’ SEQ ID NO F1 GCCAAGGTCAGTGGAAGTGG 1 R1 GCTGCTAGGCCATACTTGTCA 2 WT - P1 TCGAGGCCGAGAC 9 M - P1 TCGAGCCCGAGAC 10 F2 CCTGGAGCGCAAGAAGAAGA 3 R2 CGCGTAGACTCGCATCTCAT 4 WT - P2 TGGATGCGGCTGAA 11 M - P2 TGGATGTGGCTGAA 12 F3 GGATGATGACCTGTCCATCCC 5 R3 GAAGGACGGCTTAGCCACG 6 WT - P3 TAGATCCCTTCTT 13 M - P3 AGATCCGTTCTTT 14 F4 CTCACCTACCAGACGGAGGA 7 R4 CGGAACTTGGACAGGTTGGT 8 WT - P4 CTCCTCGGCCTGG 15 M - P4 AGGCCAAGGAGGC 16 By way of example and not limitation, in each tube of PCR premix, a PCR enhancer is further included, and the PCR enhancer includes one or more of ficoll, formamide, BSA, and DMSO. In one embodiment, the PCR enhancer includes ficoll, formamide, BSA, DMSO, etc.
[0035] In one embodiment, the kit includes: PCR premix 1, the first primer group, the second primer group, the first probe group, the second probe group, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg2 + , ficoll, formamide, BSA, DMSO, etc.; PCR premix 2, the third primer group, the fourth primer group, the third probe group, the fourth probe group, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg2 + , ficoll, formamide, BSA, DMSO, etc.
[0036] In one embodiment, the kit includes: PCR premix 1, the first primer group, the third primer group, the first probe group, the third probe group, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg2+ , Ficoll, formamide, BSA, DMSO, etc.; PCR Premix 2, the second primer set, the fourth primer set, the second probe set, the fourth probe set, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg2 + , Ficoll, formamide, BSA, DMSO, etc.
[0037] In one of the embodiments, the kit includes: PCR Premix 1, the first primer set, the fourth primer set, the first probe set, the fourth probe set, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg2 + , Ficoll, formamide, BSA, DMSO, etc.; PCR Premix 2, the second primer set, the third primer set, the second probe set, the third probe set, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg2 + , Ficoll, formamide, BSA, DMSO, etc.
[0038] In one or more of the embodiments, the kit further includes a sample preservation solution, a positive control product, and a negative control product. Among them, the positive control product contains MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] mutant sequences, and can be a purified PCR product or an artificial plasmid embedded with MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] mutant sequences; and / or, the negative control product contains MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] wild-type sequences, and can be a purified PCR product or an artificial plasmid embedded with MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], MYH7 c.5647G>A [E1883K] wild-type sequences.
[0039] In one or more embodiments, based on the above-mentioned kit, it is possible to simultaneously detect whether the genes of feline hypertrophic cardiomyopathy carry MYBPC3:c.91G > C, MYBPC3:c.2453C > T, ALMS1c.7384G>C and MYH7c.5647G>A in one step. Specifically: S1. Without pretreatment, directly add the samples into the double-tube PCR premix respectively; S2. Based on the multiplex Taqman-MGB real-time fluorescence PCR method, use a real-time fluorescence PCR instrument for amplification. The amplification procedure is as follows: 1. Pre-denaturation: 95°C for 1 minute to completely denature the DNA.
[0040] 2. Cycle amplification (45 cycles): - Denaturation: 95°C for 10 seconds to dissociate the DNA double strand; - Annealing / extension: 63°C for 8 seconds, and the primer binds to the template and extends.
[0041] 3. Fluorescence signal acquisition: At the end of the annealing / extension step of each cycle, collect the signals of four fluorescence channels (FAM, VIC, ROX, CY5).
[0042] S3. Result analysis: - Wild-type sample: - Fluorescence signals are detected only in the wild-type probe channels (WT-P1, WT-P2, WT-P3, WT-P4), and the Ct value ≤ 35.
[0043] - There is no signal or the Ct value > 40 in the mutant probe channels (M-P1, M-P2, M-P3, M-P4).
[0044] - Homozygous mutant sample: - Fluorescence signals are detected only in the mutant probe channels, and the Ct value ≤ 35.
[0045] - There is no signal or the Ct value > 40 in the wild-type probe channels.
[0046] - Heterozygous mutant sample: - Fluorescence signals are detected in both the wild-type and mutant probe channels, and the Ct values are both ≤ 35.
[0047] - No-template control (NTC): - There is no fluorescence signal or the Ct value > 40 in all channels, indicating no contamination.
[0048] The following will further elaborate on the present application in combination with specific embodiments.
[0049] Composition of the kit: PCR amplification reaction solution A, PCR amplification reaction solution B, sample preservation solution, positive control product, negative control product.
[0050] The positive control product contains the MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] mutant sequences, and can be a purified PCR product or an artificial plasmid embedded with the MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] mutant sequences, which is used to verify the accuracy of the detection method.
[0051] The negative control product contains the MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] wild-type sequences, and can be a purified PCR product or an artificial plasmid embedded with the MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] wild-type sequences, which is used to verify the specificity of the detection method.
[0052] Other auxiliary materials: PCR tubes, pipette tips, centrifuge tubes, etc.
[0053] Among them, the components of PCR amplification reaction solution A and PCR amplification reaction solution B are shown in Table 2.
[0054] Table 2
[0055] The kit of this example is stored at -20°C, and the kit specification is: 4 test portions / box. The specific components are shown in Table 3.
[0056] Table 3 Components Specifications Quantities Main ingredients PCR Amplification Reaction Solution A 20 μL / tube 4 <![CDATA[Primers and probes for MYBPC3 c.91G>C and ALMS1 c.7384G>C, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg 2+ , Ficoll, DEPC Water]]> PCR Amplification Reaction Solution B 20 μL / tube 4 <![CDATA[Primer probes for MYBPC3 c.2453C>T and MYH7 c.5647G>A, Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg 2+ , Ficoll, DEPC Water]]> Positive Control 50 μL / tube 1 Artificial plasmid containing mutant sequences of MYBPC3 c.91G>C, MYBPC3 c.2453C>T, ALMS1 c.7384G>C, MYH7 c.5647G>A Negative Control 50 μL / tube 1 Artificial plasmid containing wild - type sequences of MYBPC3 c.91G>C, MYBPC3 c.2453C>T, ALMS1 c.7384G>C, MYH7 c.5647G>A Sample Preservation Solution 1 mL / tube 1 Tris - HCl and EDTA Detection method: (1) Preparation of simulated samples: Negative control product: The plasmid containing the MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] wild-type sequences is serially diluted with the sample preservation solution, and the final concentration is 0.05 pg / μL; Homozygous mutation simulation sample of MYBPC3 c.91G>C [A31P]: Plasmids containing the MYBPC3 c.91G>C [A31P] mutant sequence and plasmids containing the wild-type sequences of MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] were serially diluted with the sample preservation solution to a final concentration of 0.05 pg / μL; Heterozygous mutation simulation sample of ALMS1 c.7384G>C [G2462R]: Plasmids containing the wild-type sequences of MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] and plasmids containing the ALMS1 c.7384G>C [G2462R] mutant sequence were serially diluted with the sample preservation solution to a final concentration of 0.05 pg / μL; Homozygous mutation simulation sample of ALMS1 c.7384G>C [G2462R]: Plasmids containing the wild-type sequences of MYBPC3 c.91G>C [A31P], MYBPC3 c.2453C>T, and MYH7 c.5647G>A [E1883K] and plasmids containing the ALMS1 c.7384G>C [G2462R] mutant sequence were serially diluted with the sample preservation solution to a final concentration of 0.05 pg / μL; Homozygous mutation simulation sample of MYBPC3 c.2453C>T [R818W]: Plasmids containing the wild-type sequences of MYBPC3 c.91G>C [A31P], ALMS1 c.7384G>C [G2462R], and MYH7 c.5647G>A [E1883K] and plasmids containing the MYBPC3 c.2453C>T [R818W] mutant sequence were serially diluted with the sample preservation solution to a final concentration of 0.05 pg / μL; (2) Loading samples: Take 5 μL of the above-prepared PCR templates and add them to 20 μL of PCR amplification reaction solution A and PCR amplification reaction solution B respectively. The remaining DNA solution was aliquoted and stored at -20 °C; (3) Amplification: Click on the cat hypertrophic amplification program for amplification, and the detection channels were selected as FAM, VIC, ROX, and Cy5.
[0057] The PCR reaction conditions were:
[0058] (3) Analysis of detection results: The results are shown in Figures 1 - 5, which respectively correspond to the experimental results presented during the amplification of the negative control product, the MYBPC3 c.91G>C [A31P] homozygous mutation, the ALMS1 c.7384G>C [G2462R] heterozygous mutation, the ALMS1 c.7384G>C [G2462R] homozygous mutation, and the MYBPC3 c.2453C>T [R818W] homozygous mutation plasmid simulation samples.
[0059] Specifically, Figure 1A - Figure 1H They are respectively the amplification curves of 91-M, ALMS1-WT, 91-WT, ALMS1-M, 2453-WT, 5647-WT, 2453-M, and 5647-M. The relevant data are shown in Table 1 below: Table 1
[0060] Specifically, Figure 2A - Figure 2H They are respectively the amplification curves of 91-M, ALMS1-WT, 91-WT, ALMS1-M, 2453-WT, 5647-WT, 2453-M, and 5647-M. The relevant data are shown in Table 2 below: Table 2
[0061] Specifically, Figure 3A - Figure 3H They are respectively the amplification curves of 91-M, ALMS1-WT, 91-WT, ALMS1-M, 2453-WT, 5647-WT, 2453-M, and 5647-M. The relevant data are shown in Table 3 below: Table 3
[0062] Specifically, Figure 4A - Figure 4H They are respectively the amplification curves of 91-M, ALMS1-WT, 91-WT, ALMS1-M, 2453-WT, 5647-WT, 2453-M, and 5647-M. The relevant data are shown in Table 4 below: Table 4
[0063] Specifically, Figure 5A - Figure 5H They are respectively the amplification curves of 91-M, ALMS1-WT, 91-WT, ALMS1-M, 2453-WT, 5647-WT, 2453-M, and 5647-M. The relevant data are shown in Table 5 below: Table 5
[0064] It can be seen that: In the negative control, only the wild type had specific amplification, and no change in fluorescence signal was detected in the mutant type. In the homozygous mutation of MYBPC3 c.91G>C [A31P], only the mutant type of MYBPC3 c.91G>C, the wild types of MYBPC3 c.2453C>T, ALMS1 c.7384G>C, and MYH7 c.5647G>A had specific amplification, and no change in fluorescence signal was detected in the wild type of MYBPC3 c.91G>C and other mutant types. In the heterozygous mutation of ALMS1 c.7384G>C [G2462R], only the mutant type of ALMS1 c.7384G>C and the other four wild types had specific amplification, and no change in fluorescence signal was detected in other mutant types. In the homozygous mutation of ALMS1 c.7384G>C [G2462R], only the mutant type of ALMS1 c.7384G>C, the wild types of MYBPC3 c.91G>C, MYBPC3 c.2453C>T, and MYH7 c.5647G>A had specific amplification, and no change in fluorescence signal was detected in the wild type of ALMS1 c.7384G>C and other mutant types. In the homozygous mutation of MYBPC3 c.2453C>T [R818W], only the mutant type of MYBPC3 c.2453C>T, the wild types of MYBPC3 c.91G>C, ALMS1 c.7384G>C, and MYH7 c.5647G>A had specific amplification, and no change in fluorescence signal was detected in the wild type of MYBPC3 c.2453C>T and other mutant types. Therefore, the specific probes and primers provided by the present invention have good specificity and accurate detection effects.
[0065] In summary, the present application provides a primer and probe composition, a kit, and a detection method for rapid and simple detection of gene mutations in feline hypertrophic cardiomyopathy. Using the multiplex Taqman-MGB real-time fluorescence PCR technology, the mutation sites related to feline hypertrophic cardiomyopathy are detected. The operation is simple, the specificity is strong, the sensitivity is high, the reliability is strong, and the cost is low. The kit of the present invention is conducive to carrying out the gene mutation screening work of feline hypertrophic cardiomyopathy. Cats identified as HCM carriers can be used as models for disease research and HCM treatment development. Cats identified as HCM carriers can also be removed from the breeding population to improve the overall health of domestic and wild cat breeds.
[0066] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the various technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as falling within the scope described in this specification.
[0067] The above-described embodiments merely represent several implementation manners of the present application. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the patent application. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims.
Claims
1. A kit for detecting feline hypertrophic cardiomyopathy, characterized in that: It includes two tubes of PCR premix solution, each tube of the PCR premix solution includes: amplification buffer, dNTPs, DNA polymerase, and primer probe sets; The primer probe set in one tube of the PCR premix solution includes the following two sets, and the primer probe set in another tube of the PCR premix solution includes another two sets: The first primer set for detecting the cat MYBPC3c.91G>C [A31P] mutation; The second primer set for detecting the cat MYBPC3c.2453C>T [R818W] mutation; The third primer set for detecting the feline ALMS1c.7384G>C [G2462R] mutation; A fourth primer set for detecting the feline MYH7c.5647G>A [E1883K] mutation; and The probe sets suitable for each primer set include: Wild-type and mutant probes targeting the cat MYBPC3 c.91G>C [A31P] mutation; Wild-type and mutant probes targeting the cat MYBPC3 c.2453C>T [R818W] mutation; Wild-type and mutant probes targeting the feline ALMS1 c.7384G>C [G2462R] mutation; Wild-type and mutant probes for the feline MYH7 c.5647G>A [E1883K] mutation.
2. The kit according to claim 1, characterized in that The first primer set includes an upstream primer F1 as shown in SEQ ID NO: 1 and a downstream primer R1 as shown in SEQ ID NO: 2; The second primer set includes an upstream primer F2 as shown in SEQ ID NO:3 and a downstream primer R2 as shown in SEQ ID NO:4; The third primer set includes an upstream primer F3 as shown in SEQ ID NO:5 and a downstream primer R3 as shown in SEQ ID NO:6; The fourth primer set includes an upstream primer F4 as shown in SEQ ID NO:7 and a downstream primer R4 as shown in SEQ ID NO:
8.
3. The kit according to claim 1 or 2, characterized in that The probe set includes: A first probe set, suitable for the first primer set, comprising a wild-type probe WT-P1 as shown in SEQ ID NO:9 and a mutant probe M-P1 as shown in SEQ ID NO:10; A second probe set, suitable for the second primer set, comprising a wild-type probe WT-P2 as shown in SEQ ID NO: 11 and a mutant probe M-P2 as shown in SEQ ID NO: 12; A third probe set, suitable for the third primer set, comprises a wild-type probe WT-P3 as shown in SEQ ID NO: 13 and a mutant probe M-P3 as shown in SEQ ID NO: 14; and, The fourth probe set, suitable for the fourth primer set, includes a wild-type probe WT-P4 as shown in SEQ ID NO:15 and a mutant probe M-P4 as shown in SEQ ID NO:
16.
4. The kit according to claim 1, characterized in that The PCR premix solution also includes a PCR enhancer, and the PCR enhancer includes one or more of polysucrose, formamide, BSA, and DMSO.
5. The kit according to any one of claims 1 to 4, characterized in that Each of the probe groups is labeled with a different fluorescent group.
6. The kit according to claim 5, characterized in that The probes of each probe group are Taqman-MGB probes, and the fluorescent labeling groups are respectively one of FAM, VIC, ROX or CY5.
7. The kit according to any one of claims 1 to 4, characterized in that The kit also includes a sample preservation solution, a positive quality control product and a negative quality control product.
8. The kit according to claim 7, characterized in that The positive control product contains MYBPC3 c.91G>C [A31P], MYBPC3c.2453C>T, ALMS1c.7384G>C [G2462R], MYH7c.5647G>A [E1883K] mutant sequences, which can be purified PCR products or artificial plasmids embedded with MYBPC3 c.91G>C [A31P], MYBPC3c.2453C>T, ALMS1c.7384G>C [G2462R], MYH7c.5647G>A [E1883K] mutant sequences; and / or, The negative quality control product contains MYBPC3 c.91G>C [A31P], MYBPC3c.2453C>T, ALMS1c.7384G>C [G2462R], MYH7c.5647G>A [E1883K] wild-type sequences, which can be purified PCR products or artificial plasmids embedded with MYBPC3c.91G>C [A31P], MYBPC3c.2453C>T, ALMS1c.7384G>C [G2462R], MYH7c.5647G>A [E1883K] wild-type sequences.
9. Use of the kit according to any one of claims 1 to 8 in cat gene detection for non-diagnostic purposes.
10. The use according to claim 9, characterized in that Applied to real-time fluorescence PCR, the PCR amplification program was 95 ℃ for 1 min; 95 ℃ for 10 sec, 63 ℃ for 8 sec, and 45 cycles.