Molecular marker related to egg weight at first laying period and peak period and application of molecular marker
By screening out SNP molecular markers associated with chicken production and peak egg weight traits, and establishing corresponding detection methods, the problems of time-consuming and labor-intensive and slow genetic progress of traditional breeding methods are solved, and early and precise selection of egg weight traits are achieved, which significantly improves the breeding efficiency.
Patent Information
- Application Number
- CN202510424216.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2045-04-07
AI Technical Summary
Traditional egg regeneration methods are time-consuming and labor-intensive, and genetic progress is slow, making it difficult to achieve early and precise selection of egg heavy traits during production and peak periods.
Through experiments, SNP molecular markers at site 76007941, associated with the chromosome 4 starting from the 5' end, were screened, and corresponding detection methods were established to identify the traits of egg weight in chickens.
The early and precise selection of egg weight traits during the start and peak periods has been achieved, which has significantly improved the efficiency of laying hen breeding, avoided the shortcomings of traditional breeding methods, and provided a more efficient and accurate laying hen breeding method.
Smart Images

Figure CN120210382A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of livestock and poultry breeding, and more particularly, to a molecular marker related to age at first egg and egg weight at peak production and its application. Background Art
[0002] As an important agricultural animal, chickens provide humans with high-quality and reasonably priced protein-rich animal products such as chicken and eggs. Egg weight, as a key economic trait in the egg-laying chicken industry, shows significant differences in consumer preferences for egg weight in different regions and for different production purposes. For example, liquid egg products processing prefers large egg types, while processing such as marinated eggs prefers small egg types. This has led to differences in egg weight breeding strategies for different breeds. Traditional breeding methods require multiple measurements of egg weight of individuals at different growth stages, which is not only time-consuming and laborious but also has slow genetic progress.
[0003] Genome-wide association study (GWAS) is one of the main means to identify genetic variations associated with complex traits. Finding genomic genetic variation loci related to egg weight is of crucial significance for implementing molecular breeding to accelerate genetic progress. Using molecular markers such as SNPs for the selection of genetic variations can achieve early and precise selection of traits, thereby further improving the breeding efficiency of target traits at the genetic level. Summary of the Invention
[0004] Based on the deficiencies of conventional breeding techniques, the present invention screened through experiments a locus at position 76007941 from the 5' end of chromosome 4 associated with age at first egg and egg weight at peak production, and established a detection method for this SNP molecular marker. In view of this, the present invention proposes a molecular marker related to age at first egg and egg weight at peak production and its application, aiming to provide a more efficient and precise egg-laying chicken breeding method.
[0005] The present invention proposes an SNP molecular marker related to age at first egg and egg weight at peak production in chickens, and the SNP molecular marker is the nucleotide shown at position 251 in SEQ ID NO: 1, which is A or G.
[0006] The present invention also proposes an application of a substance for detecting the polymorphism or genotype of the SNP molecular marker, and the application at least includes one of the following:
[0007] A1) Application in identifying or assisting in identifying age at first egg and egg weight at peak production traits in chickens;
[0008] A2) Application in chicken breeding;
[0009] A3) Application in preparing chicken breeding products;
[0010] Among them, the SNP molecular marker is a single nucleotide polymorphism in the chicken genome;
[0011] The SNP molecular marker is the nucleotide shown at the 251st position in SEQ ID NO: 1, which is A or G.
[0012] Preferably, when the SNP molecular marker is of the AA genotype, this genotype is the dominant genotype for large egg weight at the onset of lay and during the peak production period; when the SNP molecular marker is of the GG genotype, this genotype is the dominant genotype for small egg weight at the onset of lay and during the peak production period.
[0013] The present invention also provides a primer pair for identifying individuals with high or low egg weight at the onset of lay and during the peak production period. The nucleotide sequence of the upstream primer of the primer pair is as shown in SEQ ID NO: 2; the nucleotide sequence of the downstream primer of the primer pair is as shown in SEQ ID NO: 3.
[0014] The present invention also provides an application of the primer pair for identifying individuals with high or low egg weight at the onset of lay and during the peak production period, and the application at least includes one of the following:
[0015] B1) Application in identifying or assisting in identifying the egg weight trait at the onset of lay and during the peak production period of chickens;
[0016] B2) Application in chicken breeding;
[0017] B3) Application in preparing chicken breeding products.
[0018] The present invention also provides a method for identifying or assisting in identifying the egg weight at the onset of lay and during the peak production period, including:
[0019] Detecting the genotype of the SNP in the chicken to be tested. When the SNP molecular marker is of the AA genotype, this genotype is the dominant genotype of the large egg weight strain at the onset of lay and during the peak production period; when the SNP molecular marker is of the GG genotype, this genotype is the dominant genotype of the small egg weight strain at the onset of lay and during the peak production period;
[0020] The SNP molecular marker is the nucleotide shown at the 251st position in SEQ ID NO: 1, which is A or G.
[0021] The present invention also provides a method for chicken breeding, including:
[0022] Detecting the genotype of the SNP in the chicken to be tested, selecting parents with the AA genotype for breeding the large egg weight strain, and selecting parents with the GG genotype for breeding the small egg weight strain.
[0023] The present invention also provides a product, and the product contains substances for detecting the polymorphism or genotype of the SNP molecular marker.
[0024] Preferably, the product is any one of the following:
[0025] Products for detecting single nucleotide polymorphisms or genotypes of loci associated with age at first egg and egg weight at peak production
[0026] Products for identifying or assisting in the identification of age at first egg and egg weight at peak production
[0027] Products for chicken breeding
[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0029] A more efficient and accurate method for selecting laying hens is provided, which can achieve early and accurate selection of the traits of age at first egg and egg weight at peak production, thereby significantly improving the selection efficiency of laying hens. By using the SNP molecular markers proposed in the present invention, the selection of the traits of age at first egg and egg weight at peak production can be carried out at the gene level, avoiding the disadvantages of time-consuming, laborious and slow genetic progress in traditional selection methods. At the same time, the primer pairs and their applications proposed in the present invention further facilitate the detection of SNP molecular markers and the identification of genotypes, providing a powerful tool for chicken breeding. In addition, the products proposed in the present invention contain substances for detecting the polymorphisms or genotypes of SNP molecular markers, which can be widely applied to the practice of chicken breeding and promote the development of the chicken industry. Description of the Drawings
[0030] By reading the following detailed description of the preferred embodiments, various other advantages and benefits will become clear to those of ordinary skill in the art. The drawings are only for the purpose of showing the preferred embodiments and are not considered to be a limitation of the present invention. Moreover, throughout the drawings, the same reference numerals are used to represent the same components. In the drawings:
[0031] Figure 1 Is the Manhattan plot of egg weight at first egg
[0032] Figure 2 Is the Manhattan plot of egg weight at peak production at 44 weeks of age Detailed Embodiments
[0033] The exemplary embodiments of the present disclosure will be described in more detail below with reference to the drawings. Although the exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided so that the present disclosure can be more thoroughly understood and the scope of the present disclosure can be fully conveyed to those skilled in the art. It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below with reference to the drawings and in conjunction with the embodiments. The test methods used in the following embodiments are all conventional methods unless otherwise specified. The consumables, reagents, etc. used are all conventional commercially available products unless otherwise specified.
[0034] Example 1 Identification of SNP Molecular Markers Related to Egg Weight at First Egg Laying and Peak Egg Production
[0035] 1. Experimental Animals
[0036] In this study, a population of 203 Leghorn chickens was used. During the feeding period, they had free access to food and water, and the feeding standards followed the relevant regulations of the industry standard (NY / T 33 - 2004).
[0037] 2. Phenotypic Measurement
[0038] Measure the egg weight of the first three eggs laid at first egg laying and the egg weight at 44 weeks of age at peak egg production.
[0039] 3. Extraction of Genomic DNA
[0040] Collect 0.5 mL of venous blood from under the wings of all experimental chickens using anticoagulant vacuum blood collection tubes. Extract genomic DNA using the phenol - chloroform extraction method. Detect DNA samples with qualified concentration and purity, and then perform agarose gel electrophoresis to further detect the purity and integrity of the DNA samples. The sample concentration is required to be greater than 50 ng / μL, the purity OD260 / 280 is 1.8 - 2.0, and the integrity is good. The DNA samples are stored at - 20°C for later use.
[0041] 4. Whole - Genome Resequencing
[0042] For the DNA samples of all experimental chickens, use the DNBSEQ sequencing platform to perform individual whole - genome resequencing according to the standard operating procedure, with a sequencing depth of approximately 15×. Use BWA and GATK software for sequence alignment and genotype extraction. After further quality control using SNP call rate and MAF, 7,498,204 SNPs and 203 individuals are obtained for subsequent analysis.
[0043] 5. Genome - Wide Association Analysis
[0044] Organize the pedigree data, phenotypic data, and genomic SNP locus data, and use GCTA software for genome - wide association analysis. The univariate mixed linear model is:
[0045] y = Xb + jα+u + e;
[0046] y is the phenotypic value; b is the fixed effect (including population effect and cage effect), X is the corresponding relationship matrix; j is the additive genotype of the SNP locus to be detected, α is the additive SNP effect; u is the random animal effect, following where G is the genomic additive relationship matrix, is the additive genetic variance; e is the residual effect following where I is the identity matrix, is the residual variance. The genome-wide FDR value was calculated using the R package qvalue, with FDR < 0.01 as the significance threshold (age at first egg P = 1.66E-05, egg weight at 44 weeks of age P = 1.87E-05). The results of the GWAS analysis are as Figure 1 and Figure 2 shown. There was a significant association between egg weight and a 1.33 Mb region on chromosome 4 (Chr4:75236136-76566458). All loci in the genome-wide association region were further verified, and the locus chr4:76007941 was locked as a candidate locus. Table 1 shows the genetic markers affecting age at first egg and egg weight at 44 weeks of age in chickens.
[0047] Table 1
[0048]
[0049] Example 2 Correlation between different genotypes at the chr4:76007941 locus and egg weight
[0050] 1. Experimental animals
[0051] Refer to Example 1.
[0052] 2. Phenotypic determination
[0053] Refer to Example 1.
[0054] 3. Extraction of genomic DNA
[0055] Refer to Example 1.
[0056] 4. Genotyping at the chr4:76007941 locus
[0057] Refer to Example 1.
[0058] 5. Determination of the dominant genotype for the phenotype
[0059] At the chr4:76007941 locus, the age at first egg of individual chickens with the GG genotype was 44.42 g, that of chickens with the GA genotype was 46.06 g, and that of chickens with the AA genotype was 49.11 g; at 44 weeks of age, the egg weight of chickens with the GG genotype was 59.14 g, that of chickens with the GA genotype was 60.85 g, and that of chickens with the AA genotype was 62.47 g. The data indicate that the AA genotype is associated with a greater egg weight advantage, while the GG genotype is associated with a smaller egg weight advantage. Table 2 shows the egg weight performance of individuals with different genotypes at the chr4:76007941 SNP locus in chickens.
[0060] Table 2
[0061]
[0062] ab: Different letters as superscripts in the same column indicate significant differences between groups (P<0.05).
[0063] Example 3 Establishment of a molecular marker detection method for the chr4:76007941 locus and its application in breeding
[0064] 1. Construction of the molecular marker detection method
[0065] Based on the DNA sequence information adjacent to the chr4:76007941 locus published in the Ensembl database, specific primers were designed and synthesized in this study for PCR amplification. The nucleotide sequence of SEQ ID NO: 1 corresponds to the region of the 76,007,941st nucleotide on chromosome 4 and 250 bases upstream and downstream from its 5'-end. SEQ ID NO: 1:
[0066] CCCAAGGAGGTTGTGGATGCCCCATCCCTGGACGCATTCAAGGCCAGGCTGGATTTTGCTCTGAGCAGCCTGGTCTAGTGATTGGCAACCCTGCACATAGCAGGGGGGTTGAAACTCGATGATCATTATGGTCCTTTTCAACCCAGGCCGTTCTATGATTCTATGATCAGCTTGCTTCCTTCAGAAAGGTGCTGCAATCACACGTTGGCACAAGGAAATGGCGTTTCTTAAGGGCATACAAATGATGGAGG / ATGTTGGAAGAG ATAAATGAAAACCTGACTCAGGATAACTTTGAAGGGACTGGGTTTTGATCCAGAAAACATAAGAACAGAGGAAGGACATGGTAACATGCTCCAGTACGTTCCAGTATTTTGAACAGTGCTATAAAAACAGTGACAATCAATTATTCTCCGTGTCCACTGGGGGTAGGATAAGAAGAACTGAACCCAATTTGCAGAAAAGAGTATTTAGGTTAGATATTAGGAAATGTTTCTAATTACGA.
[0067] The primer sequences are shown in Table 3, and the PCR amplification system and conditions are shown in Tables 4 and 5, respectively. The amplification products were analyzed by Sanger sequencing to determine the genotypes at the chr4:76007941 locus. The genotype results cover three types: AA, AG, and GG.
[0068] Table 3
[0069] Primer Name Sequence Sequence Listing Corresponding Number Forward Primer TGAGCAGCCTGGTCTAGTGA SEQ ID NO:2 Reverse Primer TCTGGATCAAAACCCAGTCC SEQ ID NO:3
[0070] Table 4
[0071] Reagent Volume (μL) <![CDATA[ddH2O]]> 8.0 2×Taq Plus Master Mix 10.0 Forward Primer (10μM) 0.5 Reverse Primer (10μM) 0.5 Genomic DNA 1.0 Total 20.0
[0072] Table 5
[0073]
[0074] 2. Selection for egg weight using the molecular marker at the chr4:76007941 locus
[0075] Using 229 individuals of Beijing Fatty Chicken as the research object, Beijing Fatty Chicken is a local breed with pink eggshells. Consumers prefer "free-range eggs" characterized by pink shells and small egg weights. Therefore, the breeding of Beijing Fatty Chicken aims to select individuals with small egg weights for cultivating new varieties and breeds with small egg weights. At 3 weeks of age, blood samples were collected from the research objects, and genomic DNA was extracted with reference to step (3) of Example 1. Specific primers were used to amplify the target site sequence, and genotype typing was performed by first-generation sequencing technology. Among the obtained genotypes, the number of individuals with the GG genotype was 188, the number of individuals with the GA genotype was 41, and no individuals with the AA genotype were detected. Based on the dominant genotype for small egg weight, GG-type individuals were preferentially selected. Subsequently, these chickens were raised until the laying period, and their first-egg weight and egg weight at 44 weeks of age were measured. The experimental results are shown in the table. The average first-egg weight of individuals with the GG genotype was 40.04 g, and the egg weight at 44 weeks of age was 51.09 g; while the average first-egg weight of individuals with the GA genotype was 41.90 g, and the egg weight at 44 weeks of age was 53.40 g. Table 6 shows the correlation between different genotypes of the chicken chr4:76007941 SNP locus and egg weight.
[0076] Table 6
[0077]
[0078] ab: Different letters in the same column as superscripts indicate significant differences between groups (P<0.05).
[0079] 3. Conclusion
[0080] The present invention has successfully identified a single nucleotide polymorphism (SNP) molecular marker chr4:76007941 related to the egg weight at first laying and the egg weight at 44 weeks of age in chickens, and constructed a corresponding molecular marker detection technology. By measuring the egg weights of individuals with different genotypes, the research results show that the AA genotype is significantly associated with a greater egg weight advantage, while the GG genotype is associated with a smaller egg weight advantage. This discovery provides a key genetic marker for chicken genetic breeding, helps to breed chicken varieties with egg weight characteristics that meet market demands. At the same time, the present invention also demonstrates the application potential of genomics technology in the field of animal breeding, providing a new perspective and methodology for the future development of genetic improvement and variety selection. Specifically, using the molecular marker at the chr4:76007941 locus for breeding significantly improves the breeding efficiency, enabling breeders to quickly identify and select chickens with target egg weight characteristics. This method not only shortens the breeding cycle but also improves the accuracy of selection, introducing new technical means to the chicken breeding field. In addition, the molecular marker detection method constructed in the present invention has advantages such as simple operation and accurate and reliable results, and is suitable for large-scale breeding practices.
[0081] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the above embodiments, those of ordinary skill in the art should understand that: modifications or equivalent replacements can still be made to the specific embodiments of the present invention, and any modification or equivalent replacement that does not depart from the spirit and scope of the present invention shall be covered by the protection scope of the claims of the present invention.
Claims
1. A SNP molecular marker associated with egg weight at the beginning and peak of egg production in chickens, characterized in that: The SNP molecular marker is the nucleotide shown at position 251 in SEQ ID NO: 1, which is A or G.
2. An application of a substance for detecting polymorphism or genotype of a SNP molecular marker, characterized in that: The application includes at least one of the following: A1) Application in the identification or auxiliary identification of egg weight traits at the beginning and peak of laying period of chickens; A2) Application in chicken breeding; A3) Application in the preparation of chicken breeding products; Wherein, the SNP molecular marker is a single nucleotide polymorphism in the chicken genome; The SNP molecular marker is the nucleotide shown at position 251 in SEQ ID NO: 1, which is A or G.
3. The use of the substance for detecting the polymorphism or genotype of a SNP molecular marker according to claim 2, characterized in that: When the SNP molecular marker is AA type, this genotype is a dominant genotype for large egg weight at the beginning and peak period; when the SNP molecular marker is GG type, this genotype is a dominant genotype for small egg weight at the beginning and peak period.
4. A primer pair for identifying individuals with high and low egg weights at the beginning and peak of egg production, characterized in that: The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 2; the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO:
3.
5. A use of the primer pair according to claim 4 for identifying individuals with high and low egg weights at the beginning and peak of egg production, characterized in that: The application includes at least one of the following: B1) Application in identification or auxiliary identification of egg weight traits at the beginning and peak of laying period of chickens; B2) Application in chicken breeding; B3) Application in the preparation of chicken breeding products.
6. A method for identifying or assisting in identifying the egg weight of a chicken during the first and peak egg laying periods, characterized in that: include: Detecting the genotype of the SNP in the chicken to be tested, when the SNP molecular marker is AA type, this genotype is the dominant genotype for large egg weight at the beginning of laying and peak period; When the SNP molecular marker is of type GG, this genotype is the dominant genotype for small egg weight at the beginning of production and at the peak period; The SNP molecular marker is the nucleotide shown at position 251 in SEQ ID NO: 1, which is A or G.
7. A method for breeding chicken lines with different egg weights at the beginning and peak of laying period, characterized in that: include: The genotype of the SNP in the tested chickens was detected, and parents with genotype AA were selected for breeding of large egg weight lines, and parents with genotype GG were selected for breeding of small egg weight lines.
8. A product, characterized in that The product contains a substance for detecting the polymorphism or genotype of a SNP molecular marker.
9. The product according to claim 8, characterized in that The product is any of the following: C1) Products for detecting single nucleotide polymorphisms or genotypes at loci associated with egg weight at the start of laying and peak periods in chickens; C2) Products that identify or assist in identifying egg weight at the start of laying and peak periods of chickens; C3) Products for chicken breeding.
Citation Information
Patent Citations
Piao chicken rumpless gene, and method, primer and kit for detecting rumpless trait of Piao Chicken
CN109295052A
Application of genetic marker related to egg short diameter in chicken genetic breeding
CN118166112A
SH3GL3 gene molecular marker primer related to egg weight character and application of SH3GL3 gene molecular marker primer
CN119265323A
Method for improving efficiencies in livestock production
US20100212031A1
Laying hen whole genome SNP chip and use thereof
WO2020062160A1