Specific identification method of alkali-resistant heteroheptaploid carassius auratus gibelio and application

Abstract

The invention relates to the technical field of fish genetic breeding, and discloses a creation method, an identification method and application of alkali-resistant heterologous heptaploid crucian carp. The characteristic that sperms and eggs of new double-triploid prussian carp are combined to form fertilized eggs is utilized, sperms of male leuciscus waleckii are integrated into eggs of female new double-triploid prussian carp in a non-subtrahend fusion mode, and a heteroheptaploid prussian carp group is created. Specific sequences of the heterogenous heptaploid carassius auratus gibelio are screened and explored, molecular marker primers are designed, breeding screening in the future is facilitated, further carbonate alkalinity stress experiments are carried out, and it is found that compared with new double-triploid carassius auratus gibelio, the alkali resistance of the heterogenous heptaploid carassius auratus gibelio is remarkably improved, and the heterogenous heptaploid carassius auratus gibelio is expected to be cultured in saline-alkali water areas.

Description

Technical Field

[0001] The present invention relates to the technical field of fish genetic breeding, and particularly relates to a method for creating, identifying and applying an alkali-tolerant allotetraploid crucian carp. Background Art

[0002] Saline-alkali waters are widely distributed globally. As an important reserve resource, the value of their development and utilization has received extensive attention. Due to the special physical and chemical properties of saline-alkali waters, such as high alkalinity, high pH value, and high ionic coefficient, their fishery productivity is low and the aquaculture varieties are single, which seriously affects the development of saline-alkali water fisheries.

[0003] However, there are still some fish species that have long adapted to inhabit and form dominant populations in many medium and high alkalinity lakes in the world. These saline-alkali tolerant fish species have important research value and development potential. Among them, the ide (Leuciscus waleckii) in Lake Dali Nur has become an excellent germplasm material for studying the evolution and molecular mechanism of fish saline-alkali adaptation due to its excellent saline-alkali tolerance. In previous studies, we obtained a new double-triploid gibel carp clone line with a "meiotic fusion-free" reproductive mode using polyploid crucian carp (Lu et al., 2023). The females of this new double-triploid gibel carp not only have the ability to produce non-reduced eggs through amitosis but also have the ability to fuse the egg nucleus and sperm nucleus to form a fertilized egg. At the same time, gibel carp has become a high-quality variety choice for fishery aquaculture in saline-alkali waters due to its advantages of strong environmental adaptability, fast growth rate, high fecundity, high feed utilization rate, strong disease resistance, and large market demand.

[0004] In this study, using the "meiotic fusion-free" reproductive mode of the females of the new double-triploid gibel carp, a set of genomes of the ide with high alkali tolerance was integrated into it, obtaining an allotetraploid crucian carp population. Specific sequences of the allotetraploid crucian carp were screened and identified, and molecular marker primers were designed. Through alkali stress experiments, it was verified that the alkali tolerance of the allotetraploid crucian carp is better than that of its maternal new double-triploid gibel carp, and it is expected to be applied to fishery aquaculture in saline-alkali waters, improving the utilization rate of saline-alkali water resources, using fishery to improve alkali, improving the environment, and promoting the sustainable development of fisheries. Summary of the Invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a specific identification method for an alkali-tolerant allotetraploid crucian carp. This method is simple and easy to implement and is suitable for modern aquaculture breeding.

[0006] Another object of the present invention is to provide an application of the specific identification method for an alkali-tolerant allotetraploid crucian carp.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A specific identification method for an alkali-resistant alloheptaploid crucian carp is to perform molecular biological detection on the alloheptaploid crucian carp to be detected by using the existing technology. As long as the DNA fragments shown in SEQ ID NO.1 and SEQ ID NO.2 are contained at the same time, the alloheptaploid crucian carp is an alkali-resistant alloheptaploid crucian carp.

[0009] The allogeneic heptaploid crucian carp to be tested is prepared by artificially inseminating and hatching sperm of male Leuciscus walleye and eggs of female neotriploid silver crucian carp, and then subjecting them to a chronic alkaline stress experiment. The experiment begins with aerated water as a blank control with 0 alkalinity, and then the alkalinity of the water body is increased at a rate of 10 mmol / L / 2d. During the experiment, the water temperature is maintained at 23±1°C and the dissolved oxygen is maintained at more than 5 mg / L. The allogeneic heptaploid crucian carp is obtained after the alkaline stress treatment is applied to the 18.5th day.

[0010] In the method described above, preferably, the molecular biological detection is PCR detection.

[0011] In the method described above, preferably, the PCR detection is a PCR detection performed after using primers designed using the DNA fragments shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0012] In the above method, preferably, the primer is:

[0013] 1F: GGCAAGGTTTTGATTCGAGGTAACGTC, 1R: AATATGGCTGAGGCCTTGCATCTCTGC and 2F: GACTGAAGTATCGTTCTTTCTATCTGGGAT, 2R: CAAGCTGGATCTCTTCTGTCCCTTTAG.

[0014] If the method described above contains only the DNA fragment shown in SEQ ID NO.1, it is determined to be the male parent, Leucissus vachelli, and if it contains only the fragment shown in SEQ ID NO.2, it is determined to be the female parent, neotriploid Carp.

[0015] The protection scope of the present invention also includes:

[0016] The above method is applied in the screening and breeding of alkali-resistant alloheptaploid crucian carp.

[0017] The alkali-resistant alloheptaploid crucian carp screened out by the above method is used in the preparation of alkali-resistant fish germplasm materials.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] By a reproductive method of "amitotic fusion", the sperm of Leuciscus waleckii with high alkali tolerance was integrated into the eggs of the new double triploid gibel carp, creating an allotetraploid crucian carp. The results of chronic alkali stress experiments showed that on the 18th day of alkali stress treatment, differences in phenotypes began to appear between the new double triploid gibel carp and the allotetraploid crucian carp. A large number of new double triploid gibel carp began to lose balance and all died after 24 hours. Under the same treatment conditions, on the 19.5th day, the allotetraploid crucian carp began to lose balance and some died after 16 hours. This indicates that due to the integration of a set of Leuciscus waleckii genomes, the alkali tolerance of the allotetraploid crucian carp has been significantly improved compared to its maternal new double triploid gibel carp.

[0020] Furthermore, the applicant screened out specific sequences to identify Leuciscus waleckii, the new double triploid gibel carp, and the allotetraploid crucian carp, with an identification accuracy rate of 100%. This method is accurate, fast, simple to operate, low in identification cost, and highly practical, and plays an important role in the genetic breeding of crucian carp and the cultivation of new alkali-tolerant strains. Brief Description of the Drawings

[0021] Figure 1 It is a flow chart for the creation of the allotetraploid crucian carp.

[0022] Figure 2 It is the flow cytometry ploidy detection results of the new double triploid gibel carp and the allotetraploid crucian carp in Example 1.

[0023] Figure 3 It is a schematic diagram of the amplification results of using the primers in Example 2 of the present invention for known species of Leuciscus waleckii, the new double triploid gibel carp, and their allotetraploid crucian carp;

[0024] In the figure, individual numbers 1-3 are Leuciscus waleckii, a specific band of 385 bp was amplified with 1F1R, and no band was amplified with 2F2R; individual numbers 4-6 are the new double triploid gibel carp, no band was amplified with 1F1R, and a specific band of 707 bp was amplified with 2F2R; individual numbers 7-9 are the allotetraploid crucian carp, a specific band of 385 bp was amplified with 1F1R, and a specific band of 707 bp was amplified with 2F2R; M represents DL2000 DNA marker.

[0025] Figure 4 It is the carbonate alkalinity stress treatment experiment and results of the new double triploid gibel carp and the allotetraploid crucian carp.

[0026] Figure 5 It is the gill tissue morphology and cell apoptosis status of the new double triploid gibel carp and the allotetraploid crucian carp at different alkalinities in the alkali stress treatment experiment.

[0027] Figure 6 It is the effect of alkalinity on the gill tissue structure of the new double triploid gibel carp and the allotetraploid crucian carp.

[0028] Figure 7 Effect of alkalinity on the apoptosis level of gill cells in new amphitriploid gibel carp and allopolyploid crucian carp Specific implementation manners

[0029] For the convenience of understanding, the technical solutions of the present invention will be described more specifically below in combination with experiments

[0030] In this embodiment, materials, reagents, instruments, etc. used are all commercially available products or can be obtained through conventional commercial channels without special instructions; the experimental methods not described in detail are all conventional techniques well known in the art, and relevant literature or standard operation procedures in the prior art can be referred to

[0031] Example 1

[0032] A method for creating alkali-tolerant allopolyploid crucian carp includes the following steps

[0033] (1) Creating allopolyploid crucian carp through a reproductive mode of amitotic fusion

[0034] Before reproduction, male Leuciscus waleckii (Institute of Hydrobiology, Chinese Academy of Sciences) and female new amphitriploid gibel carp (Lu et al., 2023) are induced to spawn. According to the ratio of 1 mL:1000 g (the dose of the spawning inducer: fish body weight), the spawning inducer is injected into the parent fish, keeping sufficient dissolved oxygen and the water temperature at 21 - 23 °C. After 8 - 10 h, check whether the parent fish spawns or ejaculates. After the parent fish spawns or ejaculates, squeeze out the eggs and semen for artificial insemination, and then hatch the fry under suitable conditions

[0035] (2) Detecting the ploidy of new amphitriploid gibel carp and allopolyploid crucian carp

[0036] Add an appropriate amount of DNA step1 one-step reagent into the sample tube. Cut the tail fin rays of the amphitriploid control group, heptaploid control group (Lu et al., 2023), new amphitriploid gibel carp and allopolyploid crucian carp to collect blood. Take an appropriate amount of blood and dissolve it in the one-step reagent to make the solution light red and transparent. Then use a flow cytometer to detect the ploidy. The results are as Figure 2 shown. By quickly detecting the total DNA content with a flow cytometer, the ploidy of the new amphitriploid gibel carp is consistent with that of the amphitriploid control group, which is 6n; the ploidy of the allopolyploid crucian carp is consistent with that of the heptaploid control group, which is 7n. In the following examples, the obtained allopolyploid crucian carp is further verified by molecular markers and alkali tolerance

[0037] Example 2

[0038] Method for molecular marker identification of allopolyploid crucian carp

[0039] (1)After screening, the applicant designed primers for the specific sequences of Leuciscus waleckii (shown as SEQ ID NO.1) and the new amphitriploid Carassius auratus gibelio (shown as SEQ ID NO.2) obtained, as follows:

[0040] The primers designed for the specific sequence of the Leuciscus waleckii genome were 1F: GGCAAGGTTTTGATTCGAGGTAACGTC and 1R: AATATGGCTGAGGCCTTGCATCTCTGC;

[0041] The primers designed for the specific sequence of the new amphitriploid Carassius auratus gibelio genome were 2F: GACTGAAGTATCGTTCTTTCTATCTGGGAT and 2R: CAAGCTGGATCTCTTCTGTCCCTTTAG.

[0042] (2)Genomic extraction:

[0043] Fin clips of Leuciscus waleckii, the new amphitriploid Carassius auratus gibelio, and the allopolyploid heptaploid Carassius auratus were respectively cut, and their genomic DNA was extracted using a DNA extraction kit. The concentration and quality of the extracted DNA were detected by NanoDrop 2000 and agarose gel electrophoresis, and it was diluted to 100 ng / μL with sterilized ddH2O and stored at -20°C for later use.

[0044] (3)PCR amplification:

[0045] The PCR amplification system was 50 μL, including 1 μL (100 ng) of template DNA; 25 μL of 2×Es Taq Master Mix polymerase; 1 μL (10 μM) of each upstream and downstream primer; and 22 μL of ddH2O.

[0046] The PCR amplification program for all primers was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 50 s, for 35 cycles; final extension at 72°C for 5 min; and the PCR amplification products were stored at 4°C.

[0047] (4)Electrophoresis pattern:

[0048] After the PCR amplification was completed, a 1.5% agarose gel was prepared for electrophoresis detection, and the results were as Figure 3As shown in the figure, only a 385bp band (shown in SEQ ID NO.1) can be amplified from Leuciscus waleckii using 1F1R, and no band can be amplified using 2F2R; no band can be amplified from the new double triploid gibel carp using 1F1R, and only a 707bp band (shown in SEQ ID NO.2) can be amplified using 2F2R; the allopolyploid heptaploid crucian carp can amplify both a 385bp band (shown in SEQ ID NO.1) using 1F1R and a 707bp band (shown in SEQ ID NO.2) using 2F2R.

[0049] Example 3:

[0050] Chronic alkali stress experiment on the allopolyploid heptaploid crucian carp created in Example 1:

[0051] For the carbonate alkalinity stress experiment, a control group of new double triploid gibel carp (NA3n) and an experimental group of allopolyploid heptaploid crucian carp (S7n) were set up. In each group, 90 uniform-sized and healthy juvenile fish (2.39±0.43g) were selected for the chronic alkali stress experiment. At the beginning of the experiment, aerated water was used as the 0 alkalinity blank control, and then the water alkalinity was increased at a rate of 10 mmol / L / 2d. During the experiment, the water temperature was maintained at 23±1°C, and the dissolved oxygen was above 5 mg / L. At the same time, a YSI multi-functional water quality analyzer was used to monitor the water temperature, salinity, dissolved oxygen, and pH every day. Ammonia nitrogen was determined by the ultraviolet spectrophotometer method, and alkalinity was determined by the acid-base titration method.

[0052] After the start of the experiment, the number of dead fish in the two groups was observed and recorded every day, and the phenotypic changes and behavioral characteristics of the fish during the treatment process were also recorded. Gill tissue samples of the fish were taken when the water alkalinity (CA) was 0 mmol / L, 20 mmol / L, 40 mmol / L, 60 mmol / L, and 85 mmol / L (the death critical point of the new double triploid gibel carp control group).

[0053] The results are as Figure 4 shown. When the alkali stress treatment reached the 18th day, phenotypic differences began to appear between the new double triploid gibel carp and the allopolyploid heptaploid crucian carp. After 12h, most of the new double triploid gibel carp lost balance and all died after 24h; under the same treatment conditions, at the 19.5th day, the allopolyploid heptaploid crucian carp began to lose balance and some died after 16h. This shows that the alkali tolerance of the allopolyploid heptaploid crucian carp is stronger than that of the new double triploid gibel carp.

[0054] Furthermore, paraffin sections were made from the gill tissues of the fish under the above 5 alkalinity treatment conditions, and the sections were subjected to HE staining and TUNEL cell apoptosis detection to detect the changes in the gill tissue structure and cell apoptosis levels of the two fish under different alkalinities.

[0055] The morphological results showed (see Figure 5 the optical microscope images in Figure 6), with the increase of alkalinity, significant changes occurred in the gill tissue structures of both groups of fish. The gill filaments became narrower and the length of the gill lamellae protrusion increased. Moreover, under the alkalinity treatment conditions, the length of the gill lamellae of the allotriploid crucian carp was greater than that of the neo-double triploid gibel carp (P < 0.001). This structural change is beneficial to increasing the gas exchange area and improving the respiratory efficiency. At the same time, when the alkalinity was 0 mmol / L, the gill tissue cells of both the neo-double triploid gibel carp and the allotriploid crucian carp were intact. With the increase of alkalinity, gill tissue damage and cell shedding occurred in both groups. Among them, the phenomenon of gill tissue cell damage and shedding in the neo-double triploid gibel carp was more serious.

[0056] In the cell apoptosis detection (see Figure 5 for the fluorescence images, Figure 7 ), when the alkalinity was 0 mmol / L, the TUNEL apoptotic signal points (green fluorescence) in the gill tissue sections of both the neo-double triploid gibel carp and the allotriploid crucian carp were fewer, and the apoptosis rate of cells was lower. When the alkalinity was 20 mmol / L, compared with that at 0 mmol / L, the apoptosis rate of cells in the neo-double triploid gibel carp increased, while the change in the apoptosis rate of cells in the allotriploid crucian carp was not significant. At this time, the apoptosis rate of cells in the neo-double triploid gibel carp was significantly higher than that in the allotriploid crucian carp (P < 0.001), reaching 4.04‰. After the alkalinity reached 40 mmol / L, the apoptotic signals in both groups increased significantly; when the alkalinity was 60 mmol / L and 85 mmol / L, significant differences occurred between the two groups, and the apoptosis rate of cells in the neo-double triploid gibel carp was significantly greater than that in the allotriploid crucian carp (P < 0.001). It shows that under the same carbonate alkalinity stress conditions, especially under the high alkalinity treatment conditions, the proportion of apoptotic cells in the gill tissue of the allotriploid crucian carp is less than that in the neo-double triploid gibel carp, and the alkali tolerance ability is stronger.

[0057] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the present invention; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention should be included within the protection scope of the present invention.

Claims

1. A specific identification method for alkali-tolerant allotetraploid crucian carp is to conduct molecular biological detection on the test allotetraploid crucian carp. As long as it contains the DNA fragments shown in SEQ ID NO.1 and SEQ ID NO.2 at the same time, it is an alkali-tolerant allotetraploid crucian carp; The test allotetraploid crucian carp is obtained by artificially inseminating and hatching the sperm of male Leuciscus waleckii and the eggs of female neo-triploid Carassius auratus gibelio, and then conducting a chronic alkali stress experiment. At the beginning of the experiment, the aerated water is used as a blank control with 0 alkalinity, and then the water alkalinity is increased at a rate of 10 mmol / L / 2d. During the experiment, the water temperature is ensured to be 23±1°C and the dissolved oxygen is above 5 mg / L. The allotetraploid crucian carp is obtained after 18.5 days of alkali stress treatment.

2. The method according to claim 1, characterized in that, The molecular biological detection is PCR detection.

3. The method according to claim 2, wherein The PCR detection is carried out by designing primers using the DNA fragments shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

4. The method according to claim 3, wherein The primers are as follows: 1F: GGCAAGGTTTTGATTCGAGGTAACGTC, 1R: AATATGGCTGAGGCCTTGCATCTCTGC and 2F: GACTGAAGTATCGTTCTTTCTATCTGGGAT, 2R: CAAGCTGGATCTCTTCTGTCCCTTTAG.

5. The method according to claim 1, wherein After detection, if it only contains the DNA fragment shown in SEQ ID NO.1, it is determined to be the male parent Leuciscus waleckii; if it only contains the fragment shown in SEQ ID NO.2, it is determined to be the female parent neo-triploid Carassius auratus gibelio.

6. Application of the method according to claim 1 in the screening and breeding of alkali-tolerant allotetraploid crucian carp.

7. Application of the alkali-tolerant allotetraploid crucian carp screened by the method according to claim 1 in the preparation of alkali-tolerant fish germplasm materials.

Images