Molecular marker related to nickel ion accumulation of wheat grains

Abstract

The invention discloses a molecular marker related to accumulation of nickel ions in wheat grains, which is characterized in that genotype data of a natural population is obtained by using the natural population constructed in the early stage of a team and adopting a Wheat Breeders 660K # imgabs0 # microarray chip identification, and the genotype data is combined with phenotype data of the nickel ion content in the grains of the natural population of wheat to carry out genome-wide association analysis (GWAS), so as to obtain the molecular marker related to accumulation of nickel ions in wheat grains. According to the invention, the fact that a quantitative trait locus (Quantitative Trait Locus, QTL) qNi.hnaas-6BL for controlling Ni ion accumulation of wheat grains exists on a long arm of a wheat 6B chromosome is identified, the qNi.hnaas-6BL is closely linked with SNP4008, the qNi.hnaas-6BL is located at the 693rd nucleotide, the 584th nucleotide and the 519th nucleotide of the 6B chromosome, and the SNP4008 has A / G polymorphism is identified. A haplotype analysis result on a population level shows that when nucleotide at the site is AA, wheat grains have relatively low nickel ion content and are favorable allelotype; when the nucleotide at the site is GG, the wheat grains have higher nickel ion content and are adverse allelotype.

Description

Technical Field

[0001] The present invention relates to the technical field of wheat molecular breeding, and more specifically, it relates to a molecular marker related to nickel ion accumulation in wheat grains and its application. Background Art

[0002] Nickel pollution in soil has become a serious global environmental problem. Research shows that high concentrations of nickel ions are carcinogenic, and long-term exposure or ingestion can increase the risk of cardiovascular diseases, lung diseases, and various cancers. Wheat, as an important staple crop for humans, provides about 20% of the energy and protein in the human diet. High concentrations of nickel ions are toxic and can inhibit key physiological processes such as seed germination, nutrient absorption, and photosynthesis, leading to a decrease in wheat yield and quality. In addition, nickel in the soil is absorbed by wheat and enters the food chain, posing a serious threat to human health. Therefore, breeding wheat varieties that can tolerate nickel stress and maintain an appropriate balance of nickel ion levels through biofortification is crucial for improving wheat yield, quality, and food safety.

[0003] Like other traits related to trace elements, the absorption and transport of nickel ions are typical quantitative traits controlled by multiple genes, showing continuous phenotypic variation in natural populations. However, so far, only 2 studies have identified a very small number of QTL loci controlling nickel ion accumulation in wheat grains, and this limited data is very limited for the identification of the main genetic loci of nickel ion accumulation in wheat grains and the screening of excellent gene dominant haplotypes. Summary of the Invention

[0004] (I) Technical Problems to be Solved

[0005] In view of the problems existing in the prior art, the present invention provides a molecular marker related to nickel ion accumulation in wheat grains to solve the technical problems mentioned in the background art.

[0006] (II) Technical Solutions

[0007] To achieve the above object, the present invention provides the following technical solution: A molecular marker related to nickel ion accumulation in wheat grains, wherein the molecular marker is SNP4008, located at nucleotide position 693,584,519 on chromosome 6BL of the wheat "Chinese Spring" reference genome;

[0008] The molecular marker is obtained by genotyping wheat SNPs using a wheat 660K gene chip and screening with the GWAS method;

[0009] The molecular marker is closely linked to the QTL locus qNi.hnaas-6BL that controls nickel ion accumulation in wheat grains, and its upstream and downstream nucleotide sequences are TACCGAGATAAACAGTGAGTGGTGGGACCCATACC[A / G]AGATATTTCTGGTCTAAATTGGCGCACGACAGTTG;

[0010] The 36th base of this nucleotide sequence has A / G polymorphism; using the SNP4008 gene typing data of the natural population and the nickel ion content data of wheat grains for haplotype analysis, it was found that at the population level, the nickel ion content in the grains of individuals with the AA genotype was significantly lower than that of individuals with the GG genotype. When this locus was of the AA genotype, the nickel ion content in wheat grains was significantly lower than that of individuals with the GG genotype, indicating that the AA genotype is the dominant haplotype controlling nickel ion accumulation in wheat grains and is a favorable allele for restricting nickel ion accumulation in wheat grains;

[0011] The molecular marker can be used for the early prediction of nickel ion content in wheat grains, providing new marker resources and applications for cultivating new wheat varieties resistant to heavy metal nickel ion stress and improving wheat biofortification breeding methods. It not only helps breeders screen germplasm resource materials resistant to heavy metal nickel ion stress, but also helps cultivate new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.

[0012] (III) Beneficial effects

[0013] Compared with the prior art, the present invention provides a molecular marker related to nickel ion accumulation in wheat grains, having the following beneficial effects:

[0014] The present application uses the genotype identification results of a high-density SNP chip and combines the genome-wide association analysis method to identify a new QTL qNi.hnaas-6BL that controls nickel ion accumulation in wheat grains and has not been reported before on chromosome 6BL, as well as a molecular marker SNP4008 closely linked to it, providing theoretical and technical support for screening wheat germplasm resource materials resistant to heavy metal nickel ion stress and cultivating new wheat varieties (lines) with stronger environmental adaptability. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is a schematic diagram showing the normal distribution of the phenotypic data of nickel ion content in the natural population in different environments in the present invention;

[0016] Figure 2 Manhattan plots and QQ-plots of genome-wide association analysis of nickel ion content in wheat grains using GLM, MLM, and FarmCPU models;

[0017] Figure 3Distribution map of different allelic genotypes and their corresponding phenotypic data of the SNP4008, a molecular marker tightly linked to the QTL locus qNi.hnaas-6BL controlling nickel ion accumulation in wheat grains, in a natural population. Detailed implementation manners

[0018] It should be noted that, without conflict, the embodiments in this application and the features in the embodiments may be combined with each other. The present invention will be described in detail below with reference to the drawings and in combination with the embodiments.

[0019] It should be pointed out that unless otherwise specified, all technical and scientific terms used in this application have the same meanings as those commonly understood by those of ordinary skill in the technical field to which this application belongs.

[0020] Example 1: Determination and statistical analysis of nickel ion content in wheat grains

[0021] (1) Sample pretreatment: Harvest mature wheat grains, dry and grind them, and then screen them using a sieve with a pore size of 0.15 mm; weigh 200 mg of whole wheat flour, put it into 8 ml of concentrated nitric acid solution, let it stand for 4 - 8 hours, and use a microwave digestion instrument for digestion according to the digestion steps of 120°C - 5 minutes, 150°C - 10 minutes, and 190°C - 20 minutes; filter the digestion solution and dilute it to 50 mL with 1% nitric acid solution for standby. After microwave digestion, the nickel ion content in wheat grains of the natural population was determined by inductively coupled plasma-mass spectrometry.

[0022] (2) All the test materials used in the present invention were provided by the Henan Academy of Agricultural Sciences. The natural population consisted of 207 wheat varieties (lines) with rich genetic backgrounds.

[0023] (3) Establishment of the standard curve: Inject the mixed standard solution into the inductively coupled plasma-mass spectrometer, measure the signal response values of nickel element and internal standard element, and draw a standard curve with the concentration of nickel element as the abscissa and the ratio of the response signal value of nickel element to the selected internal standard element as the ordinate.

[0024] (4) Determination of nickel ion content: Measured by inductively coupled plasma-mass spectrometry. Inject the blank solution and the sample solution into the inductively coupled plasma-mass spectrometer respectively, measure the signal response values of nickel element and internal standard element, obtain the concentration of nickel element in the digestion solution according to the standard curve, and repeat the measurement 3 times to obtain the nickel ion content data in wheat grains (Table 1).

[0025] (5) Data analysis of the phenotypic performance of nickel ion content in wheat grains

[0026] First, use the "lem 4" package in the R software version 4.2.2 to estimate the Best Linear Unbiased Prediction (BLUP) of each variety at two planting sites according to the method of Y = (1|Line)+(1|Loc)+(1|Rep%in%Line:Loc)+(1|Line:Loc) as one environmental data for candidate association analysis; secondly, use the "psych" package to perform descriptive statistics on the phenotypic data of natural populations in different environments. As shown in Table 1, the variation range of nickel ion content in wheat grains in different environments is from 23.46 ug / kg to 294.05 ug / kg( Figure 1 A, Table 2), and the phenotypic data of nickel ion content in natural populations under different environments all conform to the normal distribution( Figure 1 B), indicating that the wheat varieties included in this population have extensive genetic diversity and are an ideal population for subsequent GWAS analysis.

[0027] Table 1 Nickel ion content in wheat grains of natural populations in different environments

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038] Table 2 Descriptive statistics of nickel ion content data of natural populations in different environments

[0039]

[0040] 1SD, standard deviation;

[0041] 2 Kurtosis, a characteristic number representing the peak height of the probability density distribution curve at the mean

[0042] 3 Skewness, a measure of the direction and degree of skewness of the statistical data distribution, is a numerical characteristic of the degree of asymmetry of the statistical data distribution

[0043] Example 2: Genotype detection

[0044] (1) Extraction of wheat leaf genomic DNA using the CTAB (Cetyl trimethylammonium bromide) method

[0045] Take 0.5 g of fresh wheat leaves and freeze them in liquid nitrogen for 30 seconds, then grind and crush them quickly;

[0046] Add 5000 μL of CTAB extraction solution at 65°C and bathe in water for 30 min for lysis;

[0047] After cooling to room temperature, 500 μL of chloroform:isoamyl alcohol (24:1) solution was added for extraction;

[0048] Centrifuge at room temperature for 5 min (12000 rpm / min), aspirate 400 μL of supernatant and transfer to a 1.5 mL centrifuge tube;

[0049] Add an equal volume of chilled isopropanol, centrifuge for 5 min (12000 rpm / min), discard the supernatant, and obtain the DNA precipitate;

[0050] Rinse with 75% ethanol solution and 100% ethanol solution in sequence. After drying, add 200 μL of deionized water to dissolve the DNA for later use;

[0051] Pipette 2 μL of the solution and use NanoDrop TM One system for concentration and purity testing.

[0052] (2) Genotyping using SNP chips

[0053] Utilizing Wheat Breeders 660K The microarray gene chip was used to identify the genotypes of 207 varieties (lines) in the natural population. The chip is a physical chip that contains more than 630,000 specific SNP sites evenly distributed throughout the wheat genome, which can provide a sufficient number of SNP markers for genotype identification.

[0054] (3) Genotype quality control

[0055] Using the PLINK v2.0 software (https: / / www.cog-genomics.org / plink / 2.0 / ), according to the criteria that the minor allele frequency (MAF) is greater than 0.05 and the missing rate of genotype data is less than 10%, the genotype data of 207 natural population materials were quality-controlled, and a total of 224,706 effective marker loci were screened out for subsequent genome-wide association analysis.

[0056] Example 3: Identification and utilization of SNP4008 molecular marker

[0057] (1) Genome-wide association analysis

[0058] Using the GLM (general linear model), MLM (mixed linear model) and FarmCPU (fixed and random model cycle probability unified model) multi-model analysis methods respectively, combined with the phenotypic data and genotype data of the grain nickel ion content of 207 wheat varieties (lines) under multiple environmental conditions, the GAPIT analysis software was used for association analysis to identify stable genetic loci controlling the accumulation of nickel ions in wheat grains at the genome-wide level.

[0059] (2) Genetic locus identification

[0060] Under multiple environmental conditions, three analysis models jointly identified a genetic locus qNi.hnaas-6BL significantly associated with the nickel ion content in wheat grains, and obtained a SNP marker SNP4008 that was tightly linked to it under multiple environmental conditions. This locus is located at the 693,584,519th nucleotide on chromosome 6BL ( Figure 2 ).

[0061] After analysis, a genetic locus qNi.hnaas-6BL controlling the accumulation of nickel ions in wheat grains was found on chromosome 6BL. The nucleotide sequences upstream and downstream of it are shown in SEQ IN NO:1, and there is an allelic mutation of 36A-36G at the 36th base of this sequence.

[0062] (3) Application of SNP4008 molecular marker

[0063] The nucleotide sequences upstream and downstream of the marker are TACCGAGATAAACAGTGAGTGGTGGGACCCATACC[A / G]AGATATTTCTGGTCTAAATTGGCGCACGACAGTTG. There is an allelic mutation of 36A-36G at the 36th base of this sequence, resulting in nucleotide polymorphism of this sequence. Combining the phenotypic data of nickel ions in wheat grains in the natural population and the genotype data of this mutation site, haplotype analysis was carried out, and it was found that the nickel ion content in wheat grains of individuals with the AA genotype was significantly lower than that of individuals with the GG genotype (Table 3). It is shown that the AA genotype is the dominant haplotype controlling the accumulation of nickel ions in wheat grains and is a favorable allelic genotype for reducing the toxicity of nickel ions in wheat grains and enhancing the ability to tolerate heavy metal nickel ion stress. Figure 3 )

[0064] Table 3 Effects of different genotypes of SNP4008 marker on the accumulation of nickel ions in wheat grains

[0065]

[0066] 1 Number of varieties (lines) with different allelic genotypes in the natural population;

[0067] 2 Analysis of variance was used to analyze the differences in nickel ion content in wheat grains among different allelic genotype populations. P-value < 0.05 was considered a significant difference, and P-value < 0.01 was considered a highly significant difference.

[0068] Figure 2 Manhattan plots and QQ-plots of genome-wide association analysis of nickel ion content in wheat grains were carried out using GLM, MLM, and FarmCPU models. The red solid line is the threshold line of -log10P = 4. SNP loci above the threshold line are significantly associated with the nickel ion content in wheat grains; the red circle represents the SNP locus SNP4008 that was commonly identified by the three analysis models and is significantly associated with nickel ions in wheat grains.

[0069] Figure 3 Distribution map of different allelic genotypes and their corresponding phenotypic data of the tightly linked molecular marker SNP4008 of the QTL locus qNi.hnaas-6BL controlling the accumulation of nickel ions in wheat grains in the natural population. Orange represents the distribution of the BLUP value of the phenotypic data of varieties (lines) with the AA genotype, and green represents the distribution of the BLUP value of the phenotypic data of varieties (lines) with the GG genotype. The nickel ion content in wheat grains of varieties (lines) with the AA genotype is significantly lower than that of varieties (lines) with the GG genotype and is a favorable allelic genotype.

[0070] Sequence

[0071] SEQ IN NO:1

[0072] TACCGAGATAAACAGTGAGTGGTGGGACCCATACC[A / G]AGATATTTCTGGTCTAAATTGGCGCACGACAGTTG

[0073] Although embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A molecular marker associated with nickel ion accumulation in wheat grains, characterized in that: The molecular marker SNP4008 is closely linked to the QTL locus qNi.hnaas-6BL that controls the accumulation of nickel ions in wheat grains. The locus is located at the 693,584,519th nucleotide on chromosome 6B of the wheat "Chinese Spring" reference genome, and its upstream and downstream sequences are TACCGAGATAAACAGTGAGTGGT GGGACCCATACC[A / G]AGATATTTCTGGTCTAAATTGGCGCACGACAGTTG. The 36th base of the nucleotide sequence has an A / G polymorphism.

2. The molecular marker associated with nickel ion accumulation in wheat grains according to claim 1, characterized in that: Haplotype analysis was performed using the natural population SNP4008 genotyping data and wheat grain nickel ion content data. It was found that at the population level, the grain nickel ion content of individuals with AA genotype was significantly lower than that of individuals with GG genotype. When the site was AA genotype, the nickel ion content of wheat grains was significantly lower than that of individuals with GG genotype, indicating that the AA genotype is the dominant haplotype controlling nickel ions in wheat grains and is a favorable allele that limits the accumulation of nickel ions in wheat grains.

3. A molecular marker associated with nickel ion accumulation in wheat grains according to claim 2, characterized in that: It can be used for early prediction of nickel ion content in wheat grains, which is not only helpful for breeders to screen out germplasm resources resistant to heavy metal nickel ion stress, but also conducive to breeding new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.

Images