Novel anti-ITGB8 antibodies and uses thereof

Abstract

In a strategy that allows cancer cells to escape from the immune system, the presence of transforming growth factor beta (TGF-beta) in the tumor microenvironment (TME) is one of the most effective immunosuppressive mechanisms for many types of tumors. Thus, depletion of TGF-beta is considered to be a promising effective therapeutic approach against cancer regardless of the type of tumor. However, the major obstacle to achieve this is that TGF-beta belongs to a small number of cytokines that must be activated once secreted. In addition, system targeting TGF-beta is associated with severe side effects because TGF-beta can maintain homeostasis of many tissues. Therefore, selective targeting TGF-beta activation in TME appears to be a reasonable method for enhancing anti-tumor response and avoiding side effects. Integrin [alpha] v [beta] 8 expressed on Treg specifically promotes TGF-[beta] activation and attenuates anti-CD8T cell response in different cancer TME in mice and humans. The inventors have generated neutralizing monoclonal antibodies against the beta 8 chain (Itg beta 8) of alpha v beta 8 integrin that specifically bind to Treg and selectively neutralize the ability of Treg to activate TGF-beta. Thus, the present invention relates to isolated anti-Itg [beta] 8 neutralizing antibodies that specifically bind to the [beta] 8 chain (Itg [beta] 8) of the [alpha] v [beta] 8 integrin expressed on Treg, and their use for the treatment of cancer.

Description

Technical Field

[0001] The present invention relates to novel antibodies that specifically bind to the β8 chain (Itgβ8) of αvβ8 integrin, particularly the β8 chain (Itgb8) of αvβ8 integrin expressed by Treg cells. These specific antibodies can be used in cancer therapies. Background Art

[0002] The principle of tumor immunotherapy is based on the ability of the immune system to detect malignant transformation and effectively eliminate cancer cells. However, solid tumors can escape the immune system by orchestrating a microenvironment that restricts effective anti-tumor immune responses.

[0003] Transforming growth factor β (TGF-β) is considered a key cytokine promoting immunosuppression in the tumor microenvironment (Batlle and Massague, 2019). Among the three subtypes of TGF-β (TGF-β-3), TGF-β1 is prevalent in tumors (Gao et al., 2013). This polypeptide cytokine, which is highly conserved in all mammals (Shull et al., 1992), impairs many functions of effector T lymphocytes and promotes the development and stability of CD4 pos Foxp3 pos regulatory T lymphocytes (Tregs) (Marie et al., 2006). Subsequently, selective targeting of TGF-β signaling in T lymphocytes leads to the effective elimination of cancer cells by effector T lymphocytes (Gorelik and Flavell, 2001), and the neutralization of the TGF-β immunomodulatory effect is considered a promising anti-cancer therapy (Dahmani and Delisle, 2018) (Huynh et al., 2019).

[0004] However, TGF-β is one of the few cytokines secreted in an inactive form. This small latent complex consists of a mature cytokine surrounded by a latency-associated peptide (LAP), which are non-covalently bound. LAP covers all the contact sites of the mature cytokine that must interact with the TGF-β receptor complex (TGFβRI and TGFβRII) to induce TGF-β signaling, including the phosphorylation of SMAD2 / 3 (Travis and Sheppard, 2013). In solid tumors, the TGF-β latent complex can be secreted by several cell types, including cancer cells and Tregs (Batlle and Massague, 2019). However, unlike TGF-β produced by Tregs, TGF-β secreted by cancer cells has been shown to be essential for inhibiting tumor-infiltrating lymphocytes (Courau et al., 2016; Donkor et al., 2011). As long as LAP remains in close contact with the mature cytokine, the secreted latent TGF-β can be stored in the tumor microenvironment without any immunomodulatory function. Therefore, the activation of the secreted TGF-β latent complex, including biochemical modifications that will separate the LAP domain from the mature cytokine, is indispensable for the TGF-β immunomodulatory function in tumors. In addition, systemic targeting of TGF-β is associated with severe side effects because TGF-β can maintain the homeostasis of many tissues REF. Therefore, selective targeting of TGF-β activation within the tumor microenvironment (TME) seems to be a reasonable approach to enhance the anti-tumor response and avoid side effects.

[0005] Previous work by the present inventors has revealed that the β8 chain (Itgβ8) of αvβ8 integrin expressed on Tregs specifically promotes the selective activation of TGF-β in the TME and impairs anti-tumor CD8 T cell responses against different cancers in mice and humans (Lainé et al., Nature Com 2021).

[0006] Therefore, there is a need to develop drugs that specifically target Itgβ8 expressed by Tregs to restore the efficient anti-tumor CD8 T cell responses blocked by TGF-β.

[0007] Previous studies have disclosed anti-αvβ8 integrin antibodies (WO2021 / 151889; WO2022 / 057862, WO2011103490). However, these are the first antibodies generated that selectively bind to the β8 chain of Treg-specific αvβ8 integrin, i.e., the β8 chain of αvβ8 integrin anchored in the Treg membrane. SUMMARY OF THE INVENTION

[0008] The present invention relates to a neutralizing antibody against the β8 chain (Itgβ8) of αvβ8 integrin, wherein the antibody specifically binds to the β8 chain of αvβ8 integrin expressed on Tregs.

[0009] Specifically, the present invention relates to a neutralizing antibody against the β8 chain (Itgβ8) of αvβ8 integrin, comprising:

[0010] (a) a heavy chain, wherein the variable domain comprises:

[0011] - H-CDR1 having the following sequence: G-Y-T-F-T-X6-Y-X8 (SEQ ID NO:14), wherein

[0012] X6 is S or R, and X8 is T or W;

[0013] - H-CDR2 having the following sequence: I-N-P-S-S-G-Y-T (SEQ ID NO:2);

[0014] - H-CDR3 having the following sequence: A-R-X3-E-X5-X6-X7-X8-X9-X 10 - X 11 - Y-X 13 - X 14 - X 15 - X 16 - X 17 (SEQ ID NO:15), wherein X3 is A or absent, X5 is G or V, X6 is L or Y, X7 is R or Y, X8 is A or Y, X9 is W or G, X 10 is F or S, X 11 is A or S, X 13 is G or absent, X 14 is D or absent, X 15 is F or absent, X 16 is D or absent, and X 17 is Y or absent; and

[0015] (b) a light chain, wherein the variable domain comprises:

[0016] - L-CDR1 having the following sequence: X1-X2-V-X4-X5-X6, wherein X1 is Q or S, X2 is N or S, X4 is G or S, X5 is T or Y, and X6 is N or absent,

[0017] - L-CDR2 having the following sequence: X1-X2-S, wherein X1 is S or R, and X2 is A or T,

[0018] - An L-CDR3 having the following sequence: Q-Q-Y-X4-S-Y-P-X8-T (SEQ ID NO:16), where X4 is N or H, and X8 is Y or L.

[0019] Specifically, the present invention relates to a neutralizing antibody against the β8 chain (Itgβ8) of αvβ8 integrin, comprising:

[0020] (a) A heavy chain, wherein the variable domain comprises: an H-CDR1 having the sequence shown in SEQ ID NO:1 or SEQ ID NO:9; an H-CDR2 having the sequence shown in SEQ ID NO:2; and an H-CDR3 having the sequence shown in SEQ ID NO:3 or SEQ ID NO:10; and

[0021] (b) A light chain, wherein the variable domain comprises: an L-CDR1 having the sequence shown in SEQ ID NO:4 or SEQ ID NO:11; an L-CDR2 having the sequence shown as SAS or RTS; and an L-CDR3 having the sequence shown in SEQ ID NO:5 or SEQ ID NO:12.

[0022] Another aspect of the present invention relates to a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the neutralizing antibody against the β8 chain (Itgβ8) of αvβ8 integrin of the present invention. Detailed Description

[0023] The inventors of the present invention generated monoclonal antibodies against the Itgβ8 chain, which selectively neutralize the ability of Tregs to activate TGF-β. The antibodies were generated by immunizing Itgβ8-deficient mice with Tregs expressing αvβ8 integrin. Complete depletion of Itgβ8 results in severe and fatal autoimmunity (Aluwihare, P. et al., 2009), while no autoimmunity has been reported after selective Itgb8 ablation in Treg cells (Worthington, J.J. et al., 2015). Compared to currently available antibodies targeting Itgβ8, the antibodies of the present invention have, for the first time, a selective tropism for Tregs and should not be associated with autoimmune side effects.

[0024] Definition

[0025] As used herein, the term "β8 chain of αvβ8 integrin" or "Itgβ8" has its ordinary meaning in the art and refers to a transmembrane glycoprotein that specifically heterodimerizes with the α-V chain to form the αvβ8 integrin. Integrin αvβ8 can bind to a variety of extracellular matrix (ECM) proteins and is reported to be a key protein for TGF-β activation. The UniprotKB accession number of Itgβ8 is P26012.

[0026] Via its αβ8 integrin, Tregs activate the inactive TGF-β produced by cancer cells, which in turn increases the level of TGF-β signaling in effector CD8 T lymphocytes and inhibits their cytotoxic function against cancer cells. As explained by Lienart S. et al., in Science 2018, integrin αvβ8 is expressed on Tregs in vivo and exhibits a specific conformational state that appears to be unique to Tregs.

[0027] As used herein, the term "regulatory T cell" or "Treg" has its ordinary meaning in the art and refers to a specialized subset of T lymphocytes whose role is to suppress the immune response in order to maintain homeostasis and self-tolerance. Tregs have many well-recognized biomarkers known in the art. In mice, Tregs express the biomarkers Foxp3 and CD4 (CD4 pos Foxp3 pos cells). In humans, Tregs are generally defined as CD3 pos , CD4 pos , CD25 hi , Foxp3 pos and CD127 lo .

[0028] As used herein, the terms "antibody" or "immunoglobulin" have the same meaning and will be used interchangeably in the present invention. The term "antibody" as used herein refers to an immunoglobulin molecule and the immunologically active portion of an immunoglobulin molecule, i.e., a molecule that contains an antigen-binding site that immunospecifically binds an antigen. Thus, the term antibody includes not only intact antibody molecules, but also antibody fragments and variants (including derivatives) of antibodies and antibody fragments. In a native antibody, the two heavy chains are linked to each other by disulfide bonds, and each heavy chain is linked to a light chain by a disulfide bond. There are two types of light chains, lambda (λ) and kappa (κ). There are five major heavy chain classes (or isotypes), which determine the functional activity of the antibody molecule: IgM, IgD, IgG, IgA, and IgE. Each chain contains distinct sequence domains. The light chain includes two domains, a variable domain (VL) and a constant domain (CL). The heavy chain includes four domains, a variable domain (VH) and three constant domains (CH1, CH2, and CH3, collectively referred to as CH). The variable regions of both the light chain (VL) and the heavy chain (VH) determine the binding recognition and specificity for an antigen. The constant domain regions of the light chain (CL) and the heavy chain (CH) confer important biological properties such as antibody chain association, secretion, transplacental mobility, complement binding, and binding to Fc receptors (FcR). The Fv fragment is the N-terminal portion of the immunoglobulin Fab fragment and consists of the variable portions of one light chain and one heavy chain. The specificity of an antibody lies in the structural complementarity between the antibody binding site and the antigenic determinant. The antibody binding site is composed of residues mainly from the hypervariable regions or complementarity-determining regions (CDRs). Occasionally, residues from non-hypervariable regions or framework regions (FRs) can participate in the antibody binding site or affect the overall domain structure and thus affect the binding site. The complementarity-determining region or CDR refers to the amino acid sequences that together define the binding affinity and specificity of the native Fv region of a native immunoglobulin binding site. Each of the light and heavy chains of an immunoglobulin has three CDRs, named L-CDR1, L-CDR2, L-CDR3 and H-CDR1, H-CDR2, H-CDR3, respectively. Thus, the antigen binding site typically includes six CDRs, including the set of CDRs from each of the heavy and light chain V regions. The framework region (FR) refers to the amino acid sequences that are inserted between the CDRs.

[0029] In the context of the present invention, the amino acid residues of the antibodies of the present invention are numbered according to the IMGT numbering system. The IMGT unique numbering has been defined for comparing variable domains, regardless of the antigen receptor, chain type or species (Lefranc M.-P., "Unique database numbering system for immunogenetic analysis" Immunology Today, 18, 509 (1997); Lefranc M.-P., "The IMGT unique numbering for Immunoglobulins, T cell receptors and Ig-like domains" The Immunologist, 7, 132-136 (1999).; Lefranc, M.-P., Pommié, C., Ruiz, M., Giudicelli, V., Foulquier, E., Truong, L., Thouvenin-Contet, V. and Lefranc, G., "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains" Dev. Comp. Immunol., 27, 55-77 (2003)). In the IMGT unique numbering, conserved amino acids always have the same position, such as cysteine 23, tryptophan 41, hydrophobic amino acid 89, cysteine 104, phenylalanine or tryptophan 118. The IMGT unique numbering provides standardized boundaries for the framework regions (FR1-IMGT: positions 1 to 26, FR2-IMGT: 39 to 55, FR3-IMGT: 66 to 104 and FR4-IMGT: 118 to 128) and the complementarity-determining regions (CDR1-IMGT: 27 to 38, CDR2-IMGT: 56 to 65 and CDR3-IMGT: 105 to 117). If the length of CDR3-IMGT is less than 13 amino acids, gaps are generated starting from the top of the loop, in the order of 111, 112, 110, 113, 109, 114, etc. If the length of CDR3-IMGT exceeds 13 amino acids, additional positions are generated between positions 111 and 112 at the top of the CDR3-IMGT loop, in the order of 112.1, 111.1, 112.2, 111.2, 112.3, 111.3, etc.(http: / / www.imgt.org / IMGTScientificChart / Nomenclature / IMGT-FRCDRdefinition.html).

[0030] As used herein, the term "amino acid sequence" has its ordinary meaning and refers to the amino acid sequence that confers the primary structure of a protein. According to the present invention, the amino acid sequence can be modified with one, two, or three conservative amino acid substitutions without significantly losing the ability to bind to each other. "Conservative amino acid substitution" means that one amino acid can be replaced by another amino acid having a similar side chain. Families of amino acids having similar side chains have been defined in the art and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., glycine, cysteine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0031] According to the present invention, a first amino acid sequence having at least 70% identity to a second amino acid sequence means that the first sequence has 70; 71; 72; 73; 74; 75; 76; 77; 78; 79; 80; 81; 82; 83; 84; 85; 86; 87; 88; 89; 90; 91; 92; 93; 94; 95; 96; 97; 98; 99% or 100% identity to the second amino acid sequence. Amino acid sequence identity is typically determined using suitable sequence alignment algorithms and default parameters, such as BLAST P (Karlin and Altschul, 1990).

[0032] For the purposes of the present invention, "identity" is calculated by comparing two aligned sequences in a comparison window. Sequence alignment allows determination of the number of positions (nucleotides or amino acids) that are shared by the two sequences in the comparison window. Thus, the number of shared positions is divided by the total number of positions in the comparison window and multiplied by 100 to give the percentage of identity. Determination of the percentage of sequence identity can be performed manually or with the aid of well-known computer programs.

[0033] As used herein, the terms "purified" and "isolated" pertain to the antibodies of the present invention and mean that the antibody is present in the substantial absence of other biological macromolecules of the same type. The term "purified" as used herein preferably refers to an antibody that is at least 75% by weight, more preferably at least 85% by weight, even more preferably at least 95% by weight, and still more preferably at least 98% by weight, relative to the total weight of the macromolecules present.

[0034] As used herein, the term "nucleic acid molecule" has its general meaning in the art and refers to a DNA or RNA molecule.

[0035] As used herein, the term "specifically binds" means that an antibody binds only to the antigen of interest, as evaluated using the native protein present on the surface of isolated target cells (here, the β8 chain of αvβ8 integrin (Itgβ8) expressed on Tregs), and does not exhibit cross-reactivity with other antigens.

[0036] As used herein, the term "specific" or "specifically" refers to the ability of an antibody to detectably bind to an epitope presented on an antigen, such as the β8 chain of αvβ8 integrin (Itgβ8) expressed on Tregs, while having relatively little detectable reactivity with other proteins or structures (such as the β8 chain of αvβ8 integrin presented on other cell types, other proteins presented on Tregs, or those presented on other cell types). Specificity can be determined relatively by binding or competitive binding assays, using, for example, flow cytometry assays (as Figure 2 described in detail) or cell-based ELISA assays.

[0037] As used herein, the term "affinity" refers to the strength of binding of an antibody to an epitope. The affinity of an antibody is given by the dissociation constant Kd, defined as [Ab]x[Ag] / [Ab-Ag], where [Ab-Ag] is the molar concentration of the antibody-antigen complex, [Ab] is the molar concentration of unbound antibody, and [Ag] is the molar concentration of unbound antigen. The association constant Ka is defined as 1 / Kd. Preferred methods for determining the affinity of mAbs can be found in Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1988), Coligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience, N.Y., (1992, 1993) and Muller, Meth. Enzymol. 92:589-601 (1983), which are hereby incorporated by reference in their entirety. A preferred and standard method well known in the art for determining the affinity of mAbs is to use flow cytometry or cell-based ELISA assays.

[0038] As used herein, the terms "monoclonal antibody", "monoclonal Ab", "monoclonal antibody composition", "mAb", etc. refer to a preparation of antibody molecules of a single molecular composition. Monoclonal antibody compositions exhibit a single binding specificity and affinity for a particular epitope.

[0039] As used herein, the term "treatment" refers to prophylactic or preventive treatment as well as curative or disease-modifying treatment, including treatment of subjects at risk of or suspected of having a disease as well as subjects having or diagnosed with a disease or medical condition, and includes inhibition of clinical recurrence. Treatment can be administered to a subject having a medical condition or who may ultimately develop the condition to prevent, cure, delay the onset of the condition or a recurrent condition, reduce the severity of the condition or a recurrent condition, or improve one or more symptoms of the condition or a recurrent condition, or to extend the survival time of the subject beyond that expected in the absence of such treatment. A "treatment regimen" refers to a pattern of treatment of a disease, such as a dosing pattern used during treatment. A treatment regimen can include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction phase" refers to a treatment regimen (or part of a treatment regimen) used for the initial treatment of a disease. The overall goal of an induction regimen is to provide a subject with a high level of drug during the initial phase of the treatment regimen. An induction regimen can use (in whole or in part) a "loading regimen", which can include administering a greater dose of drug than that used by the physician in the maintenance regimen, administering the drug more frequently than that administered by the physician in the maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance phase" refers to a treatment regimen (or part of a treatment regimen) used to maintain a subject during the treatment of a disease, e.g., to keep the subject in remission for an extended period of time (months or years). A maintenance regimen can employ continuous therapy (e.g., administering the drug at regular time intervals, such as weekly, monthly, annually, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, relapse treatment, or treatment after reaching a specific predetermined criterion [e.g., pain, disease manifestation, etc.]).

[0040] As used herein, "therapeutically effective amount" means the minimum amount of an active agent necessary to confer a therapeutic benefit on a patient. For example, a "therapeutically effective amount of an active agent" for a patient means an amount of the active agent that induces, ameliorates, or results in an improvement in the pathological symptoms, disease progression, or physical condition associated with the disease the patient is suffering from. It should be understood that the total daily dosage of the compounds and compositions of the present invention will be determined by the attending physician within the scope of reasonable medical judgment. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the patient's age, weight, general health, sex, and diet; the time of administration, the route of administration, and the excretion rate of the particular compound employed; the duration of the treatment; drugs used in combination with or concurrently with the particular polypeptide employed; and like factors well known in the medical arts. For example, it is well known to those skilled in the art that the initial dosage of a compound is set at a level lower than the dose required to achieve the desired therapeutic effect, and then the dosage is gradually increased until the desired effect is achieved. However, the daily dosage of the product can vary within a broad range of from 0.01 to 1,000 mg per adult per day. Preferably, the composition contains 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250, and 500 mg of the active ingredient for symptomatic adjustment of the dosage administered to the patient to be treated. A medicament generally contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. The effective amount of the medicament is generally provided at a dosage level of from 0.0002 mg / kg body weight to about 100 mg / kg body weight per day.

[0041] As used herein, the term "administer" refers to the act of injecting or otherwise physically delivering a substance that exists in vitro (e.g., a nanobody or polypeptide according to the present invention) into the body of a subject, such as by mucosal, intradermal, intravenous, subcutaneous, intramuscular delivery, and / or any other physical delivery method described herein or known in the art. When treating a disease or its symptoms, the substance is generally administered after the onset of the disease or its symptoms. When preventing a disease or its symptoms, the substance is generally administered before the onset of the disease or its symptoms.

[0042] As used herein, the terms "combination therapy", "combination treatment", or "therapy combination" refer to a treatment using more than one drug. A combination therapy can be a dual therapy or a two-way therapy.

[0043] As used herein, the term "co-administer" means to administer two active ingredients simultaneously or substantially simultaneously by the same route. The term "separate administration" means to administer two active ingredients simultaneously or substantially simultaneously by different routes. The term "sequential administration" means to administer two active ingredients at different times, the route of administration being the same or different.

[0044] As used herein, the term "pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when appropriately administered to a mammal, particularly a human. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or any type of formulation aid.

[0045] 1) Antibodies of the present invention

[0046] The target sequences in this application are shown in Table 1 below:

[0047] Table 1: Sequences of the antibodies of the present invention

[0048]

[0049]

[0050] In a first aspect, the present invention relates to an isolated neutralizing antibody against the β8 chain (Itgβ8) of αvβ8 integrin, wherein the antibody specifically binds to the β8 chain of αvβ8 integrin expressed on Tregs (i.e., the β8 chain anchored in the plasma membrane of Tregs).

[0051] In a specific embodiment, the antibody of the present invention specifically binds to the β8 chain of αvβ8 integrin expressed on Tregs. According to the present invention, the term "β8 chain of αvβ8 integrin expressed on Tregs" refers to the β8 chain showing a specific conformation as demonstrated in Lienart S et al., Science 2018 (which is incorporated herein by reference).

[0052] In a specific embodiment, the antibody of the present invention specifically binds to Itgβ expressed on Tregs associated with the tumor microenvironment (TME) (i.e., TME-associated Tregs or Tregs in the TME).

[0053] In a specific embodiment, the antibody of the present invention specifically and only binds to Itgβ expressed on Tregs, particularly Itgβ expressed on Tregs associated with the TME (i.e., TME-associated Tregs or Tregs in the TME).

[0054] In a specific embodiment, the antibody of the present invention specifically binds to Itgβ expressed on Tregs, but does not bind to the β8 chain of αvβ8 integrin expressed on other cell types (such as endothelial cells, epithelial cells, fibroblasts, neurons, glial cells, and / or dendritic cells).

[0055] As used herein, the term "anti-Itgβ8 neutralizing antibody" has its ordinary meaning in the art and refers to an antibody capable of inhibiting the biological activity of Itgβ8, i.e., capable of blocking the ability of Tregs to activate TGF-β via αvβ8.

[0056] Accordingly, the present invention relates to isolated anti-Itgβ8 neutralizing antibodies, wherein the antibody specifically binds to the β8 chain of the αvβ8 integrin expressed on Tregs and inhibits the ability of Tregs to activate TGF-β via αvβ8

[0057] In another embodiment, the anti-Itgβ8 neutralizing antibody can block the interaction of the αvβ8 integrin with TGF-β.

[0058] In other words, the anti-Itgβ8 neutralizing antibody can restore the anti-cancer response of CD8 T cells by inhibiting TGF-β activation and thereby inhibiting TGF-β signaling in CD8 T cells infiltrating tumors.

[0059] Then, for the present invention, neutralizing antibodies are selected as described above for their ability to (i) bind to the β8 chain of the αvβ8 integrin expressed on Tregs, and / or (ii) inhibit TGF-β activation in Tregs (see Examples of functional assays and Figure 3 )), and / or (iii) inhibit the growth of tumor cells.

[0060] Assays for determining the ability of an antibody to bind Itgβ8 expressed on Tregs are well known to those skilled in the art. In a preferred embodiment, the antagonist specifically binds to Itgβ8 expressed on Tregs in a sufficient manner to inhibit the biological activity of αvβ8 expressed on Tregs, i.e., inhibit the activation of TGF-β. Binding to the β8 chain of the αvβ8 integrin expressed on Tregs and inhibition of the biological activity of αvβ8 expressed on Tregs can be determined by any competitive assay well known in the art. For example, the assay can consist of, for example, determining the specific ability of the antibody to bind to the β8 chain of the αvβ8 integrin expressed on Tregs by flow cytometry (see Examples and Figure 2 ). A competitive assay can then be performed to determine the ability of the agent to inhibit the biological activity of αvβ8 expressed on Tregs, as described above.

[0061] In a specific embodiment, the isolated anti-Itgβ8 neutralizing antibody of the present invention is a monoclonal antibody.

[0062] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises (a) a heavy chain, wherein the variable domain comprises:

[0063] - An H-CDR1 having the following sequence: G-Y-T-F-T-X6-Y-X8 (SEQ ID NO:14), where X6 is S or R, and X8 is T or W;

[0064] - An H-CDR2 having the following sequence: I-N-P-S-S-G-Y-T (SEQ ID NO:2);

[0065] - An H-CDR3 having the following sequence: A-R-X3-E-X5-X6-X7-X8-X9-X 10 - X 11 - Y-X 13 - X 14 - X 15 - X 16 - X 17 (SEQ ID NO:15), where X3 is A or nothing, X5 is G or V, X6 is L or Y, X7 is R or Y, X8 is A or Y, X9 is W or G, X 10 is F or S, X 11 is A or S, X 13 is G or nothing, X 14 is D or nothing, X 15 is F or nothing, X 16 is D or nothing, and X 17 is Y or nothing; and

[0066] (b) A light chain, where the variable domain contains:

[0067] - An L-CDR1 having the following sequence: X1-X2-V-X4-X5-X6, where X1 is Q or S, X2 is N or S, X4 is G or S, X5 is T or Y, and X6 is N or nothing,

[0068] - An L-CDR2 having the following sequence: X1-X2-S, where X1 is S or R, and X2 is A or T,

[0069] - An L-CDR3 having the following sequence: Q-Q-Y-X4-S-Y-P-X8-T (SEQ ID NO:16), where X4 is N or H, and X8 is Y or L.

[0070] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises:

[0071] (a) A heavy chain, where the variable domain contains: An H-CDR1 having the sequence shown in SEQ ID NO:1 or SEQ ID NO:8; An H-CDR2 having the sequence shown in SEQ ID NO:2; and An H-CDR3 having the sequence shown in SEQ ID NO:3 or SEQ ID NO:9; and

[0072] (b) Light chain, wherein the variable domain comprises: L-CDR1 having the sequence shown in SEQ ID NO:4 or SEQ ID NO:10; L-CDR2 having the sequence shown in SAS or RTS; and L-CDR3 having the sequence shown in SEQ ID NO:5 or SEQ ID NO:11.

[0073] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises:

[0074] (a) Heavy chain, wherein the variable domain comprises: H-CDR1 having the sequence shown in SEQ ID NO:1; H-CDR2 having the sequence shown in SEQ ID NO:2; and H-CDR3 having the sequence shown in SEQ ID NO:3; and

[0075] (b) Light chain, wherein the variable domain comprises: L-CDR1 having the sequence shown in SEQ ID NO:4; L-CDR2 having the sequence shown in SAS; and L-CDR3 having the sequence shown in SEQ ID NO:5 (“1G10G4 mAb or 1G10H5mAb”).

[0076] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises: (a) heavy chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ ID NO:6, and (b) light chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ IDNO:7 (“1G10G4 mAb or 1G10H5 mAb”).

[0077] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises: (a) heavy chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ ID NO:6 and comprises H-CDR1 having the sequence shown in SEQ ID NO:1; H-CDR2 having the sequence shown in SEQ ID NO:2; and H-CDR3 having the sequence shown in SEQ ID NO:3, and (b) light chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ ID NO:7 and comprises L-CDR1 having the sequence shown in SEQ ID NO:4; L-CDR2 having the sequence shown in SAS; and L-CDR3 having the sequence shown in SEQ ID NO:5. (“1G10G4 mAb or 1G10H5 mAb”).

[0078] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises or consists of: (a) a heavy chain, wherein the variable domain has the sequence as set forth in SEQ ID NO:6, and (b) a light chain, wherein the variable domain has the sequence as set forth in SEQ ID NO:7. (“1G10G4 mAb or 1G10H5 mAb”).

[0079] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises:

[0080] (a) a heavy chain, wherein the variable domain comprises: H-CDR1 having the sequence as set forth in SEQ ID NO:8; H-CDR2 having the sequence as set forth in SEQ ID NO:2; and H-CDR3 having the sequence as set forth in SEQ ID NO:9; and

[0081] (b) a light chain, wherein the variable domain comprises: L-CDR1 having the sequence as set forth in SEQ ID NO:10; L-CDR2 having the sequence as set forth in RTS; and L-CDR3 having the sequence as set forth in SEQ ID NO:11. (“9B2 mAb”).

[0082] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises: (a) a heavy chain, wherein the variable domain has at least 70% identity with the sequence as set forth in SEQ ID NO:12, and (b) a light chain, wherein the variable domain has at least 70% identity with the sequence as set forth in SEQ ID NO:13. (“9B2 mAb”).

[0083] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises: (a) a heavy chain, wherein the variable domain has at least 70% identity with the sequence as set forth in SEQ ID NO:12 and comprises H-CDR1 having the sequence as set forth in SEQ ID NO:8; H-CDR2 having the sequence as set forth in SEQ ID NO:2; and H-CDR3 having the sequence as set forth in SEQ ID NO:9, and (b) a light chain, wherein the variable domain has at least 70% identity with the sequence as set forth in SEQ ID NO:13 and comprises L-CDR1 having the sequence as set forth in SEQ ID NO:10; L-CDR2 having the sequence as set forth in RTS; and L-CDR3 having the sequence as set forth in SEQ ID NO:11. (“9B2 mAb”).

[0084] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody comprises or consists of: (a) a heavy chain, wherein the variable domain has the sequence shown in SEQ ID NO:12, and (b) a light chain, wherein the variable domain has the sequence shown in SEQ ID NO:13. (“9B2 mAb”).

[0085] Accordingly, the present invention provides antibodies comprising functional variants of VH regions, said functional variants of VH regions comprising the FRs and / or one or more CDRs of antibodies 1G10H5, 1G10G4, and 9B2. Functional variants of VH (FR or CDR) used in the context of the single-domain antibodies of the present invention still allow the antibody to retain at least a substantial proportion (at least about 50%, 60%, 70%, 80%, 90%, 95% or more) of the affinity / avidity and / or specificity / selectivity of the parental antibody (i.e., single-domain antibody Z70) and in some cases, such single-domain antibodies of the present invention may have higher affinity, selectivity and / or specificity compared to the parental single-domain antibody (or VHH). Such variants can be obtained by a number of affinity maturation protocols, including mutating the CDRs (Yang et al., J. Mol. Biol., 254, 392-403, 1995), chain shuffling (Marks et al., Bio / Technology, 10, 779-783, 1992), use of E. coli mutator strains (Low et al., J. Mol. Biol., 250, 359-368, 1996), DNA shuffling (Patten et al., Curr. Opin. Biotechnol., 8, 724-733, 1997), phage display (Thompson et al., J. Mol. Biol., 256, 77-88, 1996), and sexual PCR (Crameri et al., Nature, 391, 288-291, 1998). Vaughan et al. (supra) discuss these methods of affinity maturation. Such functional variants generally maintain significant sequence identity with the parental single-domain antibody (or VHH). The sequence of the CDR variant may differ from the CDR sequence of the parental antibody sequence by mostly conservative substitutions; for example, at least about 35%, about 50% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more (e.g., about 65-95%, such as about 92%, 93% or 94%) of the substitutions are conservative amino acid residue replacements. The sequence of the CDR variant may differ from the CDR sequence of the parental antibody sequence by mostly conservative substitutions; for example, at least 10, such as at least 9, 8, 7, 6, 5, 4, 3, 2 or 1 substitution in the variant is a conservative amino acid residue replacement. In the context of the present invention, conservative substitutions can be defined as substitutions within the amino acid classes shown below:

[0086] Aliphatic residues I, L, V, and M

[0087] Cycloalkenyl-related residues F, H, W, and Y

[0088] Hydrophobic residues A, C, F, G, H, I, L, M, R, T, V, W, and Y

[0089] Negatively charged residues D and E

[0090] Polar residues C, D, E, H, K, N, Q, R, S, and T

[0091] Positively charged residues H, K, and R

[0092] Small residues A, C, D, G, N, P, S, T, and V

[0093] Very small residues A, G, and S

[0094] Residues involved in turn formation A, C, D, E, G, H, K, N, Q, R, S, P, and T

[0095] Flexible residues Q, T, K, S, G, P, D, E, and R.

[0096] More conservative substitution groups include: valine - leucine - isoleucine, phenylalanine - tyrosine, lysine - arginine, alanine - valine, and asparagine - glutamine. Compared to the CDRs of Z70, the conservation of the variant CDRs in terms of hydrophilic / hydrophobic properties and residue weight / size is also substantially retained. The importance of the hydrophilic amino acid index in conferring the biological functions of protein interactions is generally understood in the art. It is recognized that the relative hydrophilic characteristics of amino acids contribute to the secondary structure of the resulting protein, which in turn determines the interaction of the protein with other molecules, such as enzymes, substrates, receptors, DNA, antibodies, antigens, etc. Each amino acid is assigned a hydrophilic index based on its hydrophobicity and charge characteristics, which are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5). The retention of similar residues can also or alternatively be measured by similarity scoring, such as by using the BLAST program (e.g., BLAST 2.2.8 available through NCBI, using the standard settings BLOSUM62, open gap = 1, gap extension = 1) to determine.

[0097] In some embodiments, the isolated anti - Itgβ8 neutralizing antibody of the invention is a "humanized" antibody.

[0098] According to the invention, the term "humanized antibody" refers to an antibody having a variable region framework and a constant region from a human antibody, but retaining the CDRs of a previously non - human antibody.

[0099] The humanized antibodies of the present invention can be produced by obtaining the nucleic acid sequences encoding the CDR domains as described above, constructing a humanized antibody expression vector by inserting them into an animal cell expression vector having a gene encoding (i) a heavy chain constant region identical to that of a human antibody and (ii) a light chain constant region identical to that of a human antibody, and expressing these genes by introducing the expression vector into animal cells. The humanized antibody expression vector can be of a type in which the gene encoding the antibody heavy chain and the gene encoding the antibody light chain are present on different vectors, or a type in which both genes are present on the same vector (tandem type). Considering the ease of constructing the humanized antibody expression vector, the ease of introducing it into animal cells, and the balance between the expression levels of the antibody H chain and L chain in animal cells, the tandem type humanized antibody expression vector is preferred. Examples of the tandem type humanized antibody expression vector include pKANTEX93 (WO 97 / 10354), pEE18, etc. Methods for producing humanized antibodies based on conventional recombinant DNA and gene transfection techniques are well known in the art (see, for example, Riechmann L. et al., 1988; Neuberger MS. et al., 1985). A variety of techniques known in the art can be used to humanize antibodies, including, for example, CDR grafting (EP 239,400; PCT publication WO91 / 09967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or surface remodeling (EP 592,106; EP 519,596; Padlan EA (1991); Studnicka GM et al., (1994); Roguska MA. et al., (1994)) and chain shuffling (U.S. Patent No. 5,565,332). Conventional recombinant DNA techniques for preparing such antibodies are also known (see European Patent Application EP 125023 and International Patent Application WO 96 / 02576).

[0100] In one embodiment, the isolated anti-Itgβ8 neutralizing antibody of the present invention is a chimeric antibody, particularly a chimeric mouse / human antibody.

[0101] According to the present invention, the term "chimeric antibody" refers to an antibody that comprises a VH domain and a VL domain of a non-human antibody, and a CH domain and a CL domain of a human antibody.

[0102] In some embodiments, the chimeric antibodies of the present invention can be produced by obtaining the nucleic acid sequences encoding the VL and VH domains as described above, constructing a human chimeric antibody expression vector by inserting them into an animal cell expression vector having genes encoding human antibody CH and human antibody CL, and expressing the coding sequences by introducing the expression vector into animal cells. As the CH domain of the human chimeric antibody, it can be any region belonging to human immunoglobulin, but regions of the IgG class are suitable, and any subclass belonging to the IgG class can also be used, such as IgG1, IgG2, IgG3, and IgG4. In addition, as the CL of the human chimeric antibody, it can be any region belonging to Ig, and regions of the κ class or λ class can be used. The methods for producing chimeric antibodies include conventional recombinant DNA and gene transfection techniques, which are well known in the art (see Morrison SL. et al., (1984) and patent documents US5,202,238; and US5,204,244).

[0103] In one embodiment, the isolated anti-Itgβ8 neutralizing antibody of the present invention is an antibody-binding fragment selected from the group consisting of: Fab, F(ab)’2, single-domain antibody, ScFv, Sc(Fv)2, diabody, triabody, tetrabody, unibody, minibody, maxibody, small modular immunopharmaceutical (SMIP), the minimal recognition unit composed of amino acid residues mimicking the hypervariable regions of an antibody (as an isolated complementarity-determining region (CDR)), and a fragment comprising or consisting of: VL and an amino acid sequence having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to SEQ ID NO:7 or SEQ ID NO:13 and / or VH chain and an amino acid sequence having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to SEQ ID NO:6 or SEQ ID NO:12.

[0104] In one embodiment, the isolated anti-Itgβ8 neutralizing antibody of the invention is an antigen-binding fragment comprising or consisting of: a VL and an amino acid sequence having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to SEQ ID NO:7 and / or a VH chain and an amino acid sequence having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to SEQ ID NO:6.

[0105] In one embodiment, the isolated anti-Itgβ8 neutralizing antibody of the invention is an antigen-binding fragment comprising or consisting of: a VL and an amino acid sequence having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to SEQ ID NO:12 and / or a VH chain and an amino acid sequence having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity to SEQ ID NO:13.

[0106] As used herein, the term "antigen-binding fragment" of an antibody refers to one or more fragments of a full antibody that retain the ability to specifically bind to a given antigen (e.g., the β8 chain of αvβ8 integrin expressed on T regulatory cells). The antigen-binding function of an antibody can be achieved by fragments of the full antibody. Examples of binding fragments included within the term "antigen-binding fragment" of an antibody are: Fab fragments, monovalent fragments consisting of the VL, VH, CL, and CH1 domains; Fab' fragments, monovalent fragments consisting of the VL, VH, CL, CH1 domains and a hinge region; F(ab')2 fragments, divalent fragments containing two Fab' fragments linked by a disulfide bond in the hinge region; Fd fragments consisting of the VH domain of a single arm of an antibody; single domain antibody (sdAb) fragments (Ward et al., 1989 Nature 341:544-546), which consist of a VH domain or a VL domain; and isolated complementarity determining regions (CDRs). In addition, although the two domains (VL and VH) of an Fv fragment are encoded by different genes, they can be joined together using recombinant methods by an artificial peptide linker to make them a single protein chain, where the VL and VH regions pair to form a monovalent molecule (referred to as single-chain Fv (ScFv); see, e.g., Bird et al., 1989 Science 242:423-426; and Huston et al., 1988 proc. Natl. Acad. Sci. 85:5879-5883). "dsFv" is a VH::VL heterodimer stabilized by a disulfide bond. Divalent and multivalent antibody fragments can form spontaneously by the binding of monovalent ScFv, or can be generated by coupling monovalent ScFv with a peptide linker such as the divalent sc(Fv)2. Such single-chain antibodies include one or more antigen-binding portions or fragments of an antibody. These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the utility of the fragments is screened in the same manner as for full antibodies. Monovalent antibodies are another type of antibody fragment that lacks the hinge region of an IgG4 antibody. The absence of the hinge region results in a molecule that is substantially half the size of a conventional IgG4 antibody and has a monovalent binding region rather than the divalent binding region of an IgG4 antibody. Antigen-binding fragments can be incorporated into single domain antibodies, SMIPs, megabodies, minibodies, intrabodies, diabodies, triabodies, and tetra-bodies (see, e.g., Hollinger and Hudson, 2005, Nature Biotechnology, 23, 9, 1126-1136). The terms "diabody", "triabody", or "tetrabody" refer to small antibody fragments with multivalent antigen-binding sites (2, 3, or 4), which contain a heavy chain variable domain (VH) linked to a light chain variable domain (VL) (VH-VL) in the same polypeptide chain.By using a linker that is too short to allow pairing between two domains on the same chain, these domains are forced to pair with complementary domains on the other chain and create two antigen-binding sites. The antigen-binding fragment can be incorporated into a single-chain molecule containing paired tandem Fv segments (VH-CH1-VH-CH1), which together with the complementary light chain polypeptide form a pair of antigen-binding regions (Zapata et al., 1995 Protein Eng. 8(10); 1057-1062 and U.S. Patent No. 5,641,870).

[0107] The Fab of the present invention can be obtained by treating an antibody that specifically reacts with the β8 chain of the αvβ8 integrin expressed on the T regulatory cells according to the present invention with the protease papaine. In addition, the Fab can be produced by inserting the DNA encoding the antibody Fab into a vector for a prokaryotic expression system or for a eukaryotic expression system and introducing the vector into a prokaryote or a eukaryote (if appropriate) for expressing the Fab.

[0108] The F(ab’)2 of the present invention can be obtained by treating an antibody that specifically reacts with the β8 chain of the αvβ8 integrin expressed on the T regulatory cells according to the present invention with the protease pepsin. In addition, the F(ab’)2 can be produced by binding the following Fab’ through a thioether bond or a disulfide bond.

[0109] The Fab’ of the present invention can be obtained by treating the F(ab’)2 that specifically reacts with the β8 chain of the αvβ8 integrin expressed on the T regulatory cells according to the present invention with the reducing agent dithiothreitol. In addition, the Fab’ can be produced by inserting the DNA encoding the antibody Fab’ fragment into an expression vector for a prokaryote or an expression vector for a eukaryote and introducing the vector into a prokaryote or a eukaryote (if appropriate) for its expression.

[0110] The scFv of the present invention can be produced by obtaining the cDNA encoding the VH and VL domains as described above, constructing the DNA encoding the scFv, inserting the DNA into an expression vector for a prokaryote or an expression vector for a eukaryote, and then introducing the expression vector into a prokaryote or a eukaryote (if appropriate) for expressing the scFv. To generate a humanized scFv fragment, a well-known technique called CDR grafting can be used, which includes selecting the complementarity-determining regions (CDRs) from a donor scFv fragment and grafting them onto the framework of a human scFv fragment with a known three-dimensional structure (see, for example, W098 / 45322; WO87 / 02671; US5,859,205; US5,585,089; US4,816,567; EP0173494).

[0111] Domain antibodies (dAbs) are the smallest functional binding units of antibodies (molecular weight approximately 13 kDa) and correspond to the variable regions of the antibody heavy chain (VH) or light chain (VL). More details regarding domain antibodies and methods for their production can be found in US 6,291,158; 6,582,915; 6,593,081; 6,172,197; and 6,696,245; US2004 / 0110941; EP 1433846, 0368684 and 0616640; WO 2005 / 035572, 2004 / 101790, 2004 / 081026, 2004 / 058821, 2004 / 003019 and 2003 / 002609, each of which is incorporated herein by reference in its entirety.

[0112] Unibodies are another antibody fragment technology based on the removal of the hinge region of IgG4 antibodies. The deletion of the hinge region results in a molecule that is substantially half the size of a conventional IgG4 antibody and has a monovalent binding region rather than a bivalent binding region. Additionally, because Unibodies are smaller, they may exhibit better distribution on larger solid tumors, with potentially favorable efficacy. Further details regarding Unibodies can be obtained by reference to WO 2007 / 059782, which is incorporated herein by reference in its entirety.

[0113] The isolated anti-Itgβ8 neutralizing antibody of the present invention can be of any isotype. The choice of isotype is generally guided by the desired effector function. IgG1 and IgG3 are isotypes that mediate such effector functions as ADCC or CDC, while IgG2 and IgG4 do not mediate or mediate at a lower level. Any one of the human light chain constant regions κ or λ can be used. If desired, the class of the monoclonal antibody of the present invention can be switched by known methods. Typically, class-switching techniques can be used to convert one IgG subclass to another, for example, from IgG1 to IgG2. Thus, the effector function of the monoclonal antibody of the present invention can be altered by isotype switching to, for example, IgG 1, IgG2, IgG3, IgG4, IgD, IgA, IgE or IgM antibodies for various therapeutic uses.

[0114] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody is an IgM antibody.

[0115] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody is an IgG1, IgG2, IgG3 or IgG4 antibody.

[0116] Another aspect of the present invention relates to cross-competing antibodies that cross-compete with the antibodies of the present invention for binding to the β8 chain of αvβ8 integrin expressed on T regulatory cells.

[0117] In some embodiments, the cross-competing single-domain antibodies of the invention cross-compete with an antibody comprising (a) a heavy chain having the sequence shown in SEQ ID NO:6 and (b) a light chain having the sequence shown in SEQ ID NO:7 for binding to the β8 chain of αvβ8 integrin expressed on T regulatory cells. (“1G10G4 or 1G10H5 mAb”).

[0118] In some embodiments, the cross-competing single-domain antibodies of the invention cross-compete with an antibody comprising (a) a heavy chain having the sequence shown in SEQ ID NO:12 and (b) a light chain having the sequence shown in SEQ ID NO:13 for binding to the β8 chain of v8 integrin expressed on T regulatory cells. (“9B2 mAb”).

[0119] As used herein, the term “cross-compete” refers to a single-domain antibody capable of binding to a specific region of an antigen. In the present disclosure, a “cross-competing” single-domain antibody has the ability to interfere with the binding of another single-domain antibody to an antigen in a standard competitive binding assay. According to non-limiting theory, such a single-domain antibody can bind to the same or related or neighboring (e.g., structurally similar or spatially proximate) epitopes as the single-domain antibody with which it competes. Cross-competition exists if single-domain antibody A reduces the binding of single-domain antibody B by at least 60%, specifically at least 70%, more specifically at least 80%, compared to a positive control lacking one of the single-domain antibodies, and vice versa. As will be understood by those skilled in the art, competition can be evaluated in different assay settings. One suitable assay involves the use of flow cytometry (using a flow cytometer and a fluorescently labeled cell suspension). Another possible assay for measuring cross-competition uses a cell-based ELISA method.

[0120] According to the invention, the cross-competing antibodies as described above retain the activity of the antibodies of the invention (i.e., the ability to inhibit the activation of TGF-β by Tregs through αvβ8).

[0121] In some embodiments, the cross-competing antibodies as described above retain the activity of an antibody comprising or consisting of: (a) a heavy chain having the sequence shown in SEQ ID NO:6 and (b) a light chain having the sequence shown in SEQ ID NO:7. (“1G10G4 or 1G10H5 mAb”).

[0122] In some embodiments, the cross-competing antibodies as described above retain the activity of an antibody comprising or consisting of: (a) a heavy chain having the sequence shown in SEQ ID NO:12 and (b) a light chain having the sequence shown in SEQ ID NO:13. (“9B2 mAb”).

[0123] Thus, in some embodiments, the cross-competing antibody of the invention is an anti-Itgβ8 neutralizing antibody, wherein the cross-competing antibody specifically binds to the β8 chain of αvβ8 integrin expressed on Tregs and is capable of inhibiting the ability of Tregs to activate TGF-β.

[0124] In some embodiments, the isolated anti-Itgβ8 neutralizing antibody is engineered to improve its properties.

[0125] The engineered antibodies of the invention include those in which framework residues within the VH and / or VL have been modified, e.g., to improve the properties of the antibody. Generally, such framework modifications are made to reduce the immunogenicity of the antibody. For example, one approach is to "backmutate" one or more framework residues to their corresponding germline sequences. More specifically, an antibody that has undergone somatic mutation may contain framework residues that are different from the germline sequence from which the antibody was derived. Such residues can be identified by comparing the antibody framework sequence to the germline sequence from which the antibody was derived. To restore the framework region sequences to their germline configuration, the somatic mutations can be "backmutated" to the germline sequence by, for example, site-directed mutagenesis or PCR-mediated mutagenesis. Such "backmutated" antibodies are also intended to be included within the invention. Another type of framework modification involves mutating one or more residues within the framework region or even within one or more of the CDRs to remove T cell epitopes and thereby reduce the potential immunogenicity of the antibody. This approach is also referred to as "deimmunization" and is described in more detail in U.S. Patent Publication No. 20030153043 to Carr et al.

[0126] In some embodiments, the glycosylation of the isolated anti-Itgβ8 neutralizing antibody of the invention is modified. The glycosylation can be altered, e.g., to increase the affinity of the antibody for the antigen. Such carbohydrate modifications can be achieved, for example, by altering one or more glycosylation sites within the antibody sequence. For example, one or more amino acid substitutions can be made, resulting in the elimination of one or more variable region framework glycosylation sites and thereby the elimination of glycosylation at that site. Such glycosylation can increase the affinity of the antibody for the antigen. This method is described in more detail in U.S. Patent Nos. 5,714,350 and 6,350,861 to Co et al.

[0127] In another embodiment, the isolated anti-Itgβ8 neutralizing antibody of the invention is modified to increase its biological half-life. Various methods are possible. For example, one or more of the following mutations can be introduced: T252L, T254S, T256F as described in Ward U.S. Patent No. 6,277,375. Alternatively, to increase the biological half-life, the antibody can be altered in the CH1 or CL region to contain the salvage receptor binding epitope of two loops of the CH2 domain taken from the Fc region of IgG as described in Presta et al. U.S. Patent Nos. 5,869,046 and 6,121,022. Antibodies with extended half-life and improved binding to the neonatal Fc receptor (FcRn), which is responsible for the transfer of maternal IgG to the fetus (Guyer et al., J. Immunol. 117:587 (1976) and Kim et al., J. Immunol. 24:249 (1994)), are described in US2005 / 0014934A1 (Hinton et al.). These antibodies contain an Fc region with one or more substitutions that improve the binding of the Fc region to FcRn. Such Fc variants include those having substitutions at one or more Fc region residues: 238, 256, 265, 272, 286, 303, 305, 307, 311, 312, 317, 340, 356, 360, 362, 376, 378, 380, 382, 413, 424 or 434, for example, substitution of Fc region residue 434 (U.S. Patent No. 7,371,826).

[0128] Another modification of the antibodies of the invention contemplated by the invention is pegylation. The antibody can be pegylated, for example, to increase the biological (e.g., serum) half-life of the antibody. To pegylate an antibody, the antibody or a fragment thereof is typically reacted with polyethylene glycol (PEG), such as a reactive ester or aldehyde derivative of PEG, under conditions such that one or more PEG groups are attached to the antibody or antibody fragment. Pegylation can be carried out by an acylation reaction or an alkylation reaction with a reactive PEG molecule (or a similar reactive water-soluble polymer). As used herein, the term "polyethylene glycol" is intended to include any form of PEG that has been used to derivatize other proteins, such as mono(C1-C10)alkoxy- or aryloxy-polyethylene glycol or polyethylene glycol-maleimide. In certain embodiments, the antibody to be pegylated is a deglycosylated antibody. Methods for pegylating proteins are known in the art and can be applied to the antibodies of the invention. See, for example, EP0154316 of Nishimura et al. and EP0401384 of Ishikawa et al.

[0129] Another modification of the antibodies of the present invention contemplated by the present invention is a conjugate or protein fusion of at least the antigen-binding region of the antibodies of the present invention with a serum protein, such as human serum albumin or a fragment thereof, to increase the half-life of the resulting molecule. This method is described, for example, in EP0322094 by Ballance et al. Another possibility is to fuse at least the antigen-binding region of the antibodies of the present invention with a protein capable of binding to a serum protein, such as human serum albumin, to increase the half-life of the resulting molecule. This method is described, for example, in EP 0 486 525 by Nygren et al.

[0130] Polysialylation is another technique that uses the natural polymer polysialic acid (PSA) to extend the active period and improve the stability of therapeutic peptides and proteins. PSA is a polymer of sialic acid (a sugar). When used for protein and therapeutic peptide drug delivery, polysialic acid provides a protective microenvironment for conjugation. This increases the active period of the therapeutic protein in circulation and prevents its recognition by the immune system. PSA polymers occur naturally in the human body. PSA is employed by certain bacteria that, over millions of years of evolution, use PSA to coat their cell walls. These naturally polysialylated bacteria are then able to disrupt the body's defense system by molecular mimicry. PSA is nature's ultimate stealth technology and can be readily produced in large quantities from such bacteria with predefined physical properties. Bacterial PSA is completely non-immunogenic, even when conjugated to proteins, because it is chemically identical to PSA in the human body.

[0131] Another technique involves the use of hydroxyethyl starch ("HES") derivatives linked to antibodies. HES is a modified natural polymer derived from waxy maize starch and can be metabolized by the body's enzymes. HES solutions are typically administered to replace deficient blood volume and improve the rheological properties of the blood. Hesylation of antibodies can extend the circulatory half-life by increasing the stability of the molecule and reducing renal clearance, resulting in increased biological activity. By varying different parameters, such as the molecular weight of HES, a wide range of HES-antibody conjugates can be customized.

[0132] The antibodies of the present invention are produced by any technique known in the art, such as, but not limited to, any chemical, biological, genetic or enzymatic technique, alone or in combination. Generally, the amino acid sequence of the desired sequence is known, and those skilled in the art can easily produce the antibodies by standard techniques for producing polypeptides. For example, they can use well-known solid-phase methods, preferably using commercially available peptide synthesis devices (such as those manufactured by Applied Biosystems, Foster City, California) and following the manufacturer's instructions for synthesis. Alternatively, the antibodies of the present invention can be synthesized by recombinant DNA techniques well known in the art. For example, after incorporating the DNA sequence encoding the antibody into an expression vector and introducing such a vector into a suitable eukaryotic or prokaryotic host (which will express the desired antibody), the antibody can be obtained as the DNA expression product, and then the antibody can be isolated from the host using well-known techniques.

[0133] In a specific embodiment, the anti-Itgβ8 neutralizing antibody of the present invention has been produced by an in vitro immunization method (or hybridoma technology).

[0134] As used herein, "in vitro immunization method" or "hybridoma technology" has its general meaning in the art and refers to immunizing a host animal (such as a mouse) with an antigen of interest (or immunogenic reagent), such as Tregs expressing αvβ8 according to the present invention, to elicit an appropriate and specific immune response. Normally, the mammalian immune system has established a highly specific immune response after 3 months. Then, the B cells are harvested and fused with immortalized B cancer cells (a myeloma cell) to produce a hybrid cell line called a hybridoma. Then the hybridoma is grown in culture, starting from a single live hybridoma cell that produces a monoclonal antibody each time.

[0135] In a specific embodiment, the anti-Itgβ8 neutralizing antibody of the present invention has been produced by an in vitro immunization method (or hybridoma technology) using Tregs expressing αvβ8 as the immunogenic reagent.

[0136] 2) Nucleic acids, vectors, recombinant host cells

[0137] Another object of the present invention relates to a nucleic acid molecule encoding the anti-Itgβ8 neutralizing antibody according to the present invention. More specifically, the nucleic acid molecule encodes the heavy chain and / or light chain of the anti-Itgβ8 neutralizing antibody of the present invention.

[0138] In a particular embodiment, the nucleic acid comprises a nucleic acid sequence having 70% identity to SEQ ID NO:17 and / or SEQ ID NO:18.

[0139] In certain embodiments, the nucleic acid comprises a nucleic acid sequence as set forth in SEQ ID NO:17 and / or SEQ ID NO:18.

[0140] SEQ ID NO:17>Heavy chain variable acid nucleic acid sequence 1G10G4 or 1G10H5CAGGTCCAGCTGCAGCAGTCTGGGGCTGAACTGGCAAGACCTGGTGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGCTACACGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCAGTGGTTATACTAAGTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGAGCTGAGGGATTAAGGGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA

[0141] SEQ ID NO:18>Light chain variable acid nucleic acid sequence 1G10G4 or 1G10H5

[0142] GACATTGTGATGACCCAGTCTCAAAAATTCATGTCCACATCAGTAGGAGACAGGGTCAGCGTCACCTGCAAGGCCAGTCAGAATGTGGGTACTAATGTAGCCTGGTATCAGCAGAAACCAGGGCAATCTCCTAAAGCACTGATTTACTCGGCATCCTACCGGTACAGTGGAGTCCCTGATCACTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCATCAATGTGCAGTCTGAAGACTTGGCAGAGTATTTCTGTCAGCAATATAACAGCTATCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA

[0143] In certain embodiments, the nucleic acid comprises a nucleic acid sequence having 70% identity to SEQ ID NO:19 and / or SEQ ID NO:20.

[0144] In certain embodiments, the nucleic acid comprises a nucleic acid sequence as set forth in SEQ ID NO:19 and / or SEQ ID NO:20.

[0145] SEQ ID NO:19>Heavy chain variable acid nucleic acid sequence 9B2

[0146] CAGGTCCAGCTGCAGCAGTCTGGGGCTGAACTGGCAAAACCTGGGGCCTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGGTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGACACATTAATCCTAGCAGTGGTTATACTAAGTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTGAGCAGCCTGACATATGAGGACTCTGCAGTCTATTACTGTGCAAGAGAGGTTTATTACTACGGTAGTAGCTACGGAGACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA

[0147] SEQ ID NO:20>Light chain variable acid nucleic acid sequence 9B2

[0148] CAAATTGTTCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACCATATCCTGCAGTGCCAGCTCAAGTGTAAGTTACATGTACTGGTACCAGCAGAAGCCAGGATCCTCCCCCAAACCCTGGATTTATCGCACATCCAACCTGGCTTCTGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTATCATAGTTACCCACTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAA

[0149] Typically, the nucleic acid is a DNA or RNA molecule, which can be contained in any suitable vector, such as a plasmid, cosmid, episome, artificial chromosome, phage or viral vector. As used herein, the terms "vector", "cloning vector" and "expression vector" refer to the vehicle by which a DNA or RNA sequence (e.g., a foreign gene) can be introduced into a host cell, thereby transforming the host and facilitating the expression (e.g., transcription and translation) of the introduced sequence. The terms "expression vector", "expression construct" or "expression cassette" are used interchangeably throughout the specification and mean any type of gene construct containing nucleic acid encoding a gene product, wherein part or all of the nucleic acid coding sequence is capable of being transcribed.

[0150] Accordingly, another aspect of the invention relates to a vector comprising the nucleic acid of the invention. Such a vector may comprise regulatory elements, such as promoters, enhancers, terminators, etc., to cause or direct the expression of the antibody after administration to a subject. Examples of promoters and enhancers for animal cell expression vectors include the early promoter and enhancer of SV40 (Mizukami T. et al., 1987), the LTR promoter and enhancer of Moloney murine leukemia virus (Kuwana Y et al., 1987), the promoter of immunoglobulin H chain (Mason Jo et al., 1985) and enhancer (Gillies SD et al., 1983), etc. Any expression vector for animal cells can be used as long as the gene encoding the human antibody C region can be inserted and expressed. Examples of suitable vectors include pAGE107 (Miyaji H et al., 1990), pAGE103 (Mizukami T et al., 1987), pHSG274 (Brady G et al., 1984), pKCR (O'Hare K et al., 1981), PSG1βd2-4- (Miyaji H et al., 1990), etc. Other examples of plasmids include replicating plasmids containing an origin of replication, or integrating plasmids, such as pUC, pcDNA, pBR, etc. Other examples of viral vectors include adenovirus, retrovirus, herpesvirus and AAV vectors. Such recombinant viruses can be produced by techniques known in the art, such as by transfecting packaging cells or by transient transfection with a helper plasmid or virus. Typical examples of viral packaging cells include PA317 cells, PsiCRIP cells, GPenv + cells, 293 cells, etc. Detailed protocols for producing such replication-defective recombinant viruses can be found, for example, in WO 95 / 14785, WO 96 / 22378, US 5,882,877, US 6,013,516, US 4,861,719, US 5,278,056 and WO 94 / 19478.

[0151] The choice of suitable expression vector for expressing the peptides or polypeptides of the present invention will, of course, depend on the particular host cell used and is within the skill of the ordinary artisan.

[0152] Expression requires the provision of suitable signals in the vector, such as enhancers / promoters from viral and mammalian sources, which can be used to drive the expression of the nucleic acid of interest in the host cell. Generally, the nucleic acid to be expressed is under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the cellular synthetic machinery or introduced synthetic machinery required to initiate gene-specific transcription. A nucleotide sequence is operably linked when the regulatory sequence functions in relation to the DNA encoding the protein of interest (e.g., single domain antibody). Thus, a promoter nucleotide sequence is operably linked to a given DNA sequence if the promoter nucleotide sequence directs the transcription of the sequence.

[0153] Another aspect of the present invention relates to host cells that have been transfected, infected or transformed with the nucleic acids and / or vectors according to the present invention.

[0154] The term "transformation" refers to the introduction of "foreign" (i.e., exogenous or extracellular) genes, DNA or RNA sequences into a host cell such that the host cell will express the introduced gene or sequence to produce the desired substance, usually a protein or enzyme encoded by the introduced gene or sequence. A host cell that receives and expresses the introduced DNA or RNA has been "transformed".

[0155] The nucleic acids of the present invention can be used to produce the antibodies of the present invention in a suitable expression system. The term "expression system" refers to a host cell and a compatible vector under suitable conditions, such as for expressing a protein encoded by exogenous DNA carried by the vector and introduced into the host cell. Common expression systems include Escherichia coli host cells and plasmid vectors, insect host cells and baculovirus vectors, and mammalian host cells and vectors. Other examples of host cells include, but are not limited to, prokaryotic cells (such as bacteria) and eukaryotic cells (such as yeast cells, mammalian cells, insect cells, plant cells, etc.). Specific examples include Escherichia coli, yeast of the genus Kluyveromyces or Saccharomyces, mammalian cell lines (such as Vero cells, CHO cells, 3T3 cells, COS cells, etc.), and primary or established mammalian cell cultures (such as those derived from lymphocytes, fibroblasts, embryonic cells, epithelial cells, nerve cells, adipocytes, etc.). Examples also include mouse SP2 / 0-Ag14 cells (ATCC CRL1581), mouse P3X63-Ag8.653 cells (ATCC CRL1580), CHO cells defective in the dihydrofolate reductase gene (hereinafter referred to as "DHFR gene") (Urlaub G et al.; 1980), rat YB2 / 3HL.P2.G11.16Ag.20 cells (ATCC CRL1662, hereinafter referred to as "YB2 / 0 cells"), etc. The present invention also relates to a method for producing a recombinant host cell expressing an antibody according to the present invention, the method comprising the steps of: (i) introducing the recombinant nucleic acid or vector as described above into a competent host cell in vitro or ex vivo, (ii) culturing the obtained recombinant host cell in vitro or ex vivo, and (iii) optionally, selecting cells expressing and / or secreting the antibody. Such recombinant host cells can be used to produce the antibodies of the present invention.

[0156] The antibodies of the present invention are appropriately isolated from the culture medium by conventional immunoglobulin purification procedures, such as protein A-agarose gel, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

[0157] 3) Therapeutic methods and uses

[0158] The inventors previously demonstrated that the β8 chain (Itgβ8) of αvβ8 integrin expressed on Tregs specifically promotes TGF-β activation and impairs CD8 T cell anti-cancer responses within the tumor microenvironment (TME) of different cancers in mice and humans (Lainé et al., 2021). Thus, the anti-Itgβ8 neutralizing antibodies of the present invention are particularly suitable for restoring CD8 T cell anti-cancer responses and treating cancer.

[0159] Thus, in some embodiments, the anti-Itgβ8 neutralizing antibody or fragment thereof of the invention directly binds to the β8 chain of αvβ8 expressed on Tregs and inhibits the ability of Tregs to activate TGF-β activation.

[0160] In some embodiments, the anti-Itgβ8 neutralizing antibody or fragment thereof of the invention directly binds to the β8 chain of αvβ8 integrin expressed on Tregs and restores the anti-tumor CD8 T cell response (or inhibits the inhibition of CD8 T cell activation by TGF-β).

[0161] In some embodiments, the anti-Itgβ8 neutralizing antibody or fragment thereof of the invention directly binds to the β8 chain of αvβ8 integrin expressed on Tregs and restores the anti-tumor CD8 T cell response in the TME (or inhibits the inhibition of CD8 T cell activation by TGF-β).

[0162] Accordingly, the invention also relates to the anti-Itgβ8 neutralizing antibody or fragment thereof of the invention for use in a method of activating an anti-tumor CD8 T cell response in a subject affected by cancer.

[0163] As used herein, the term "anti-tumor CD8 T cell response" has its ordinary meaning in the art and refers to the natural ability of CD8 T cells to lyse cancer cells (as disclosed in Robbins and Kawakami; 1996, Romero, 1996).

[0164] As used herein, the term "subject" denotes a mammal such as a rodent, feline, canine, and primate. Preferably, the subject according to the invention is a human. Preferably, the subject according to the invention is a human suffering from or susceptible to cancer.

[0165] In another aspect, the invention relates to a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the anti-Itgβ8 neutralizing antibody or fragment thereof of the invention.

[0166] As used herein, the term "cancer" refers to abnormal cells having the ability to grow autonomously, i.e., an abnormal condition or disease characterized by the growth of rapidly proliferating cells, which has the potential to invade or spread to other parts of the body. The term is intended to include all types of cancerous growths or carcinogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of the histopathological type or stage of invasion. The terms "cancer" or "tumor" include malignant tumors of various organ systems, such as those affecting the lung, breast, thyroid, lymph, gastrointestinal, and urogenital tracts, as well as adenocarcinomas, including malignancies such as most colon cancers, renal cell carcinomas, prostate cancers, and / or testicular tumors, glioblastomas, non-small cell lung cancers, small intestine cancers, and esophageal cancers.

[0167] As used herein, the term "cancer" has its ordinary meaning in the art and includes, but is not limited to, solid tumors and hematogenous tumors. The term cancer includes diseases of the skin, tissue, organ, bone, cartilage, blood, and blood vessels. The term "cancer" also includes primary and metastatic cancers. Examples of cancers include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testicle, tongue, or uterus.

[0168] In certain embodiments, the cancer is selected from the group consisting of but not limited to: head and neck squamous cell carcinoma (HNSCC); adrenocortical carcinoma; anal cancer; periportal cancer; distal bile duct carcinoma; intrahepatic bile duct carcinoma; osteoblastoma; osteochondroma; hemangioma; chondromyxoid fibroma; astrocytoma; ductal carcinoma in situ; gynecomastia; endometrial adenocarcinoma; adenocanthoma; papillary serous adenocarcinoma; laryngeal and hypopharyngeal cancer; hemangioma, hepatic adenoma; focal nodular hyperplasia; small cell lung cancer; non-small cell lung cancer; mesothelioma, plasmacytoma; olfactory neuroblastoma; midline granulomatous tumor; nasopharyngeal cancer; oral and oropharyngeal cancer, ovarian cancer; pancreatic cancer; penile cancer; pituitary cancer; prostate cancer; salivary gland cancer; non-melanoma skin cancer; gastric cancer, testicular cancer; thymic cancer; follicular carcinoma; anaplastic carcinoma; poorly differentiated carcinoma; medullary thyroid carcinoma; vaginal cancer, vulvar cancer, uterine leiomyosarcoma; malignant bladder tumor; carcinoma; carcinoma, undifferentiated; giant cell carcinoma and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; adenocarcinoma, familial adenomatous polyposis; solid carcinoma; malignant carcinoid tumor; bronchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; eosinophilic carcinoma; eosinophilic adenocarcinoma; basophilic carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenocortical carcinoma; endometrioid carcinoma; skin adnexal carcinoma; apocrine adenocarcinoma; sebaceous gland carcinoma; cerumen; adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary carcinoma; invasive lobular carcinoma; lobular carcinoma in situ; lobular carcinoma; inflammatory carcinoma; Paget's disease, of the breast; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w / squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; and malignant roblastoma; Sertoli cell carcinoma; malignant leydig cell tumor; malignant liposarcoma; malignant paraganglioma; glioma; medulloblastoma; schwannoma; germ cell tumor; craniopharyngioma; malignant extrapulmonary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant congenital nevus; epithelioid cell melanoma; malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma;Alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; Müllerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymoma; malignant Brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma; malignant struma ovarii; choriocarcinoma; invasive mole; malignant mesonephroma; angiosarcoma; malignant hemangioendothelioma; Kaposi sarcoma; malignant hemangiopericytoma; lymphangiosarcoma; osteosarcoma; parosteal osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing sarcoma; malignant odontogenic tumor; ameloblastic odontosarcoma; malignant ameloblastoma; ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma multiforme; oligodendroglioma; oligoastrocytoma; primitive neuroectodermal tumor; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant schwannoma; malignant granular cell tumor; malignant lymphoma; Hodgkin disease; Hodgkin lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, diffuse large cell; malignant follicular lymphoma; mycosis fungoides; other specified non-Hodgkin lymphoma; Sézary syndrome; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryocytic leukemia; myelosarcoma; and hairy cell leukemia.

[0169] In some embodiments, the cancer is a solid cancer.

[0170] In preferred embodiments, the cancer is selected from the group consisting of glioma, thyroid cancer, colorectal cancer, head and neck cancer, gastric cancer, liver cancer, pancreatic cancer, kidney cancer, ovarian cancer, laryngeal squamous cell carcinoma, lung cancer, prostate cancer, cervical cancer, testicular cancer, endometrial cancer, breast cancer, and melanoma.

[0171] In more preferred embodiments, the cancer is breast cancer or melanoma.

[0172] In some embodiments, the anti-Itgβ8 neutralizing antibody or fragment thereof of the invention can be administered in combination with an anti-cancer therapy.

[0173] As used herein, the term "anti-cancer therapy" has its ordinary meaning in the art and refers to any natural or synthetic compound used to treat cancer.

[0174] In certain embodiments, classical therapy refers to radiotherapy, antibody therapy, or chemotherapy.

[0175] As used herein, the term "chemotherapeutic agent" refers to a compound that is effective in inhibiting tumor growth. Examples of chemotherapeutic agents include multi-kinase inhibitors such as sorafenib and sunitinib, alkylating agents such as thiotepa and cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including hexamethylmelamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its synthetic analogues adozelesin, carzelesin, and bizelesin); cryptophycins (especially cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including synthetic analogues, KW-2189 and CB1-TMI); eleutherobin; pancratistatin; sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, nitrogen mustard oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics such as enediyne antibiotics (e.g., calicheamicin, especially calicheamicin (11 and calicheamicin 211, see, e.g., Agnew Chem Intl. Ed. Engl.33:183-186(1994); dynemicin, including dynemicin A; esperamicin; and neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycins, authramycin, diazo serine, bleomycin, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyano-morpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxy-doxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycin, mycophenolic acid, nocardicin, olivomycin, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptozotocin, streptothricin, bestrabucil, bisantrene, edatraxate, defo famine, colchicine, elesclomol, elfornithine, eliptinium acetate, epothilone, etoglucid, gallium nitrate, hydroxyurea, lentinan, lonidamine, maytansine alkaloids such as maytansine and ansamitocin, mitoguazone, mitoxantrone, mopidamol, nitracrine, pentostatin, phenamet, pirarubicin, podophyllic acid, 2-ethylhydrazide, procarbazine;. Razoxane; Rhizoxin; Sizofiran; Spirogermanium; Alternariol; Triaziquone; 2,2',2"-Trichloroethylamine; Trichothecenes (especially T-2 toxin, Verracurin A, Baccharin A and Anguidine); Urethane; Vinzolidine; Dacarbazine; Mannomustine; Dibromomannitol; Dibromodulcitol; Pipobroman; Gacytosine; Cytarabine ("Ara-C"); Cyclophosphamide; Thiotepa; Taxanes, such as Paclitaxel( Bristol-Myers Squibb Oncology, Princeton, N.J.) and Docetaxel( Rhone-Poulenc Rorer, Antony, France); Chlorambucil; Gemcitabine; 6-Thioguanine; Mercaptopurine; Methotrexate; Platinum analogs, such as Cisplatin and Carboplatin; Vinblastine; Platinum; Etoposide (VP-16); Ifosfamide; Mitomycin C; Mitoxantrone; Vincristine; Vinorelbine; Navelbine; Mitoxantrone; Teniposide; Daunorubicin; Aminopterin; Xeloda; Ibandronate; CPT-11; Topoisomerase inhibitor RFS2000; Difluoromethylornithine (DMFO); Tretinoin; Capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. The definition also includes antihormonal agents for regulating or suppressing the action of hormones on tumors, such as antiestrogens, including, for example, Tamoxifen, Raloxifene, Aromatase inhibitor 4(5)-Imidazole, 4-Hydroxytamoxifen, Toremifene, Keoxifene, LY117018, Onapristone and Toremifene (Fareston); and antiandrogens, such as Flutamide, Nilutamide, Bicalutamide, Leuprolide and Goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above.

[0176] As used herein, the term "radiation therapy" has its ordinary meaning in the art and refers to the treatment of cancer with ionizing radiation. The energy deposited by ionizing radiation damages or destroys cells by disrupting the genetic material of the cells in the treatment area (target tissue), rendering these cells unable to continue growing. One commonly used type of radiation therapy involves photons, such as X-rays. Depending on the amount of energy they possess, the rays can be used to destroy cancer cells on the body surface or deep within the body. The higher the energy of the X-ray beam, the deeper the X-rays can penetrate into the target tissue. Linear accelerators and betatrons generate X-rays with increasing energy. Focusing radiation (such as X-rays) on the cancer site using a machine is called external beam radiation therapy. Gamma rays are another form of photons used in radiation therapy. Gamma rays are spontaneously generated due to the release of radiation when certain elements (such as radium, uranium, and cobalt 60) decompose or decay. In some embodiments, the radiation therapy is external radiation therapy. Examples of external radiation therapy include, but are not limited to, conventional external beam radiation therapy; three-dimensional conformal radiation therapy (3D-CRT), which delivers shaped beams from different directions to closely fit the shape of the tumor; intensity-modulated radiation therapy (IMRT), such as helical tomotherapy, which shapes the radiation beam to closely fit the shape of the tumor and also varies the radiation dose according to the shape of the tumor; conformal proton beam radiation therapy; image-guided radiation therapy (IGRT), which combines scanning and radiation techniques to provide real-time images of the tumor to guide radiation treatment; intraoperative radiation therapy (IORT), which delivers radiation directly to the tumor during surgery; stereotactic radiosurgery, which delivers a large, precise radiation dose to a small tumor area in a single treatment session; hyperfractionated radiation therapy, such as continuous hyperfractionated accelerated radiotherapy (CHART), in which the subject is given more than one radiation therapy treatment (fractions) per day; and hypofractionated radiation therapy, in which a larger dose of radiation therapy is given per fraction, but with fewer fractions.

[0177] As used herein, the term "immune checkpoint inhibitor" refers to a molecule that fully or partially reduces, inhibits, interferes with, or modulates one or more immune checkpoint proteins.

[0178] As used herein, the term "immune checkpoint protein" has its ordinary meaning in the art and refers to a molecule expressed by T lymphocytes, in which either upregulates signals (stimulatory checkpoint molecules) or downregulates signals (inhibitory checkpoint molecules).

[0179] Examples of stimulatory checkpoints include CD27, CD28, CD40, CD122, CD137, OX40, GITR, and ICOS. Examples of inhibitory checkpoint molecules include A2AR, B7-H3, B7-H4, BTLA, CTLA-4, CD277, IDO, KIR, PD-1, PD-L1, LAG-3, TIM-3, and VISTA.

[0180] The compounds used in combination with the treatment methods of the present invention are administered and dosed in accordance with good medical practice, taking into account the clinical condition of the individual subject, the site and method of administration, the dosing schedule, the age, sex, and weight of the patient, and other factors known to the physician. Thus, a pharmaceutically "effective amount" for the purposes herein is determined by factors known in the art. This amount must be effective to achieve an improvement, including but not limited to increased survival rate or faster recovery, or improvement or elimination of symptoms and other metrics (such as appropriate measurement criteria selected by those skilled in the art).

[0181] 4) Pharmaceutical compositions of the present invention:

[0182] The anti-Itgβ8 neutralizing antibody or fragment thereof of the present invention as described above can be combined with a pharmaceutically acceptable excipient and an optional sustained-release matrix such as a biodegradable polymer to form a therapeutic composition.

[0183] Accordingly, the present invention relates to a pharmaceutical composition comprising i) an anti-Itgβ8 neutralizing antibody or fragment thereof according to the present invention, and ii) a pharmaceutically acceptable carrier.

[0184] The present invention also relates to a pharmaceutical composition for preventing or treating cancer, comprising i) an anti-Itgβ8 neutralizing antibody or fragment thereof according to the present invention, and ii) a pharmaceutically acceptable carrier.

[0185] In a therapeutic application, the composition is administered to a patient already suffering from the disease in an amount sufficient to cure or at least partially arrest the disease symptoms and their complications. The appropriate dose of the pharmaceutical composition can be determined according to any of several well-established protocols. For example, animal studies (e.g., on mice or rats) are typically used to determine the maximum tolerated dose of the bioactive agent per kilogram of body weight. Generally, at least one species of test animal is a mammal. The results of the animal studies can be extrapolated to determine the dose for other species (e.g., humans). The composition of the effective dose also depends on the nature and severity of the disease or condition, and the overall health of the patient.

[0186] In a therapeutic treatment, the antagonist contained in the pharmaceutical composition can be administered in several doses or a single dose until the desired response is achieved. The treatment is typically monitored, and repeated doses are administered as needed.

[0187] The daily dose of the product can vary within a broad range of 0.01 - 1,000 mg per adult per day. Preferably, the composition contains 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250, and 500 mg of the active ingredient for symptomatic adjustment of the dose administered to the patient to be treated. The medicament generally contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. The effective amount of the medicament is generally provided at a dosage level of from 0.0002 mg / kg to about 20 mg / kg body weight per day, especially at about 0.001 mg / kg to 10 mg / kg body weight per day. However, it should be understood that the specific dosage level and frequency of administration for any particular patient may vary and will depend on a variety of factors, including the activity of the specific compound employed, metabolic stability, and duration of action of that compound, age, body weight, general health status, sex, diet, mode and time of administration, rate of excretion, drug combination, severity of the particular disorder, and the host undergoing the therapy.

[0188] In the pharmaceutical compositions of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, topical, or rectal administration, the active ingredient can be administered to animals and humans alone or in combination with another active ingredient in unit dosage form (as a mixture with a conventional pharmaceutical carrier). Suitable unit dosage forms include forms for oral administration, such as tablets, gel capsules, powders, granules, and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subcutaneous, transdermal, intrathecal, and intranasal administration forms, and rectal administration forms.

[0189] Suitable unit dosage forms include forms for oral administration, such as tablets, gelatin capsules, powders, granules, and solutions or suspensions for oral use, forms for sublingual and buccal administration, aerosols, implants, forms for subcutaneous, intramuscular, intravenous, intranasal, or intraocular administration, and forms for rectal administration. Description of the Drawings

[0190] The present invention will be further illustrated by the following drawings and examples. However, these examples and drawings should not be construed in any way as limiting the scope of the present invention.

[0191] Figure 1 : Itgβ8 is mainly expressed on Tregs in the TME of mice and humans.

[0192] (A-F) Melanoma cells (B16) or breast cancer cells (E0771) were injected into Itgβ8-td-Tomato reporter mice in the dermis or mammary gland, respectively. After 18 days, the tumors were analyzed by flow cytometry. The percentages of gated populations are mentioned on dot plots and count plots. A) Representative plots illustrate the expression of Itgβ8-tdTomato in tumors. B) Shows the percentages of Itgβ8 pos cells in the hematopoietic compartment (CD45 neg ) and non-hematopoietic compartment (CD45 pos ) in five respective tumors. C, E) Representative contour plots showing the proportions of CD3 pos cells in Itgβ8-td-Tomato pos CD45 pos cells and CD4 pos Foxp3 pos (Treg) in Itgβ8-td-Tomato pos T cells. D-F) Histograms represent the average percentage of T cells in Itgβ8-tdTomato pos CD45 pos cells and the percentage of Treg in Itgβ8-td-Tomato pos T cells in five respective tumors. G) Transcriptome analysis from single-cell RNAseq data obtained from T cell-infiltrated human non-small cell lung cancer and human hepatocellular carcinoma. DimPlot and pie charts show the proportions of Foxp3 neg negative and Itgβ8-expressing cells in Foxp3 pos T cells for each dataset of different tumors.

[0193] Figure 2 : Anti-Itgβ antibody specificity.

[0194] The specificity of antibody binding was tested by flow cytometry. Itgb8-deficient mice were immunized with Tregs expressing Itgb8. Clones were isolated and their supernatants were tested by ELISA. Mouse lymph node (LN) cells were incubated with the supernatant of the primary isolated clone positive in ELISA. A conjugated secondary antibody against IgM was used to reveal clone binding. Histograms show the ability of the antibody to bind Itgβ8 pos vs. Itgβ8 neg Tregs. Controls correspond to the secondary antibody alone.

[0195] Figure 3 : Anti-itgβ8 antibody function.

[0196] The reporter cells of TGF-β-activated TLMC were incubated with active TGF-β1 (TGFβ1*), the supernatant of Treg cultures (+) for 24 h, with or without inactive TGF-β1 and in the presence of clone supernatants (9B2, 1G10G4, 1G10H5) or control medium (control). Culture conditions without Treg were annotated as (-). The graph illustrates the levels of bioactive TGF-β1 using the TGF-β-activated TLMC reporter system.

[0197] Example:

[0198] Materials & Methods

[0199] Antibody generation

[0200] Itgβ8-deficient mice were immunized with Tregs expressing Itgβ8. The inventors previously demonstrated that Itgβ8 is highly expressed on Tregs ( Figure 1 ). Two million cells were injected subcutaneously in complete Freund's adjuvant. After 45 days, the mice were challenged again in the same manner. Three months after the first injection, spleens were harvested and B cell hybridomas were established and cloned. The supernatants of the hybridoma clones were tested by ELISA with recombinant mouse Itgβ8. Five clones produced antibodies that recognize Itgβ8.

[0201] Specificity of the antibody

[0202] To demonstrate the specificity of the five clones for Itgβ8 expressed on Tregs, each supernatant was incubated with cells from Itgβ8 Dt-Tomato reporter, Foxp3 GFP mouse lymph nodes (as Figure 1 shown). Cells were analyzed by flow cytometry. Binding was revealed with anti-IgM mouse antibody. Apparently, the antibodies from clones 1, 3, and 5 showed specific binding to Treg cells (Foxp3 GFP-positive) expressing Itgβ8 (DtTomato-positive).

[0203] Epitope mapping

[0204] The CDR3 and frameworks of the antibodies were sequenced. Based on the antibody sequences, epitope mapping was established using AlphaFold v2.1.0. The binding sequences were confirmed to be located in the extracellular domain of the Itgβ8 protein. Epitope binding was confirmed to be 100% homologous between mouse and human Itgβ8.

[0205] Functionality

[0206] In vitro functional tests confirmed the ability of the antibody to block TGF-β1 activation by Tregs. Purified Tregs from draining lymph nodes were incubated with RPMI complete medium in the presence of inactive TGF-β1 (R&D system) at no more than 10 ng / mL for 24 h. Then, the supernatant of the Treg culture was applied to a reporter cell line for active TGF-β (TLMC, as disclosed by Lainé et al., 2021, which contains the PAI1 promoter followed by luciferase) and maintained for 24 h. Luciferase activity was measured and expressed in arbitrary units. Activated TGF-β1 (R&D system) was used as a positive control.

[0207] Results:

[0208] We generated monoclonal antibodies against Itgβ8 that selectively neutralize the ability of Tregs to activate TGF-β in the TME. Antibodies were generated by immunizing Itgb8-deficient mice with Tregs expressing Itgb8. Among the 5 clones generated, clones 1, 3, and 5 showed specific binding to Treg cells expressing Itgβ8 (Foxp3GFP positive) ( Figure 2 ). These clones were selected and named 9B2, 1G10G4, and 1G10G5, respectively.

[0209] Then, the ability of these antibodies to block TGF-β1 activation by Tregs was analyzed and confirmed ( Figure 3 ).

[0210] Our initial analysis of a fresh human colon tumor revealed specific binding of the clones to Treg cells (CD3pos CD4pos CD25pos Foxp3pos CD127neg) compared to other cells in the tumor microenvironment (data not shown). Notably, no binding to human blood Treg cells was observed, indicating specificity for Treg cells in the tumor microenvironment (data not shown). This observation is consistent with previous work that revealed weaker expression of the Itgb8 chain on human Treg cells in blood compared to tumors. (Plitas G et al., 2016)

[0211] Conclusions:

[0212] In summary, the generated antibodies selectively bind to Itgβ8 of Tregs. Their binding sites are conserved between mice and humans and are located in the extracellular domain of the protein. As expected, the sequences recognized by the antibodies are largely conformational and are located in the same conformational region of the protein. The antibodies are endowed with the ability to block the ability of Itgβ8 of Tregs to activate TGF-β1 and should therefore prevent tumor growth by activating the CD8 T cell anti-tumor immune response. In fact, it has previously been demonstrated that the β8 chain (Itgβ8) of the αvβ8 integrin expressed on Tregs specifically promotes TGF-β activation and impairs the anti-CD8 T cell response within the tumor microenvironment (TME) of different cancers in mice and humans (Lainé et al., Nature Com, 2017).

[0213] This unique specificity of Treg cells for ITGβ8 makes the antibodies developed herein an effective tool for curing cancer and any condition associated with the ability of Tregs to activate TGF-β.

[0214] References:

[0215] Throughout the application, various references describe the state of the art to which the present invention pertains. The disclosures of these references are incorporated herein by reference.

[0216] Batlle E, Massagué J. Transforming Growth Factor-β Signaling in Immunity and Cancer. Immunity. 2019 Apr 16;50(4):924-940.

[0217] Gao B, Sun W, Wang X, Jia X, Ma B, Chang Y, Zhang W, Xue D. Whole genome expression profiling and screening for differentially expressed cytokine genes in human bone marrow endothelial cells treated with humoral inhibitors in liver cirrhosis. Int J Mol Med. 2013 Nov;32(5):1204-14.

[0218] Shull MM, Ormsby I, Kier AB, Pawlowski S, Diebold RJ, Yin M, Allen R, Sidman C, Proetzel G, Calvin D, et al. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature. 1992 Oct 22; 359(6397): 693-9.

[0219] Marie JC, Liggitt D, Rudensky AY. Cellular mechanisms of fatal early-onset autoimmunity in mice with the T cell-specific targeting of transforming growth factor-beta receptor. Immunity. 2006 Sep; 25(3): 441-54.

[0220] Gorelik L, Flavell RA. Immune-mediated eradication of tumors through the blockade of transforming growth factor-beta signaling in T cells. Nat Med. 2001 Oct; 7(10): 1118-22.

[0221] Dahmani A, Delisle JS. TGF-β in T Cell Biology: Implications for Cancer Immunotherapy. Cancers (Basel). 2018 Jun 11; 10(6): 194.

[0222] Huynh LK, Hipolito CJ, Ten Dijke P. A Perspective on the Development of TGF-β Inhibitors for Cancer Treatment. Biomolecules. 2019 Nov 17; 9(11): 743.

[0223] Travis MA, Sheppard D. TGF-β activation and function in immunity. Annu Rev Immunol. 2014;32:51-82.

[0224] Courau T, Nehar-Belaid D, Florez L, Levacher B, Vazquez T, Brimaud F, Bellier B, Klatzmann D. TGF-β and VEGF cooperatively control the immunotolerant tumor environment and the efficacy of cancer immunotherapies. JCI Insight. 2016 Jun 16;1(9):e85974.

[0225] Donkor MK, Sarkar A, Savage PA, Franklin RA, Johnson LK, Jungbluth AA, Allison JP, Li MO. T cell surveillance of oncogene-induced prostate cancer is impeded by T cell-derived TGF-β1 cytokine. Immunity. 2011 Jul 22;35(1):123-34.

[0226] Lainé, A., Labiad, O., Hernandez-Vargas, H. et al. Regulatory T cells promote cancer immune-escape through integrin αvβ8-mediated TGF-β activation. Nat Commun 12, 6228 (2021).

[0227] Liénart S, Merceron R, Vanderaa C, Lambert F, Colau D, Stockis J, van der Woning B, De Haard H, Saunders M, Coulie PG, Savvides SN, Lucas S. Structural basis of latent TGF-β1 presentation and activation by GARP on human regulatory T cells. Science. 2018 Nov 23;362(6417):952-956.

[0228] Aluwihare, P., Mu, Z., Zhao, Z., Yu, D., Weinreb, P. H., Horan, G. S., Violette, S. M., and Munger, J. S. (2009). Mice that lack activity of alphavbeta6- and alphavbeta8-integrins reproduce the abnormalities of Tgfb1- and Tgfb3-null mice. J Cell Sci 122, 227-232.

[0229] Worthington, J. J., Kelly, A., Smedley, C., Bauche, D., Campbell, S., Marie, J. C., and Travis, M. A. (2015). Integrin alphavbeta8-Mediated TGF-beta Activation by Effector Regulatory T Cells Is Essential for Suppression of T-Cell-Mediated Inflammation. Immunity 42, 903-915.

[0230] Plitas G, Konopacki C, Wu K, Bos PD, Morrow M, Putintseva EV, Chudakov DM, Rudensky AY. Regulatory T Cells Exhibit Distinct Features in Human Breast Cancer. Immunity. 2016 Nov 15;45(5):1122-1134。

Claims

1. An isolated neutralizing antibody against the β8 chain (Itgβ8) of αvβ8 integrin, wherein the antibody specifically binds to the β8 chain of αvβ8 integrin expressed on regulatory T cells.

2. The isolated anti-Itgβ8 neutralizing antibody according to claim 1, wherein the antibody comprises: (a) A heavy chain, wherein the variable domain comprises: - H-CDR1 having the following sequence: G-Y-T-F-T-X6-Y-X8 (SEQ ID NO:14), wherein X6 is S or R, and X8 is T or W; - H-CDR2 having the following sequence: I-N-P-S-S-G-Y-T (SEQ ID NO:2); - An H-CDR3 having the following sequence: A-R-X3-E-X5-X6-X7-X8-X9-X 10 - X 11 - Y-X 13 - X 14 - X 15 - X 16 - X 17 (SEQ ID NO:15), wherein X3 is A or none, X5 is G or V, X6 is L or Y, X7 is R or Y, X8 is A or Y, X9 is W or G, X 10 is F or S, X 11 is A or S, X 13 is G or none, X 14 is D or none, X 15 is F or none, X 16 is D or none, and X 17 is Y or none; and (b) A light chain, wherein the variable domain comprises: - L-CDR1 having the following sequence: X1-X2-V-X4-X5-X6, wherein X1 is Q or S, X2 is N or S, X4 is G or S, X5 is T or Y, and X6 is N or none, - L-CDR2 having the following sequence: X1-X2-S, wherein X1 is S or R, and X2 is A or T, - L-CDR3 having the following sequence: Q-Q-Y-X4-S-Y-P-X8-T (SEQ ID NO:16), wherein X4 is N or H, and X8 is Y or L.

3. The isolated anti-Itgβ8 neutralizing antibody according to claim 1, wherein the antibody comprises: (a) A heavy chain, wherein the variable domain comprises: H-CDR1 having the sequence shown in SEQ ID NO:1 or SEQ ID NO:8; H-CDR2 having the sequence shown in SEQ ID NO:2; and H-CDR3 having the sequence shown in SEQ ID NO:3 or SEQ ID NO:9; and (b) A light chain, wherein the variable domain comprises: L-CDR1 having the sequence shown in SEQ ID NO:4 or SEQ ID NO:10; L-CDR2 having the sequence shown as SAS or RTS; and L-CDR3 having the sequence shown in SEQ ID NO:5 or SEQ ID NO:

11.

4. The isolated anti-Itgβ8 neutralizing antibody according to claim 3, wherein the antibody comprises: (a) A heavy chain, wherein the variable domain comprises: H-CDR1 having the sequence shown in SEQ ID NO:1; H-CDR2 having the sequence shown in SEQ ID NO:2; and H-CDR3 having the sequence shown in SEQ ID NO:3; and (b) A light chain, wherein the variable domain comprises: L-CDR1 having the sequence shown in SEQ ID NO:4; L-CDR2 having the sequence shown as SAS; and L-CDR3 having the sequence shown in SEQ ID NO:

5.

5. The isolated anti-Itgβ8 neutralizing antibody according to claim 1, wherein the antibody comprises: (a) a heavy chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ ID NO: 6, and (b) a light chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ ID NO:

7.

6. The isolated anti-Itgβ8 neutralizing antibody according to claim 3, wherein the antibody comprises: (a) a heavy chain, wherein the variable domain comprises: H-CDR1 having the sequence shown in SEQ ID NO: 8; H-CDR2 having the sequence shown in SEQ ID NO: 2; and H-CDR3 having the sequence shown in SEQ ID NO: 9; and (b) a light chain, wherein the variable domain comprises: L-CDR1 having the sequence shown in SEQ ID NO: 10; L-CDR2 having the sequence shown in RTS; and L-CDR3 having the sequence shown in SEQ ID NO:

11.

7. The isolated anti-Itgβ8 neutralizing antibody according to claim 1, wherein the antibody comprises: (a) a heavy chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ ID NO: 12, and (b) a light chain, wherein the variable domain has at least 70% identity with the sequence shown in SEQ ID NO:

13.

8. The isolated anti-Itgβ8 neutralizing antibody according to any one of claims 1 to 7, wherein the antibody is a humanized antibody.

9. A nucleic acid molecule encoding the antibody according to any one of claims 1 to 8.

10. A vector comprising the nucleic acid according to claim 9.

11. A host cell that has been transfected, infected, or transformed with the nucleic acid according to claim 9 and / or the vector according to claim 10.

12. A cross-competing antibody that cross-competes with the antibody according to any one of claims 1 to 8 for binding to the β8 chain of αvβ8 integrin expressed on regulatory T cells.

13. A pharmaceutical composition comprising i) the anti-Itgβ8 neutralizing antibody or a fragment thereof according to any one of claims 1 to 8, and ii) a pharmaceutically acceptable carrier.

14. The anti-Itgβ8 neutralizing antibody or a fragment thereof according to any one of claims 1 to 8, for use in a method of activating an anti-tumor CD8 T cell response in a subject affected by cancer.

15. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the anti-Itgβ8 neutralizing antibody or a fragment thereof according to any one of claims 1 to 8.

16. The method according to claim 15, wherein the cancer is selected from the group consisting of glioma, thyroid cancer, colorectal cancer, head and neck cancer, gastric cancer, liver cancer, pancreatic cancer, kidney cancer, ovarian cancer, laryngeal squamous cell carcinoma, lung cancer, prostate cancer, cervical cancer, testicular cancer, endometrial cancer, breast cancer, and melanoma.

Images