Rumen and methanogens vaccines and uses thereof

Abstract

Disclosed herein are polynucleotides encoding one or more rumen-associated antigens, and polypeptides encoded by the polynucleotides. Also provided herein are compositions comprising the polynucleotides, and methods of making and using the compositions.

Description

[0001] Cross - reference to related applications

[0002] This application claims the priority and benefit of U.S. Provisional Patent Application No. 63 / 422,312, filed on November 3, 2022, the entire content of which is hereby incorporated by reference in its entirety. Background of the Invention

[0003] Controlling methane emissions in animals (e.g., ruminants) is an emerging field. Summary of the Invention

[0004] The present disclosure points out certain challenges posed by the increase in global surface temperature due to the increase in greenhouse gas (i.e., methane (CH4)) levels. For example, the present disclosure points out that the increase in methane from agriculture is a major source of greenhouse gas emissions. The present disclosure also points out that reducing methane emissions in animals (e.g., ruminants) will be very important for reducing greenhouse gas emissions.

[0005] In addition, the present disclosure provides techniques for reducing methane emissions in animals (e.g., ruminants), which are carried out by providing a composition for inoculating animals (e.g., ruminants) against rumen - related antigens. In some embodiments, the composition comprising rumen - related antigens may further comprise one or more chemokines and / or cytokines. Without wishing to be bound by theory, the present disclosure proposes that a composition comprising rumen - related antigens (e.g., rumen antigens and / or methanogen antigens) may reduce methane emissions and / or reduce the abundance of microorganisms (e.g., methanogens) in the animal's digestive tract. In some embodiments, reducing methane emissions and / or reducing the abundance of methanogens in the digestive tract of animals (e.g., ruminants) may improve the energy efficiency of the animals.

[0006] The present disclosure provides an isolated polynucleotide encoding one or more rumen - related antigens, fragments thereof, variants thereof, or variant fragments thereof.

[0007] In some embodiments, one or more rumen - related antigens include one or more rumen antigens.

[0008] In some embodiments, one or more rumen antigens are derived from: a polypeptide involved in attachment to fermentative bacteria, or a fragment, variant, or variant fragment thereof.

[0009] In some embodiments, the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, or at least 100 rumen antigens.

[0010] In some embodiments, one or more rumen-related antigens comprise one or more methanogen antigens.

[0011] In some embodiments, one or more methanogen antigens are derived from a polypeptide found on the cell surface of a wild-type methanogen, or a fragment, variant, or variant fragment thereof.

[0012] In some embodiments, the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 methanogen antigens.

[0013] In some embodiments, the polynucleotide comprises about 2 to about 20, about 2 to about 15, about 2 to about 10, about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 5, about 2 to about 4, about 2 to about 3, about 3 to about 20, about 4 to about 20, about 5 to about 20, about 6 to about 20, about 7 to about 20, about 8 to about 20, about 9 to about 20, about 10 to about 20, or about 15 to about 20 methanogen antigens.

[0014] In some embodiments, one or more methanogen antigens are the same, e.g., having the same sequence.

[0015] In some embodiments, one or more methanogen antigens are different, e.g., having different sequences.

[0016] In some embodiments, one or more methanogen antigens comprise:

[0017] (i) one or more peptides having at least 80% sequence identity to a methanogen protein;

[0018] (ii) one or more secreted antigens comprising a signal peptide;

[0019] (iii) multiple peptides having at least 80% sequence identity to each other;

[0020] (iv) Multiple peptides related to at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogenic bacterial species;

[0021] (v) One or more peptides having at least 80% sequence identity with a polypeptide having signal peptidase activity;

[0022] (vi) One or more peptides having at least 80% sequence identity with an AglB polypeptide or having a substantially similar function to an AglB polypeptide;

[0023] (vii) One or more peptides having at least 80% sequence identity with a polypeptide containing an Ig-like domain or having a substantially similar function to a polypeptide containing an Ig-like domain; or

[0024] (viii) Or any combination thereof.

[0025] In some embodiments, one or more methanogenic bacterial antigens comprise:

[0026] (i) One or more peptides having at least 80% sequence identity with a methanogenic bacterial protein;

[0027] (ii) One or more secreted antigens containing a signal peptide;

[0028] (iii) Multiple peptides having at least 80% sequence identity with each other;

[0029] (iv) Multiple peptides related to at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogenic bacterial species;

[0030] (v) One or more peptides having at least 80% sequence identity with a polypeptide having signal peptidase activity;

[0031] (vi) Or any combination thereof.

[0032] In some embodiments, the polynucleotide comprises three methanogenic bacterial antigens. In some embodiments, the three methanogenic bacterial antigens are related to at least three different methanogenic bacterial species.

[0033] In some embodiments, one or more methanogenic bacterial antigens comprise:

[0034] (i) One or more peptides having at least 80% sequence identity with a methanogenic bacterial protein;

[0035] (ii) One or more secreted antigens containing a signal peptide;

[0036] (iii) Multiple peptides related to at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogenic bacterial species;

[0037] (iv) one or more peptides having at least 80% sequence identity with the AglB polypeptide or having a substantially similar function to the AglB polypeptide;

[0038] (v) any combination thereof.

[0039] In some embodiments, the polynucleotide comprises five methanogen antigens. In some embodiments, the five methanogen antigens are related to at least five different methanogen species.

[0040] In some embodiments, one or more methanogen antigens comprise:

[0041] (i) one or more peptides having at least 80% sequence identity with a methanogen protein;

[0042] (ii) one or more secreted antigens comprising a signal peptide;

[0043] (iii) multiple peptides having at least 80% sequence identity with each other;

[0044] (iv) multiple peptides related to at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogen species;

[0045] (v) one or more peptides having at least 80% sequence identity with a polypeptide containing an Ig-like domain or having a substantially similar function to a polypeptide containing an Ig-like domain; or

[0046] (vi) any combination thereof.

[0047] In some embodiments, the polynucleotide comprises eight methanogen antigens. In some embodiments, the eight methanogen antigens are related to at least three different methanogen species.

[0048] In some embodiments, one or more methanogen antigens comprise multiple peptides related to at least 2 different, at least 3 different, at least 4 different, at least 5 different, at least 6 different, at least 7 different, at least 8 different, at least 9 different, at least 10 different, at least 11 different, at least 12 different, at least 15 different, or at least 20 different methanogen species.

[0049] In some embodiments, one or more methanogen antigens comprise multiple peptides related to approximately 2 different, approximately 3 different, approximately 4 different, approximately 5 different, approximately 6 different, approximately 7 different, approximately 8 different, approximately 9 different, approximately 10 different, approximately 11 different, approximately 12 different, approximately 15 different, or approximately 20 different methanogen species.

[0050] In some embodiments, one or more methanogen antigens are derived from a polypeptide found on the cell surface of a wild-type methanogen, or a fragment or variant thereof or a variant fragment thereof.

[0051] In some embodiments, one or more methanogen antigens are secreted.

[0052] In some embodiments, a methanogen antigen comprises a peptide involved in adhesion, attachment or motility, or a fragment or variant of a peptide involved in adhesion, attachment, motility.

[0053] In some embodiments, a secreted methanogen antigen comprises a signal peptide. In some embodiments, the signal peptide can be predicted using a prediction algorithm, and optionally wherein the prediction score is at least 0.5.

[0054] In some embodiments, one or more methanogen antigens comprise one or more peptides having at least 80% sequence identity to a methanogen protein.

[0055] In some embodiments, a polynucleotide comprises multiple methanogen antigens, each antigen having at least 80% sequence identity to each other.

[0056] In some embodiments, the polynucleotide comprises a plurality of methanogenic antigens, wherein each of the plurality of methanogenic antigens is associated with a different methanogenic species. In some embodiments, the polynucleotide comprises a plurality of methanogenic antigens, and wherein the plurality of methanogenic antigens are associated with at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogenic species. In some embodiments, the polynucleotide comprises a plurality of methanogenic antigens, and wherein each of the plurality of methanogenic antigens is associated with the same methanogenic species. In some embodiments, the methanogenic species include: Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanomicrobium mobile, Methanosarcina mazei, Methanobrevibacter thaueri, Methanobrevibacter sp. UBA188, or Methanosarcina soligelidi. In some embodiments, the methanogenic species include: Methanobrevibacter ruminantium, Methanobrevibacter smithii, or Methanobrevibacter oralis. In some embodiments, the methanogenic species include: Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, or Methanosphaera stadtmanae.

[0057] In some embodiments, the polynucleotide comprises one or more methanogenic antigens, wherein the methanogenic antigen comprises one or more peptides that have at least 80% sequence identity with a polypeptide having signal peptidase activity. In some embodiments, the polypeptide having signal peptidase activity: (i) is membrane-bound; (ii) has the ability to cleave one or more signal peptides; (iii) plays a role in converting a secreted protein into its mature form (e.g., from a non-secreted form to a secreted form); and / or (iv) any combination thereof.

[0058] In some embodiments, the polynucleotide comprises one or more methanogen antigens, the methanogen antigens comprising one or more peptides that (1) have at least 80% sequence identity with an immunoglobulin (Ig)-like polypeptide, or (2) have a substantially similar function to a polypeptide containing an Ig-like domain. In some embodiments, the polypeptide containing an Ig-like domain comprises a polypeptide characterized as a cell surface protein that facilitates binding to other cells and / or the cell surface.

[0059] In some embodiments, the polynucleotide comprises one or more methanogen antigens, the methanogen antigens comprising an adhesin or a fragment or variant thereof, a pilin or a fragment or variant thereof, or a flagellin or a fragment or variant thereof.

[0060] In some embodiments, the polynucleotide comprises a sequence encoding one or more methanogen antigens comprising the antigens provided in Table 1, or a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto.

[0061] In some embodiments, the polynucleotide comprises a sequence encoding one or more methanogen antigens comprising the antigen sequences provided in Table 2, or a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto. In some embodiments, the polynucleotide comprises a sequence encoding one or more methanogen antigens, the methanogen antigens comprising fragments, variants or variant fragments of the antigen sequences provided in Table 2. The exemplary antigen sequences provided in Table 2 are not marked in bold or italic.

[0062] In some embodiments, the polynucleotide comprises the antigen nucleic acid sequences provided in Table 2, or a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto.

[0063] In some embodiments, the polynucleotide comprises a sequence encoding a polypeptide having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the polypeptide sequences provided in Table 2.

[0064] In some embodiments, the polynucleotide comprises one or more methanogen antigens, the methanogen antigens comprising one or more peptides that (1) have at least 80% sequence identity with an archaeal oligosaccharyltransferase (AglB) polypeptide or (2) have a substantially similar function to the AglB polypeptide. In some embodiments, the AglB polypeptide is characterized by having N-glycosylation activity.

[0065] In some embodiments, the methanogen antigen comprises a peptide involved in adhesion, attachment or motility, or a fragment or variant of a peptide involved in adhesion, attachment, motility.

[0066] In some embodiments, the methanogen antigen comprises an adhesin or a fragment or variant thereof. In some embodiments, the methanogen antigen comprises an adhesin protein provided in Table 1 or a sequence having at least 85% identity thereto. In some embodiments, the methanogen antigen comprises mru1499 or a fragment or variant thereof.

[0067] In some embodiments, the methanogen antigen comprises an antigen sequence in Table 2, or a variant or fragment or variant fragment thereof. In some embodiments, the methanogen antigen comprises an antigen sequence in Table 2, or a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto. The exemplary antigen sequences provided in Table 2 are not marked in bold or italic.

[0068] In some embodiments, the methanogen antigen comprises an antigen sequence encoded by the nucleotide sequence provided in SEQ ID NO:1, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least or 100% identity thereto. In some embodiments, the methanogen antigen comprises an antigen sequence provided in SEQ ID NO:2, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least or 100% identity thereto.

[0069] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:5, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:6, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0070] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:7, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:8, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0071] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:16, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:15, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0072] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:18, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:17, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0073] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:20, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:19, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0074] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:22, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:21, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0075] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:24, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:23, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0076] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:26, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:25, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0077] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:28, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:27, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0078] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:30, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:29, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0079] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:32, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:31, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0080] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:34, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:33, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0081] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:36, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:35, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0082] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:38, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:37, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0083] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:40, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:39, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0084] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO: 42, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 41, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0085] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO: 44, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 43, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0086] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO: 46, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 45, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0087] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO: 48, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 47, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0088] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO: 50, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 49, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0089] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO: 52, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 51, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0090] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:54, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:53, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0091] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:56, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:55, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0092] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:58, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:57, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0093] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:60, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:59, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0094] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:62, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:61, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0095] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:64, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:63, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0096] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:66, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:65, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0097] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:68, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:67, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0098] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:70, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:69, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0099] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:72, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:71, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0100] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:74, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:73, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0101] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:76, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:75, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0102] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:78, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:77, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0103] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:80, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:79, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0104] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:82, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:81, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0105] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:84, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:83, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0106] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:86, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:85, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0107] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:88, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:87, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0108] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:90, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:89, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0109] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:92, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:91, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0110] In some embodiments, the methanogen antigen comprises an antigenic sequence encoded by the nucleotide sequence provided in SEQ ID NO:94, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto. In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:93, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0111] In some embodiments, the methanogen antigen comprises a pilin or a fragment or variant thereof.

[0112] In some embodiments, the methanogen antigen comprises a flagellin or a fragment or variant thereof.

[0113] In some embodiments, the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100 methanogen antigens.

[0114] In some embodiments, the polynucleotide comprises a signal peptide. In some embodiments, the signal peptide has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least or 100% homology with an archaeal signal peptide.

[0115] In some embodiments, the polynucleotide has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least or 100% homology with a bacterial signal peptide.

[0116] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO:97, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least or 100% identity thereto.

[0117] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO:98, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0118] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO:99, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0119] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO:100, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0120] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO:101, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0121] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO:102, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0122] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 103, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0123] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 104, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0124] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 105, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0125] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 106, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0126] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO: 107, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0127] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 108, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0128] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 109, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0129] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 110, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0130] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 111, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0131] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 112, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0132] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:113, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0133] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:114, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0134] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:115, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0135] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:116, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0136] In some embodiments, the methanogen antigen comprises the antigenic sequence provided in SEQ ID NO:117, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0137] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 118, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0138] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 119, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0139] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 120, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0140] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 121, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0141] In some embodiments, the methanogen antigen comprises the antigen sequence provided in SEQ ID NO: 122, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0142] In some embodiments, the signal peptide is or comprises the PPA2 signal peptide, or a fragment or variant thereof.

[0143] In some embodiments, the signal peptide is or comprises the SSP signal peptide, or a fragment or variant thereof.

[0144] In some embodiments, the signal peptide is or comprises the SARS-CoV-2 spike secretion signal, or a fragment or variant thereof.

[0145] In some embodiments, the signal peptide is located at the N-terminus of the rumen-associated antigen sequence.

[0146] In some embodiments, the polynucleotide comprises: (i) a first nucleotide sequence encoding one or more rumen antigens, and (ii) a second nucleotide sequence encoding one or more methanogen antigens.

[0147] In some embodiments, the polynucleotide comprises: (i) a first nucleotide sequence encoding one or more rumen antigens, (ii) a second nucleotide sequence encoding one or more methanogen antigens; and (iii) a third nucleotide sequence encoding a chemokine and / or cytokine.

[0148] In some embodiments, the polynucleotide comprises: (i) a first nucleotide sequence encoding one or more rumen antigens, (ii) a second nucleotide sequence encoding a chemokine and / or cytokine.

[0149] In some embodiments, the polynucleotide comprises: (i) a first nucleotide sequence encoding one or more methanogen antigens; and (ii) a second nucleotide sequence encoding a chemokine and / or cytokine.

[0150] In some embodiments, the polynucleotide comprises nucleotides encoding a chemokine and / or cytokine. In some embodiments, the chemokine and / or cytokine is selected from APRIL, VIP, and / or CXCL10.

[0151] In some embodiments, the polynucleotide comprises a sequence encoding the chemokine or cytokine provided in SEQ ID NO:10, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least or 100% identity thereto.

[0152] In some embodiments, the polynucleotide comprises the chemokine or cytokine nucleotide sequence provided in SEQ ID NO:9, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least or 100% identity thereto.

[0153] In some embodiments, the polynucleotide comprises a sequence encoding the chemokine or cytokine provided in SEQ ID NO:12, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0154] In some embodiments, the polynucleotide comprises the chemokine or cytokine nucleotide sequence provided in SEQ ID NO:11, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0155] In some embodiments, the polynucleotide comprises a sequence encoding the chemokine or cytokine provided in SEQ ID NO:14, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0156] In some embodiments, the polynucleotide comprises the chemokine or cytokine nucleotide sequence provided in SEQ ID NO:13, or a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity thereto.

[0157] In some embodiments, the nucleotide sequence encoding one or more rumen antigens comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 rumen antigens.

[0158] In some embodiments, the nucleotide sequence encoding one or more methanogen antigens comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 methanogen antigens.

[0159] In some embodiments, the first nucleotide sequence, the second nucleotide sequence, and / or the third nucleotide sequence are located on a single polynucleotide.

[0160] In some embodiments, the first nucleotide sequence, the second nucleotide sequence, and / or the third nucleotide sequence are located on different polynucleotides.

[0161] In some embodiments, one or more rumen antigens and / or one or more methanogen antigens are each located on a separate nucleotide sequence.

[0162] In some embodiments, the polynucleotide comprises at least two methanogen antigens, and the at least two methanogen antigens are located on separate nucleotide sequences.

[0163] In some embodiments, the polynucleotide comprises at least three methanogen antigens, and the at least three methanogen antigens are located on separate nucleotide sequences.

[0164] In some embodiments, the polynucleotide comprises at least four methanogen antigens, and the at least four methanogen antigens are located on separate nucleotide sequences.

[0165] In some embodiments, the polynucleotide comprises at least five methanogen antigens, and the at least five methanogen antigens are located on separate nucleotide sequences.

[0166] In some embodiments, the polynucleotide comprises at least six methanogen antigens, and the at least six methanogen antigens are located on separate nucleotide sequences.

[0167] In some embodiments, the polynucleotide comprises at least seven methanogen antigens, and the at least seven methanogen antigens are located on separate nucleotide sequences.

[0168] In some embodiments, the polynucleotide comprises at least eight methanogen antigens, and the at least eight methanogen antigens are located on separate nucleotide sequences.

[0169] In some embodiments, the polynucleotide comprises at least nine methanogen antigens, and the at least nine methanogen antigens are located on separate nucleotide sequences.

[0170] In some embodiments, the polynucleotide comprises at least ten methanogen antigens, and the at least ten methanogen antigens are located on separate nucleotide sequences.

[0171] In some embodiments, one or more rumen antigens and / or one or more methanogen antigens are located on the same nucleotide sequence.

[0172] In some embodiments, the polynucleotide comprises a transmembrane domain.

[0173] In some embodiments, the polynucleotide further comprises a complement C3d-binding polypeptide of the immunoglobulin-binding protein (Sbi) from Staphylococcus aureus. In some embodiments, the complement C3d-binding polypeptide is or comprises one or both of domains III and IV of Sbi of Staphylococcus aureus or a functional fragment or variant thereof.

[0174] In some embodiments, the polynucleotide is or comprises DNA.

[0175] In some embodiments, the polynucleotide is or comprises RNA. In some embodiments, the RNA comprises a 5' cap. In some embodiments, the RNA comprises a polyA tail.

[0176] In some embodiments, the polynucleotide sequence comprises one or more ribonucleotides that comprise a nucleoside that comprises an acetyl group, wherein the nucleoside is N4-acetylcytidine, and the modified ribonucleotide has the following structure:

[0177]

[0178] wherein R is a 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0179] In some embodiments, the polyribonucleotide further comprises one or more modified ribonucleotides in addition to N4-acetylcytidine, optionally wherein the nucleoside is selected from: adenosine, inosine, guanosine, cytidine or uridine, or any combination thereof.

[0180] In some embodiments, the nucleoside of one or more modified ribonucleotides is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure:

[0181]

[0182] wherein R is a 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0183] In some embodiments, the polynucleotide sequence comprises one or more ribonucleotides that comprise a nucleoside that comprises a hydroxymethyl group, wherein the nucleoside is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure:

[0184]

[0185] wherein R is a 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0186] In some embodiments, the polynucleotide further comprises one or more modified ribonucleotides in addition to 5-hydroxymethyluridine, wherein the one or more modified ribonucleotides comprise a nucleoside selected from adenosine, inosine, guanosine, cytidine, or uridine, or any combination thereof.

[0187] In some embodiments, the nucleoside of the one or more modified ribonucleotides is N4-acetylcytidine, and the modified ribonucleotide has the following structure

[0188]

[0189] wherein R is 5'-monophosphate, 5'-diphosphate, or 5'-triphosphate.

[0190] The present disclosure also provides polypeptides encoded by the polynucleotides disclosed herein.

[0191] The present disclosure further provides compositions comprising one or more of the polynucleotides disclosed herein or the polypeptides disclosed herein.

[0192] In some embodiments, the composition comprises a plurality of the polynucleotides disclosed herein. In some embodiments, each of the plurality of polynucleotides comprises one or more methanogen antigens. In some embodiments, each of the plurality of polynucleotides encodes a different methanogen antigen. In some embodiments, each of the plurality of polynucleotides encodes the same methanogen antigen.

[0193] In some embodiments of the composition comprising a plurality of polynucleotides, the plurality of polynucleotides comprises a mixture of polynucleotides, e.g., a portion encoding the same methanogen antigen and a portion encoding different methanogen antigens.

[0194] In some embodiments, the compositions disclosed herein comprise one or more polynucleotides that comprise one or more rumen-related antigens, e.g., methanogen antigens. In some embodiments, the composition (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises a plurality of polynucleotides (e.g., a plurality of RNAs), each polynucleotide comprising an antigen. In some embodiments, the composition (e.g., a multi-component composition, a multi-component vaccine composition) comprises a plurality of polynucleotides (e.g., a plurality of RNAs), each polynucleotide comprising one or more antigens (e.g., the same or different antigens).

[0195] In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 1% of a first polynucleotide and about 99% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 5% of a first polynucleotide and about 95% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 10% of a first polynucleotide and about 90% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 20% of a first polynucleotide and about 80% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 30% of a first polynucleotide and about 70% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 40% of a first polynucleotide and about 60% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 50% of a first polynucleotide and about 50% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 60% of a first polynucleotide and about 40% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 70% of a first polynucleotide and about 30% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 80% of a first polynucleotide and about 20% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 90% of a first polynucleotide and about 10% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 99% of a first polynucleotide and about 1% of one or more additional polynucleotides.

[0196] In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises approximately 33% of a first polynucleotide, approximately 33% of a second polynucleotide, and approximately 33% of a third polynucleotide.

[0197] In some embodiments, the composition is a pharmaceutical composition.

[0198] In some embodiments, the pharmaceutical composition is an immunogenic composition.

[0199] In some embodiments, the composition is a vaccine composition.

[0200] In some embodiments, the composition is formulated for delivery with a carrier. In some embodiments, the carrier is a lipid nanoparticle, a cationic lipid, a polymeric particle.

[0201] In some embodiments, the composition is formulated for delivery without a carrier.

[0202] The present disclosure provides a method that includes administering a composition disclosed herein to a cell, tissue, or animal (e.g., a ruminant).

[0203] In some embodiments, the method is a vaccination method.

[0204] In some embodiments, the animal is a ruminant, e.g., a cow, sheep, goat, buffalo, moose, antelope, reindeer, or deer.

[0205] In some embodiments, the animal is a domestic animal.

[0206] In some embodiments, compared to animals that have not been vaccinated or have been vaccinated with a different vaccine, the vaccine reduces the methane emissions of the animals.

[0207] In some embodiments, the composition is characterized in that, compared to other comparable animals that have not been administered the composition or have been administered a different composition, administering the composition to an animal reduces the methane emissions of the animal. In some embodiments, compared to other comparable animals that have not been administered the composition or have been administered a different composition, the methane emissions are reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0208] In some embodiments, the composition is characterized in that, compared to other comparable animals that have not been administered the composition or have been administered a different composition, administering the composition to an animal reduces the microbial population in the animal. In some embodiments, the microbe is a methanogen. In some embodiments, the methanogens include methanogens from one or more of the following clades: Methanobrevibacter, Methanosphaera, Methanobacterium, Methanosarcinales, Methanomicrobiales, Methanothermobacter, Candidatus Methanomethylophilus, Thermoplasmatales.

[0209] In some embodiments, the methanogens include Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexistens, Methanobrevibacter sp. UBA188, Methanosarcina soligelidi, Methanothermobacter thermautotrophicus, Methanococcus aeolicus, Methanocaldococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanopyrus kandleri, Methanocorpusculum labreanum, Methanococcoides burtonii, Methanosaeta thermophilia, Methanoregula boonei, Methanosphaerula palustris, Methanoculleus marisnigri, Methanospirillum hungatei, Methanosarcina acetivorans, or any combination thereof.

[0210] In some embodiments, the composition is characterized in that administering the composition to an animal increases the growth rate of the animal compared to the growth rate of other comparable animals that have not received the composition or have received a different composition. In some embodiments, the increase in growth rate includes a daily increase in the weight of the animal, optionally wherein the daily increase in the weight of the animal is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% increase in weight compared to other comparable animals that have not received the composition or have received a different composition.

[0211] In some embodiments, the methods disclosed herein include administering a dose of the vaccine composition to an animal.

[0212] In some embodiments, the methods disclosed herein include administering multiple doses of a vaccine composition to an animal.

[0213] In some embodiments, a first dose of the composition is administered to the animal, followed by one or more subsequent doses of the composition.

[0214] In some embodiments, the first dose and the one or more subsequent doses of the composition comprise the same methanogen antigen and / or rumen antigen.

[0215] In some embodiments, the first dose and the one or more subsequent doses of the composition comprise different methanogen antigens and / or rumen antigens.

[0216] In some embodiments, the composition is administered to the animal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times.

[0217] In some embodiments, the composition is administered once every 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months.

[0218] In some embodiments, the composition is administered in combination with one or more additional agents.

[0219] In some embodiments, the one or more additional agents include chemical additives, biological feed additives.

[0220] In some embodiments, the composition is administered in combination with one or more additional compositions.

[0221] In some embodiments, the additional composition immunizes the animal against a disease, e.g., an infectious disease.

[0222] Also disclosed herein are compositions comprising the isolated polynucleotides disclosed herein, or the pharmaceutical compositions disclosed herein, for use in administering to an animal (e.g., vaccination).

[0223] The present disclosure also provides the use of a composition comprising the isolated polynucleotides disclosed herein or the pharmaceutical compositions disclosed herein in the manufacture of a medicament for administering to an animal (e.g., vaccination).

[0224] In some embodiments of any of the compositions for use or the uses disclosed herein, the isolated polynucleotide or pharmaceutical composition is administered to an animal.

[0225] In some embodiments of any of the compositions for use or the uses disclosed herein, administering the isolated polynucleotide or pharmaceutical composition results in, compared to other comparable animals that have not received the composition or have received a different composition:

[0226] (i) a reduction in methane emissions;

[0227] (ii) a decrease in the abundance of one or more microorganisms (e.g., methanogens) in the animal's digestive tract; and / or

[0228] (iii) an increase in the growth rate of the animal.

[0229] In some embodiments of any of the compositions for use or the uses disclosed herein, the animal is a ruminant or a domestic animal.

[0230] In some embodiments of any of the compositions for use or the uses disclosed herein, the methanogens include Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobacterium arboriphilum, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexistentis, Methanobrevibacter sp. UBA188, Methanosarcina söhngenii, Methanothermus fervidus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanothermus kandleri, Methanopyrus kandleri, Methanoculleus bourgensis, Methanothrix thermophila, Methanoregula boonei, Methanosphaerula palustris, Methanocorpusculum bavaricum, Methanospirillum hungatei, Methanosarcina acetivorans, or any combination thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0231] Figures 1A - 1B Describes the antigen-specific IgG titers in serum for an exemplary multi-component RNA vaccine formulation. The experimental groups consisted of calves that received 1 dose (day 20, n = 5), 2 doses (days 20 and 34, n = 5) or no dose / untreated (UTD, n = 5) of the exemplary RNA vaccine formulation: a total of 0.5 mg, 50% OVA_HNadj (85% HNmod1, where HNmod1 corresponds to Ac4C and 50% mru1499_HNadj (85% HNmod1). Serum was collected on days 20, 34, and 90. ELISA was run separately on each antigen (OVA, mru1499) of the multi-component vaccine. The geometric mean reciprocal titers of the 1-dose and 2-dose groups are provided for each time point, and the responses of OVA-IgG ( Figure 1A ) and mru1499-IgG ( Figure 1B ) to the exemplary RNA vaccine in cattle were measured.

[0232] Figure 2Describes the normalized relative abundances of methanogenic species in rumen fluid for an exemplary multi-component RNA vaccine formulation. The experimental groups consisted of calves receiving 1 dose (day 20, n = 5), 2 doses (days 20 and 34, n = 5) or no dose / untreated (UTD, n = 5) of the exemplary RNA vaccine formulation: 0.5 mg total, 50% OVA_HNadj (85% HNmod1) and 50% mru1499_HNadj (85% HNmod1). Rumen fluid was collected on days 0, 20, 34 and 90. Samples were sequenced to obtain measurements of the relative abundances of Methanobrevibacter ruminantium (Mbb.) M1, a methanogen, in the 1-dose and 2-dose groups in response to the exemplary RNA vaccine in cattle. Values at each time point are Δ compared to the value on day 0 for that group. The y-axis is normalized to 1.0 based on the mean pre-study M1 / archaea for the cohort.

[0233] Figures 3A - 3B Describes the normalized relative abundances of methanogenic and archaeal species in rumen fluid for an exemplary RNA vaccine formulation that targets methanogenic proteins and has various secretion signals. The experimental groups consisted of groups of calves (n = 4) receiving prime / boost doses of the designated RNA vaccine formulation (0.5 mg, 100% HNmod1). Rumen fluid was collected on days 0, 20, 34 and 90 and processed into pellets. Samples were sequenced to obtain measurements of the relative abundances of Methanobrevibacter ruminantium (Mbb.) M1 ( Figure 3A ), a methanogen, and total archaea ( Figure 3B ) in response to the exemplary RNA vaccine in cattle for each formulation group. Values at each time point are Δ compared to the value on day 0 for that group. The y-axis is normalized to 1.0 based on the mean pre-study M1 / archaea for the cohort.

[0234] Figure 4 Describes the normalized relative abundances of methanogenic and archaeal species in rumen fluid for an exemplary RNA vaccine formulation having cytokines and dual chemical modifications (HNmod1 / HNmod2, where HNMod1 corresponds to Ac4C and HNMOD2 corresponds to 5hmU). The experimental groups consisted of groups of calves (n = 4) receiving prime / boost doses of the designated RNA vaccine formulation (0.5 mg, the corresponding composition described in the figure). The experimental setup was similar to that in Figure 3; however, the RNA vaccine formulation included cytokine and dual chemical modification (HNmod1 / HNmod2) features. Note that for F8, n = 1.

[0235] Figure 5Describes the methane emissions per unit feed intake for exemplary RNA vaccine formulations targeting methanogenic proteins and having various secretion signals. The experimental group consisted of calves (n = 4) receiving a prime / boost dose of the designated RNA vaccine formulation (0.5 mg, 100% HNmod1; the corresponding composition described in the figure). Intestinal methane emissions were measured per animal, i.e., average daily CH4 (g / d) per daily total feed intake (lbs / d), and then averaged over an 8-day measurement time frame.

[0236] Figure 6 Describes the methane emissions per unit feed intake for exemplary RNA vaccine formulations having cytokines and single chemical modification (HNmod1) or dual chemical modification (HNmod1, HNmod2). The experimental group consisted of calves (n = 4) receiving a prime / boost dose of the designated RNA vaccine formulation (0.5 mg, the corresponding composition described in the figure). The experimental setup was similar to Figure 5 ; however, the RNA vaccine formulation included cytokine characteristics. Note that for group F5, n = 3, and for group F7, n = 2 due to calves not complying with the GreenFeed system.

[0237] Figures 7A - 7B Describes the normalized relative abundances of all archaeal species in rumen fluid for an exemplary multi-component RNA vaccine formulation targeting multiple methanogenic proteins. The experimental group consisted of calves (n = 10) receiving three doses of the designated RNA vaccine formulation (0.55 mg, 100% Hnmod1; the corresponding composition described in Table 3). Rumen fluid was collected on days 90, 109, and 122 and processed into pellets, where day 90 represents the pre-injection (before the third injection) sample ("PRE", 14 days before the boost injection), day 109 represents the 5-day post-injection (after the third injection) sample ("+5dPOST"), and day 122 represents the 18-day post-injection (after the third injection) sample ("+18d POST"). In this study, no rumen collections were performed after the first and second injections to minimize interference with the rumen biome. Samples were sequenced to obtain relative abundance measurements (e.g., % of total sequence population) of all bacterial and archaeal species in response to the RNA vaccine formulations CNT (OVA) and F3. The bacterial and archaeal species tested included Methanobrevibacter wolinii, Methanosphaera stadtmanae, Methanobrevibacter oralis, Methanobrevibacter smithii, and Methanobrevibacter ruminantium. Figure 7AShows the relative abundance levels of all archaeal species identified at time points PRE, +5-d POST, and +18-d POST. The "Other" category consists of species with relative abundances < 0.01% and includes Methanosarcina mazei, Methanosarcina sp., Methanobrevibacter arboriphilus, Thermoplasmatales, Methanobacterium formicicum, Methanobrevibacter boviskoreani, Methanomicrobium mobile, Methanothermobacter sp., Candidatus Methanomethylophilus alvus, and Nitrososphaera sp. Figure 7B Shows the % change for each archaeal species relative to the PRE time point and normalized to CNT(OVA).

[0238] Figures 8A - 8B Describes the raw methane emissions and methane emissions per unit feed intake for an exemplary multi-component RNA vaccine formulation targeting multiple methanogen proteins. The experimental group consisted of a group of calves (n = 10) receiving a prime / boost dose of the designated RNA vaccine formulation (0.55 mg, 100% Hnmod1; the corresponding composition described in Table 3). Intestinal methane emissions were measured per animal, i.e., average daily CH4 (g / d) per daily total feed intake (lbs / d), and then averaged over the time range T1 (D0–D14) 14 days after the prime injection and the pre-injection baseline T0 (D-8-D-2). The methane percentage Δ ( Figure 8A ) and methane / intake ( Figure 8B ) were determined by dividing the raw methane or methane / intake value of the later time range (T1) by the value of the baseline (T0), and then normalizing by measuring the percentage difference of each treatment group from the control group (CNT-OVA). Error bars reflect standard error.

[0239] Figure 9 Describes the growth efficiency measurements for an exemplary RNA vaccine formulation targeting methanogen proteins and having various secretion signals, cytokines, and either single chemical modification (HNmod1) or dual chemical modification (HNmod1, HNmod2). The experimental group consisted of calves receiving the designated RNA vaccine formulation (0.5 mg, the composition corresponding to Figure 5 and Figure 6consisted of calves in the priming / boosting dose groups (n = 4) of those in []. Average daily gain (ADG, lb / day) is an indicator of growth efficiency, and a higher median value reflects higher efficiency. The average daily gain was calculated by linear regression of body weight measurements between time periods. Specifically, "pre-injection baseline" was the average daily weight gain from D-32 to D0 (e.g., a 32-day period before injection), "D0-D20" was the average daily weight gain from D0 to D20 (e.g., a 20-day period after the priming injection), and "D20-D90" was the average daily weight gain from D20 to D90 (e.g., a 70-day period after the boosting injection). ΔADG represents the difference between the ADG of each treatment group within the specified time range and the pre-injection baseline, and was then normalized by finding the difference between this Δ and the Δ of the control group (UTD). The vaccine condition F8 (n = 1) was not shown, with an ADG change of +1.70 lb / day at D20 and +0.91 lb / day at D90.

[0240] Figures 10A - 10B describes the growth efficiency measurements of exemplary multi-component RNA vaccine formulations targeting multiple methanogen proteins. The experimental groups consisted of calves in the priming / boosting dose groups (n = 10) that received the specified RNA vaccine formulations (0.55 mg; 100% Hnmod1; the corresponding compositions described in Table 3). Average daily gain (ADG, lb / day) is an indicator of growth efficiency, and a higher median value reflects higher efficiency. The average daily gain was calculated by linear regression of body weight measurements between time periods ( Figure 10A ). Specifically, "pre-injection baseline" was the average daily weight gain from D-49 to D0 (e.g., a 50-day period before injection), "D25" was the average daily weight gain from D0 to D25 (e.g., a 25-day period after the priming injection), and "D90" was the average daily weight gain from D25 to D90 (e.g., a 65-day period after the boosting injection). Figure 10B shows the ΔADG in pounds per day (lb / d), which represents the difference between the ADG of each treatment group within the specified time range and the pre-injection baseline, and was then normalized by finding the difference between this Δ and the Δ of the control group (CNT-OVA). The right graph shows the ΔADG in percentage units (%), representing the ratio of the later time to the earlier time, and was then normalized by finding the difference between this percentage and the percentage of the control group (CNT-OVA).

[0241] Certain Definitions

[0242] About or approximately: As used herein, the terms "about" and "approximately" when used in reference to a value herein, refer to a value that is similar in context to the value being referred to. Generally, one of ordinary skill in the art familiar with the context will understand the degree of relevant variance covered by "about" or "approximately" in that context. For example, in some embodiments, the term "about" or "approximately" may cover a range of values within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value.

[0243] Administering: As used herein, the term "administering" or "administration" generally refers to the application of a composition to an animal to effect delivery of the composition or an agent contained therein. One of ordinary skill in the art will appreciate the various routes that may be used to administer to an animal (e.g., a ruminant) as appropriate. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve the application of a fixed number of doses. In some embodiments, administration may involve intermittent (e.g., multiple doses separated in time) and / or periodic (e.g., individual doses separated by the same time period) dosing. In some embodiments, administration may involve continuous dosing (e.g., infusion) for at least a selected period of time.

[0244] Antigen: As used herein, the term "antigen" refers to an agent that elicits an immune response; and / or (ii) an agent that binds to a T cell receptor (e.g., when presented by an MHC molecule) or to an antibody. In some embodiments, the antigen elicits a humoral response (e.g., including the production of antigen-specific antibodies); in some embodiments, the antigen elicits a cellular response (e.g., T cells involved in receptor-antigen specific interactions). In some embodiments, the antigen comprises at least one epitope of a target protein. In some embodiments, the epitope can be a linear epitope. In some embodiments, the epitope can be a conformational epitope. In some embodiments, the antigen binds to an antibody and can or may not induce a specific physiological response in an organism. Generally speaking, an antigen can be or include any chemical entity, such as, for example, small molecules, nucleic acids, polypeptides, carbohydrates, lipids, polymers (in some embodiments, other than biopolymers [e.g., other than nucleic acid or amino acid polymers]), etc. In some embodiments, the antigen is or comprises a polypeptide. In some embodiments, the antigen is or comprises a glycan. Those of ordinary skill in the art will understand that, generally speaking, an antigen can be provided in an isolated or pure form, or alternatively can be provided in a crude form (e.g., together with other materials, such as in an extract containing the antigen source, such as a cell extract or other relatively crude preparation). In some embodiments, the antigen used in accordance with the present invention is provided in a crude form. In some embodiments, the antigen is a recombinant antigen.

[0245] Delivery / Contact: As used interchangeably herein, the terms "delivery", "delivering", or "contact" refer to introducing a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) into a target cell. The target cell can be cultured in vitro or ex vivo or be present in an animal (in vivo). The method of introducing a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) into a target cell can vary depending on in vitro, ex vivo, or in vivo applications. In some embodiments, a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) can be introduced into a target cell in a cell culture by in vitro transfection. In some embodiments, a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) can be introduced into a target cell via a delivery vehicle (e.g., nanoparticles, liposomes, and / or complexed with a cell-penetrating agent). In some embodiments, a fusion polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) can be introduced into a target cell of a subject by administering the fusion polynucleotide (e.g., as described herein) or the fusion polypeptide (e.g., as described herein) to the animal.

[0246] Functional: As used herein, the term "functional" is used to refer to a form or fragment of an entity that exhibits a particular property and / or activity.

[0247] Fragment: A "fragment" of a material or entity as described herein has a structure that includes discrete portions of the whole, but lacks one or more portions that are present in the whole. In some embodiments, the fragment consists of such discrete portions. In some embodiments, the fragment consists of or includes characteristic structural elements or portions found in the whole. In some embodiments, the fragment includes a polynucleotide fragment. In some embodiments, the fragment includes a polypeptide fragment. In some embodiments, the polynucleotide fragment or polypeptide fragment comprises or consists of: at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomeric units (e.g., residues) as found in the whole polynucleotide or whole polypeptide. In some embodiments, the polynucleotide fragment or polypeptide fragment comprises or consists of: at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the monomeric units (e.g., residues) found in the whole polynucleotide or whole polypeptide. The whole polypeptide or whole polynucleotide may be referred to in some embodiments as the "parent" of the polynucleotide fragment or polypeptide fragment.

[0248] Methanogens: As used herein, "methanogens" are microorganisms that produce methane. In some embodiments, methanogens can inhabit the digestive tract of animals and participate in the fermentation process. In some embodiments, methanogens are organisms that conserve energy for ATP synthesis by producing methane gas. In some embodiments, methanogens can inhabit the digestive tract of ruminants. In some embodiments, methanogens can inhabit the digestive tract of non-ruminants. Exemplary methanogens are provided in Buan N.R. (2018) Emerg Top life Sci 2(4): pp. 629-646, the entire content of which is hereby incorporated by reference. In some embodiments, methanogens include one or more methanogens from one or more of the following clades: Methanobrevibacter, Methanosphaera, Methanobacterium, Methanosarcinales, Methanomicrobiales, Methanothermobacter. In some embodiments, methanogens include: Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188, Methanosarcina söehngenii, Methanothermobacter thermautotrophicus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanothermus kandleri, Methanoculleus labreanum, Methanococcoides burtonii, Methanothrix thermophila, Methanoregula boonei, Methanosphaerula palustris, Methanocorpusculum bavaricum, Methanospirillum hungatei, Methanosarcina acetivorans, or any combination thereof.

[0249] Nucleic acids / oligonucleotides / polynucleotides: As used herein, the terms “nucleic acid” and “polynucleotide” and “oligonucleotide” are used interchangeably and refer to polymers of three or more nucleotides. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises RNA. In some embodiments, the nucleic acid comprises messenger RNA (mRNA). In some embodiments, the nucleic acid is single-stranded. In some embodiments, the nucleic acid is double-stranded. In some embodiments, the nucleic acid comprises both single-stranded and double-stranded portions. In some embodiments, the nucleic acid comprises a backbone containing one or more phosphodiester linkages. In some embodiments, the nucleic acid comprises a backbone containing phosphodiester linkages and non-phosphodiester linkages. For example, in some embodiments, the nucleic acid may comprise a backbone containing one or more phosphorothioate or 5'-N-phosphoramidite linkages and / or one or more peptide linkages, such as, for example, in “peptide nucleic acid”. In some embodiments, the nucleic acid comprises one or more or all natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, the nucleic acid comprises one or more or all non-natural residues. In some embodiments, the non-natural residues comprise nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, the non-natural residues comprise one or more modified sugars compared to the sugars in natural residues (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose). In some embodiments, the nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or polypeptide. In some embodiments, the nucleic acid has a nucleotide sequence comprising one or more introns. In some embodiments, the nucleic acid can be prepared by isolation from natural sources, enzymatic synthesis (e.g., by polymerization based on a complementary template, e.g., in vivo or in vitro), replication in a recombinant cell or system, or chemical synthesis.In some embodiments, the nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500 or 20,000 or more residues or nucleotides in length. When the number of nucleotides is used as an indication of size (e.g., the size of a fusion polynucleotide), the number of nucleotides refers to the number of nucleotides on a single strand (e.g., a single strand of a fusion polynucleotide).

[0250] Polypeptide: As used herein, the term "polypeptide" generally has the meaning of a polymer of at least three or more amino acids as is generally recognized in the art. Those of ordinary skill in the art will understand that the term "polypeptide" is intended to be broad enough to cover not only polypeptides having the complete sequences described herein, but also polypeptides representing functional, bioactive or characteristic fragments, portions or domains of such complete polypeptides (e.g., fragments, portions or domains that retain at least one activity). Polypeptides can contain L-amino acids, D-amino acids or both and can contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. In some embodiments, the polypeptide can comprise natural amino acids, unnatural amino acids, synthetic amino acids and combinations thereof.

[0251] Polynucleotide: As used herein, the term "polynucleotide" refers to a polymer of three or more ribonucleotides. In some embodiments, the polynucleotide is single-stranded. In some embodiments, the polynucleotide is double-stranded. In some embodiments, the polynucleotide contains single-stranded and double-stranded portions. In some embodiments, the polynucleotide may contain a backbone structure as described in the definition of "nucleic acid / oligonucleotide" above. The polynucleotide may be a regulatory RNA (e.g., siRNA, microRNA, etc.) or a messenger RNA (mRNA) oligonucleotide. In some embodiments, the polynucleotide typically contains a poly(A) region at its 3' end. In some embodiments, the polynucleotide typically contains a cap structure recognized in the art at its 5' end, e.g., for identifying the RNA and attaching the RNA to the ribosome to initiate translation. In some embodiments, the polynucleotide contains an RNA oligonucleotide. When the number of ribonucleotides is used as an indication of size (e.g., the size of a polynucleotide), the number of nucleotides refers to the number of ribonucleotides on a single strand.

[0252] Rumen-related antigen: As used herein, "rumen-related antigen" is an antigen expressed in ruminants. In some embodiments, the rumen-related antigen is a "rumen antigen", e.g., an antigen encoded by a nucleotide sequence naturally present in the ruminant genome. In some embodiments, the rumen-related antigen is encoded by a nucleotide sequence that is not naturally present in the ruminant genome (e.g., has been introduced into the ruminant genome or is part of a microorganism that can inhabit the ruminant digestive tract (e.g., the rumen)). In some embodiments, the rumen-related antigens include: methanogen antigens, antigens from rumen ciliates symbiotic with methanogens; antigens from hydrogen-producing organisms; antigens from taxa associated with low feed efficiency, or any combination thereof. In some embodiments, the rumen-related antigen is or includes a methanogen antigen.

[0253] Variant: As used herein, the term "variant" refers to an entity that exhibits significant structural identity with a reference entity but is structurally different from the reference entity in the presence or level of one or more chemical moieties. In many embodiments, the variant is also functionally different from its reference entity. Generally, whether a particular entity is properly considered a "variant" of a reference entity is based on the degree of structural identity of the particular entity with the reference entity. For example, a variant polypeptide may differ from a reference polypeptide due to one or more differences in the amino acid sequence and / or one or more differences in chemical moieties covalently attached to the polypeptide backbone (e.g., carbohydrates, lipids, etc.). Alternatively or additionally, in some embodiments, the variant polypeptide does not share at least one characteristic sequence element with the reference polypeptide. In some embodiments, the reference polypeptide has one or more biological activities. In some embodiments, the variant polypeptide shares one or more of the biological activities of the reference polypeptide. In some embodiments, the variant polypeptide lacks one or more of the biological activities of the reference polypeptide. In some embodiments, the variant polypeptide exhibits a decrease in one or more levels of biological activity compared to the reference polypeptide.

[0254] Standard techniques are available for recombinant DNA, oligonucleotide synthesis (e.g., RNA synthesis), and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques can be performed according to the manufacturer's instructions or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally carried out according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout this specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)), which is incorporated herein by reference for any purpose. Detailed Description

[0255] The present disclosure points out that the increase in methane from agriculture is a major source of greenhouse gas emissions. The present disclosure also points out that reducing methane emissions from animals (e.g., ruminants) will be very important for reducing greenhouse gas emissions.

[0256] Methane is produced by methanogens (a subgroup within the domain of archaea), which are present in the rumen of ruminants. Methanogens can reduce the efficiency of nutrients and / or energy available to ruminants because methane production by methanogens can account for 2 - 12% of the ingested energy (see Leahy SC et al., (2010) PlosOne; Vol. 5, No. 1; e8926, the entire content of which is incorporated by reference). Accordingly, the present disclosure states that reducing methane emissions from ruminants can be beneficial for increasing the energy efficiency of ruminants and reducing methane emissions into the atmosphere.

[0257] In addition, the present disclosure provides techniques for reducing methane emissions from animals (e.g., ruminants), which are carried out by providing a composition for administering rumen-related antigens to an animal (e.g., a ruminant) (e.g., vaccinating an animal (e.g., a ruminant) against rumen-related antigens). The present disclosure also provides techniques for increasing the energy efficiency of animals (e.g., ruminants), which are for administering rumen-related antigens to an animal (e.g., a ruminant) (e.g., vaccinating an animal (e.g., a ruminant) against rumen-related antigens), thereby reducing the abundance of one or more methanogens in the rumen of the animal (e.g., a ruminant).

[0258] Without wishing to be bound by theory, the present disclosure proposes that a composition comprising rumen-related antigens (e.g., rumen antigens and / or methanogen antigens) can reduce methane emissions and / or reduce the abundance of microorganisms (e.g., methanogens) in the digestive tract of an animal. In some embodiments, reducing methane emissions and / or reducing the abundance of methanogens in the digestive tract of an animal (e.g., a ruminant) can increase the energy efficiency of the animal. Furthermore, the animal (e.g., a ruminant) may require less food, experience an increase in muscle mass, and / or have an improved overall health condition. These benefits can result in reduced costs of raising the animal and / or increased revenue from selling the animal or the meat obtained from such an animal.

[0259] Rumen-related antigens

[0260] Rumen-related antigens as described herein include rumen antigens and / or methanogen antigens. In some embodiments, the rumen-related antigens are endogenous to the ruminant, e.g., encoded by a nucleotide sequence in the ruminant genome. In some embodiments, the rumen-related antigens are not endogenous to the ruminant, e.g., encoded by a nucleotide sequence introduced into the ruminant, or by a nucleotide sequence of a microorganism present in or introduced into the ruminant.

[0261] In some embodiments, the ruminant is selected from cattle, sheep, goats, buffalo, moose, antelopes, reindeer or deer, or a combination thereof.

[0262] Exemplary rumen - associated antigens include peptides involved in attachment to bacteria (e.g., fermenting bacteria) and fragments or variants thereof.

[0263] In some embodiments, the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100 rumen antigens.

[0264] In some embodiments, the polynucleotide comprises about 2 - 100, about 3 - 100, about 4 - 100, about 5 - 100, about 6 - 100, about 7 - 100, about 8 - 100, about 9 - 100, about 10 - 100, about 20 - 100, about 30 - 100, about 40 - 100, about 50 - 100, about 60 - 100, about 70 - 100, about 80 - 100, about 90 - 100, about 2 - 90, about 2 - 80, about 2 - 70, about 2 - 60, about 2 - 50, about 2 - 40, about 2 - 30, about 2 - 20, about 2 - 10, about 2 - 15, about 2 - 14, about 2 - 13, about 2 - 12, about 2 - 11, about 2 - 10, about 2 - 9, about 2 - 8, about 2 - 7, about 2 - 6, about 2 - 5, about 2 - 4, about 2 - 3 rumen antigens.

[0265] Methanogens and methanogen antigens

[0266] Methanogens are anaerobic archaea characterized by the ability to conserve energy for ATP synthesis by producing methane gas, as described in Buan N.R. (2018). Methanogens can also inhabit the digestive tracts of animals (e.g., ruminants and humans). Methanogens can reduce the efficiency of nutrients and / or energy available to ruminants because methane production by methanogens can account for 2 - 12% of the ingested energy (see Leahy SC et al., (2010) PlosOne; Vol. 5, No. 1; e8926, the entire content of which is incorporated by reference). Thus, reducing methane emissions from ruminants can be beneficial for improving the energy efficiency of ruminants and / or reducing methane emissions into the atmosphere.

[0267] In some embodiments, the methanogens include methanogens from one or more of the following clades: Methanobrevibacter, Methanosphaera, Methanobacterium, Methanosarcinales, Methanomicrobiales, Methanothermobacter, Candida methanosorbosa, Thermoplasmatales.

[0268] In some embodiments, the methanogens include methanogens from the Methanobrevibacter clade. In some embodiments, the methanogens from the Methanobrevibacter clade include: Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanobrevibacter symbiosum, Methanobrevibacter gottschalkii, Methanobrevibacter millerae, Methanobrevibacter woesei, Methanobrevibacter arboriphilus, Methanobrevibacter wolinii, Methanobrevibacter olleyae, Methanobrevibacter boonei, or a combination thereof.

[0269] In some embodiments, the methanogens include methanogens from the Methanosphaera clade. In some embodiments, the methanogens from the Methanosphaera clade include: Methanosphaera stadtmanae.

[0270] In some embodiments, the methanogens include methanogens from the Methanobacterium clade. In some embodiments, the methanogens from the Methanobacterium clade include: Methanobacterium bryantii or Methanobacterium formicicum.

[0271] In some embodiments, the methanogens include methanogens from the Methanosarcinales clade. In some embodiments, the methanogens from the Methanosarcinales clade include Methanosarcina bakeri, Methanosarcina mazei, or Methanosarcina söehngenii.

[0272] In some embodiments, the methanogens include methanogens from the Methanomicrobiales clade. In some embodiments, the methanogens from the Methanomicrobiales clade include Methanofollis liminatans, Methanospirillum hungatei, Methanolacinia payteri, Methanococcoides blackseaense, or Methanoculleus sp.

[0273] In some embodiments, the methanogens include methanogens from the Methanomicrobium clade. In some embodiments, the methanogens from the Methanomicrobium clade include Methanomicrobium mobile.

[0274] In some embodiments, the methanogens include methanogens from the Thermoplasmatales clade. In some embodiments, the methanogens from the Thermoplasmatales clade include Thermoplasma volcanium or Thermoplasma acidophilum.

[0275] In some embodiments, the methanogens include: Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosarcina stadtmanae, Methanosarcina mazei, Methanobrevibacter coexistentis, Methanobrevibacter sp. UBA188, Methanosarcina söehngenii, Methanothermobacter thermoautotrophicus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanothermus kandleri, Methanoculleus labreanum, Methanococcoides burtonii, Methanothrix thermophila, Methanoregula boonei, Methanosphaerula palustris, Methanocorpusculum bavaricum, Methanospirillum hungatei, Methanosarcina acetivorans, or any combination thereof.

[0276] The methanogen antigen comprises any protein expressed or produced in any methanogen clade (e.g., as described herein). Exemplary methanogen antigens are provided in Table 1. In some embodiments, the methanogen antigen is the antigen provided in Table 1, or a fragment thereof, or a variant thereof. In some embodiments, the methanogen antigen has a sequence with at least 85% identity to the methanogen antigen provided in Table 1. In some embodiments, the methanogen antigen is an adhesin, e.g., mru 1499.

[0277] In some embodiments, the methanogen antigen is a peptide involved in adhesion, attachment, motility, or any combination thereof. In some embodiments, the methanogen antigen is an adhesin, a pilin, a flagellin, or any combination thereof.

[0278] In some embodiments, the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100 methanogen antigens.

[0279] In some embodiments, the polynucleotide comprises about 2 - 100, about 3 - 100, about 4 - 100, about 5 - 100, about 6 - 100, about 7 - 100, about 8 - 100, about 9 - 100, about 10 - 100, about 20 - 100, about 30 - 100, about 40 - 100, about 50 - 100, about 60 - 100, about 70 - 100, about 80 - 100, about 90 - 100, about 2 - 90, about 2 - 80, about 2 - 70, about 2 - 60, about 2 - 50, about 2 - 40, about 2 - 30, about 2 - 20, about 2 - 10, about 2 - 15, about 2 - 14, about 2 - 13, about 2 - 12, about 2 - 11, about 2 - 10, about 2 - 9, about 2 - 8, about 2 - 7, about 2 - 6, about 2 - 5, about 2 - 4, about 2 - 3 methanogen antigens.

[0280] In some embodiments, the polynucleotide comprises one or more methanogen antigens from one or more methanogens.

[0281] In some embodiments, the methanogen antigen comprises the antigen sequence provided in Table 2, or a fragment thereof, or a variant thereof, or a variant fragment thereof. In some embodiments, the methanogen antigen comprises an antigen sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the sequence provided in Table 2. The exemplary antigen sequences provided in Table 2 are not marked in bold or italic.

[0282] In some embodiments, the methanogen antigen comprises an antigenic sequence provided by any of the following: SEQ ID NO: 2, 6, 8, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 97, 98, 99, 100, 101, 102, 103, 14, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, or a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto. The antigenic sequences in SEQ ID NO: 2, 6, 8, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 97, 98, 99, 100, 101, 102, 103, 14, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 are not marked (no bold or italic).

[0283] In some embodiments, the methanogen antigen comprises an antigen encoded by an antigenic nucleotide sequence provided by any of the following: SEQ ID NO: 1, 5, 7, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92 or 94, or a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity thereto.

[0284] Table 1: Exemplary methanogen antigens.

[0285]

[0286]

[0287]

[0288] Antigens from hydrogen-producing symbionts

[0289] In some embodiments, rumen-related antigens include antigens from hydrogen-producing symbionts. In some embodiments, hydrogen-producing symbionts are microorganisms that produce rumen hydrogen in a manner similar to methanogens that reduce dairy cow efficiency.

[0290] In some embodiments, rumen-related antigens include antigens from rumen ciliates. In some embodiments, rumen ciliates are symbiotic with methanogens. In some embodiments, rumen ciliates include: Diplodinium dentatum (syn. Diplodinium denticulatum), Diploplastron affine (syn. Eudiplodinium affine), Enoploplastron triloricatum (syn. Ostracodinium triloricatum), Entodinium simplex, Entodinium caudatum acutum, Entodinium longinucleatum, Epidinium ecaudatum, Eremoplastron bovis (syn. Eudiplodinium neglectum), Eudiplodinium maggii, Ostracodinium obtusum, Polyplastron multivesiculatum, or combinations thereof.

[0291] In some embodiments, hydrogen-producing symbionts supply nutrients and / or energy (e.g., hydrogen gas) to methanogens. In some embodiments, hydrogen-producing symbionts that supply nutrients and / or energy (e.g., hydrogen gas) to methanogens include Butyrivibrio proteoclasticus, Bacteroides thetaiotaomicron, Ruminococcus flavefaciens, Ruminococcus albus, or combinations thereof.

[0292] In some embodiments, the hydrogen-producing symbionts comprise taxa associated with low feed efficiency. In some embodiments, the hydrogen-producing symbionts comprise taxa associated with low feed efficiency, including: Veillonellaceae, Prevotellaceae, Lachnospiraceae, Succinivibrionaceae, Fibrobacteraceae, Anaerovibrio, Clostridiales, Prevotella, Ruminococcaceae.

[0293] Exemplary multi-component compositions comprising rumen-related antigens

[0294] Disclosed herein are polynucleotides (e.g., RNA) comprising one or more rumen-related methanogens (e.g., rumen antigens and / or methanogen antigens). Also disclosed herein are compositions comprising said polynucleotides, and methods of preparing and using said polynucleotides for administration (e.g., vaccination) to an animal (e.g., a ruminant). In some embodiments, the polynucleotides disclosed herein comprise multiple rumen-related methanogens, e.g., multiple rumen antigens and / or multiple methanogen antigens. In some embodiments, a composition comprising such a polynucleotide is also referred to as a multi-component vaccine composition or a multivalent vaccine composition.

[0295] In some embodiments, the polynucleotide is or comprises RNA. In some embodiments, the RNA comprises a 5' cap, e.g., a 5'-5' triphosphate-linked guanosine. In some embodiments, the RNA comprises a polyA tail. In some embodiments, the RNA comprises one or more untranslated regions, e.g., 5' UTR and / or 3' UTR.

[0296] In some embodiments, the polynucleotide is an RNA comprising: (i) a 5' cap; (ii) a 5' UTR region; (iii) a sequence encoding one or more payloads (e.g., one or more rumen-related antigens); (iv) a polyA tail, and (v) a 3' UTR region. In some embodiments, the polynucleotide further comprises one or more elements, such as one or more sequences encoding additional payloads, or one or more sequences that can form a secondary structure (e.g., a hairpin or an IRES), etc. In some embodiments, the polynucleotide is a messenger RNA.

[0297] In some embodiments of the isolated polynucleotides, compositions comprising the polynucleotides, or methods of making or using the polynucleotides disclosed herein, the polynucleotide comprises one or more methanogen antigens. In some embodiments, the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 methanogen antigens. In some embodiments, one or more of the methanogen antigens are the same, e.g., antigens having the same sequence, structure, and / or function. In some embodiments, one or more of the methanogen antigens are different, e.g., antigens having different sequences, structures, and / or functions. In some embodiments, one or more of the methanogen antigens comprise a mixture of the same and different antigens. In some embodiments, one or more of the methanogen antigens are associated with one or more methanogen species. In some embodiments, one or more of the methanogen antigens are associated with a single methanogen species.

[0298] In some embodiments, one or more of the methanogen antigens comprise one or more, all, or any combination of the following: (i) one or more peptides having at least 80% sequence identity to a methanogen protein; (ii) one or more secreted antigens, e.g., each comprising a signal peptide; (iii) multiple peptides having at least 80% sequence identity to each other; (iv) multiple peptides that are associated with at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogen species; (v) one or more peptides having at least 80% sequence identity to a polypeptide having signal peptidase activity; (vi) one or more peptides having at least 80% sequence identity to an AglB polypeptide or having a substantially similar function to an AglB polypeptide; (vii) one or more peptides having at least 80% sequence identity to a polypeptide containing an Ig-like domain or having a substantially similar function to a polypeptide containing an Ig-like domain; or (viii) one or more of the methanogen antigens provided in Table 1 or a sequence having at least 85% identity thereto. In some embodiments, the polynucleotide comprises one or more methanogen antigens from each of (i)-(viii).

[0299] In some embodiments, one or more of the methanogen antigens comprise one or more peptides having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a methanogen protein. In some embodiments, the methanogen protein comprises a polypeptide encoded by a methanogen genome, or a variant or fragment thereof.

[0300] In some embodiments, one or more methanogen antigens include one or more secreted antigens. For example, one or more methanogen antigens contain a signal peptide. In some embodiments, the secreted antigen is or includes an antigen that is a surface-associated protein or a protein secreted from the cell. In some embodiments, the secreted antigen contains a signal peptide. In some embodiments, the signal peptide can be predicted using an algorithm. In some embodiments, the predicted score of the signal peptide is at least 0.5.

[0301] In some embodiments, one or more methanogen antigens contain multiple peptides that have at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with each other. In some embodiments, one or more methanogen antigens that contain at least 80% identity with each other are also referred to as cluster homology.

[0302] In some embodiments, one or more methanogen antigens contain multiple peptides that are related to at least 2 different, at least 3 different, at least 4 different, at least 5 different, at least 6 different, at least 7 different, at least 8 different, at least 9 different, at least 10 different, at least 11 different, at least 12 different, at least 15 different, or at least 20 different methanogen species.

[0303] In some embodiments, one or more methanogen antigens contain multiple peptides that are related to approximately 2 different, approximately 3 different, approximately 4 different, approximately 5 different, approximately 6 different, approximately 7 different, approximately 8 different, approximately 9 different, approximately 10 different, approximately 11 different, approximately 12 different, approximately 15 different, or approximately 20 different methanogen species.

[0304] In some embodiments, one or more methanogen antigens contain multiple peptides that are related to no more than 2 different, no more than 3 different, no more than 4 different, no more than 5 different, no more than 6 different, no more than 7 different, no more than 8 different, no more than 9 different, no more than 10 different, no more than 11 different, no more than 12 different, no more than 15 different, or no more than 20 different methanogen species.

[0305] In some embodiments, one or more methanogenic antigens comprise multiple peptides related to about 2 to about 20, about 2 to about 15, about 2 to about 12, about 2 to about 11, about 2 to about 10, about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, about 2 to about 3, about 3 to about 20, about 4 to about 20, about 5 to about 20, about 6 to about 20, about 7 to about 20, about 8 to about 20, about 9 to about 20, about 10 to about 20, about 11 to about 20, about 12 to about 20, or about 15 to about 20 different methanogenic species.

[0306] In some embodiments, one or more methanogenic antigens related to methanogenic species refer to antigens that can be found in methanogenic species. For example, methanogenic antigens related to a specific methanogenic species include antigens encoded by nucleotide sequences naturally present in the methanogenic species.

[0307] In some embodiments, one or more methanogenic antigens include methanogens from one or more or all of the following clades: Methanobrevibacter, Methanosphaera, Methanobacterium, Methanosarcinales, Methanomicrobiales, Methanothermobacter, Candida methanolytica, Thermoplasmatales.

[0308] In some embodiments, the methanogenic species are selected from: Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188, Methanosarcina söehngenii, Methanothermobacter thermautotrophicus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanothermus kandleri, Methanopyrus kandleri, Methanoculleus bourgensis, Methanothrix thermophila, Methanoregula boonei, Methanosphaerula palustris, Methanocorpusculum bavaricum, Methanospirillum hungatei, Methanosarcina acetivorans.

[0309] In some embodiments, the methanogenic species are selected from Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188 or Methanosarcina söehngenii.

[0310] In some embodiments, the methanogenic species are selected from Methanobrevibacter ruminantium, Methanobrevibacter smithii or Methanobrevibacter oralis.

[0311] In some embodiments, the methanogenic species are selected from Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile or Methanosphaera stadtmanae.

[0312] In some embodiments, one or more methanogen antigens comprise multiple methanogen antigens, wherein each methanogen antigen is associated with the same methanogen species.

[0313] In some embodiments, one or more methanogen antigens comprise one or more peptides that have at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a polypeptide having signal peptidase activity. In some embodiments, the polypeptide having signal peptidase activity has one or more (or all) of the following characteristics: (i) is membrane-bound; (ii) has the ability to cleave one or more signal peptides; and / or (iii) plays a role in converting a secreted protein into its mature form (e.g., from a non-secreted form to a secreted form).

[0314] In some embodiments, one or more methanogen antigens comprise one or more peptides that have at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with an AglB polypeptide or have a substantially similar function to an AglB polypeptide. In some embodiments, the AglB polypeptide is characterized by having N-glycosylation activity.

[0315] In some embodiments, one or more methanogen antigens comprise one or more peptides that have at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a polypeptide containing an Ig-like domain or have a substantially similar function to a polypeptide containing an Ig-like domain. In some embodiments, the polypeptide containing an Ig-like domain includes a polypeptide characterized as a cell surface protein that promotes binding to other cells and / or the cell surface.

[0316] The polypeptides containing an Ig-like domain described herein may include: (i) a protein containing a transglutaminase domain or a fragment, variant, or variant fragment thereof, (ii) a protein containing a pseudomurein-binding repeat or a fragment, variant, or variant fragment thereof, (iii) a protein containing a right-handed parallel beta-helix repeat or a fragment, variant, or variant fragment thereof, (iv) a succinylglutamate desuccinylase / aspartate acylase family protein or a fragment, variant, or variant fragment thereof, or (v) any combination of (i)-(iv).

[0317] In some embodiments, one or more methanogen antigens include one or more of the antigens provided in Table 1 or sequences having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity thereto. In some embodiments, one or more methanogen antigens include adhesins or fragments or variants thereof. In some embodiments, one or more methanogen antigens include pili proteins or fragments or variants thereof. In some embodiments, one or more methanogen antigens include flagellin proteins or fragments or variants thereof.

[0318] In some embodiments of the isolated polynucleotides, compositions comprising the polynucleotides, or methods of making or using the polynucleotides disclosed herein, the polynucleotide comprises one or more methanogen antigens. In some embodiments, the polynucleotide comprises one or more methanogen antigens selected from one or more, or all, or any combination of the following: (i) one or more peptides having at least 80% sequence identity to a methanogen protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides having at least 80% sequence identity to each other; (iv) multiple peptides related to at least 2 different, at least 3 different, at least 4 different or at least 5 different methanogen species; or (v) one or more peptides having at least 80% sequence identity to a polypeptide having signal peptidase activity. In some embodiments, the polynucleotide comprises one or more methanogen antigens from each of (i)-(v). In some embodiments, the polynucleotide comprises three methanogen antigens. In some embodiments, the three methanogen antigens are related to at least three different methanogen species, e.g., Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis. Exemplary multi-component compositions are described in Table 3.

[0319] In some embodiments of the isolated polynucleotides, compositions comprising the polynucleotides, or methods of making or using the polynucleotides disclosed herein, the polynucleotide comprises one or more methanogen antigens. In some embodiments, the polynucleotide comprises one or more methanogen antigens selected from one or more, or all, or any combination of the following: (i) one or more peptides having at least 80% sequence identity to a methanogen protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides that are related to at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogen species; or (iv) one or more peptides having at least 80% sequence identity to an AglB polypeptide or having a substantially similar function to an AglB polypeptide. In some embodiments, the polynucleotide comprises one or more methanogen antigens from each of (i)-(iv). In some embodiments, the polynucleotide comprises five methanogen antigens. In some embodiments, the five methanogen antigens are related to at least five different methanogen species, e.g., Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanosarcina stadtmanae. Exemplary multi-component compositions are described in Table 3.

[0320] In some embodiments of the isolated polynucleotides, compositions comprising the polynucleotides, or methods of making or using the polynucleotides disclosed herein, the polynucleotide comprises one or more methanogen antigens. In some embodiments, the polynucleotide comprises one or more methanogen antigens selected from one or more, or all, or any combination of the following: (i) one or more peptides having at least 80% sequence identity to a methanogen protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides that have at least 80% sequence identity to each other; (iv) multiple peptides that are related to at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogen species; or (v) one or more peptides having at least 80% sequence identity to a polypeptide containing an Ig-like domain or having a substantially similar function to a polypeptide containing an Ig-like domain. In some embodiments, the polynucleotide comprises one or more methanogen antigens from each of (i)-(v). In some embodiments, the polynucleotide comprises eight methanogen antigens. In some embodiments, the eight methanogen antigens are related to at least three different methanogen species, e.g., Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis. Exemplary multi-component compositions are described in Table 3.

[0321] In some embodiments of the isolated polynucleotides, compositions comprising the polynucleotides, or methods of preparing or using the polynucleotides disclosed herein, the polynucleotide comprises one or more methanogen antigens. In some embodiments, the polynucleotide comprises one or more methanogen antigens selected from one or more, or all, or any combination of the following: (i) one or more peptides having at least 80% sequence identity with a methanogen protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides having at least 80% sequence identity with each other; (iv) multiple peptides associated with at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogen species; or (v) one or more peptides having at least 80% sequence identity with a polypeptide containing an Ig-like domain or having a function substantially similar to a polypeptide containing an Ig-like domain. In some embodiments, the polynucleotide comprises one or more methanogen antigens from each of (i)-(v). In some embodiments, the polynucleotide comprises 34 methanogen antigens. In some embodiments, one or more methanogen antigens are associated with at least five different methanogen species, e.g., Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188. Exemplary multi-component compositions are described in Table 5.

[0322] In some embodiments, the compositions disclosed herein comprise one or more polynucleotides, the polynucleotide comprising one or more rumen-related antigens, e.g., methanogen antigens. In some embodiments, the composition (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises multiple polynucleotides (e.g., multiple RNAs), each polynucleotide comprising an antigen. In some embodiments, the composition (e.g., a multi-component composition, a multi-component vaccine composition) comprises multiple polynucleotides (e.g., multiple RNAs), each polynucleotide comprising one or more antigens (e.g., the same or different antigens).

[0323] In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 1% of a first polynucleotide and about 99% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 5% of a first polynucleotide and about 95% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 10% of a first polynucleotide and about 90% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 20% of a first polynucleotide and about 80% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 30% of a first polynucleotide and about 70% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 40% of a first polynucleotide and about 60% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 50% of a first polynucleotide and about 50% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 60% of a first polynucleotide and about 40% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 70% of a first polynucleotide and about 30% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 80% of a first polynucleotide and about 20% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 90% of a first polynucleotide and about 10% of one or more additional polynucleotides. In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises about 99% of a first polynucleotide and about 1% of one or more additional polynucleotides.

[0324] In some embodiments, a composition comprising multiple polynucleotides (e.g., a multi-component composition, e.g., a multi-component vaccine composition) comprises approximately 33% of a first polynucleotide, approximately 33% of a second polynucleotide, and approximately 33% of a third polynucleotide.

[0325] Exemplary methanogen antigens disclosed herein can be obtained, for example, from a sequenced sample of the rumen of an animal (e.g., a ruminant). Sequencing a sample from the rumen of an animal (e.g., a ruminant) can provide information about specific protein targets and / or specific species (e.g., methanogen species). Additionally, methanogen antigens can also be obtained by using a list (e.g., a defined list) of target species (e.g., methanogens), which is readily determinable by a person with knowledge of the relevant field. Additionally or alternatively, methanogen antigens can also be obtained by using algorithms or language models (such as those known in the art) to generate de novo proteins or variants or structures of related sequences.

[0326] Accordingly, provided herein is also a method of identifying one or more methanogen antigens for use in the polynucleotides or compositions comprising the polynucleotides disclosed herein, e.g., for vaccination of an animal (e.g., a ruminant).

[0327] Acetylated nucleotide

[0328] In addition thereto, provided herein are polynucleotides comprising one or more modified ribonucleotides, the modified ribonucleotides comprising a nucleoside comprising an acetyl group. In some embodiments, the nucleoside of the modified ribonucleotide is N4-acetylcytidine, and the modified ribonucleotide has: a 5'-monophosphate, a 5'-diphosphate, or a 5'-triphosphate. International Patent Application PCT / US22 / 27721, filed on July 18, 2022, provides additional details regarding polynucleotides comprising one or more modified ribonucleotides (comprising a nucleoside comprising an acetyl group), the entire content of which is hereby incorporated by reference.

[0329] In some embodiments, the nucleoside of the modified ribonucleotide is N4-acetylcytidine, and the modified ribonucleotide has the following structure:

[0330]

[0331] wherein R is a 5'-monophosphate, a 5'-diphosphate, or a 5'-triphosphate.

[0332] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues. In some embodiments, at least 5% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine. In some embodiments, less than 100% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0333] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 5% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0334] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 10% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0335] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 15% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0336] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 20% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0337] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 25% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0338] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 30% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0339] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 35% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0340] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 40% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0341] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 45% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0342] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 50% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0343] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 55% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0344] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 60% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0345] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 65% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0346] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 70% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0347] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 75% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0348] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 80% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0349] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 85% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0350] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 90% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0351] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and at least 95% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0352] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues. In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0353] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 60% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0354] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 65% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0355] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 70% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0356] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 75% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0357] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 80% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0358] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 85% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0359] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 90% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0360] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 95% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0361] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and more than about 99% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0362] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 5% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0363] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 10% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0364] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 15% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0365] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 20% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0366] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 25% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0367] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 30% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0368] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 35% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0369] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 40% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0370] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 45% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0371] In some embodiments, the polynucleotides disclosed herein comprise cytidine residues, and about 50% of the cytidine residues in the polynucleotide comprise N4-acetylcytidine.

[0372] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 55% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0373] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 60% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0374] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 65% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0375] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 75% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0376] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 80% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0377] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 85% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0378] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 90% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0379] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 95% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0380] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and about 99% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0381] In some embodiments, the polyribonucleotides disclosed herein comprise cytidine residues, and 100% of the cytidine residues in the polyribonucleotides comprise N4-acetylcytidine.

[0382] In some embodiments, the polynucleotides disclosed herein (e.g., polynucleotides comprising cytidine residues, wherein about 5%-100% of the cytidine residues comprise N4-acetylcytidine) comprise one or more additional modified ribonucleotides. In some embodiments, the one or more additional modified ribonucleotides comprise a nucleoside selected from adenosine, inosine, guanosine, cytidine, or uridine, or any combination thereof. In some embodiments, the one or more additional modified ribonucleotides comprise 5-hydroxymethyl. In some embodiments, the one or more additional modified ribonucleotides comprise 5-hydroxymethyluridine. In some embodiments, 5%-100% of the uridine residues in the polynucleotide comprising uridine are 5-hydroxymethyluridine.

[0383] In some embodiments, the length of the polynucleotide can be at least 5 nucleotides or longer. In some embodiments, the length of the polynucleotide can be at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 55 nucleotides, at least 60 nucleotides, at least 65 nucleotides, at least 70 nucleotides, at least 75 nucleotides, at least 80 nucleotides, at least 85 nucleotides, at least 90 nucleotides, at least 95 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 1000 nucleotides, at least 2000 nucleotides, at least 5000 nucleotides or longer.

[0384] In some embodiments, the length of the polynucleotide can be from about 5 nucleotides to about 200,000 nucleotides, from about 5 nucleotides to about 150,000 nucleotides, from about 5 nucleotides to about 100,000 nucleotides, from about 5 nucleotides to about 50,000 nucleotides, from about 5 nucleotides to about 10,000 nucleotides, from about 5 nucleotides to about 5000 nucleotides, from about 5 nucleotides to about 1000 nucleotides, from about 5 nucleotides to about 500 nucleotides, from about 5 nucleotides to about 400 nucleotides, from about 5 nucleotides to about 300 nucleotides, from about 5 nucleotides to about 200 nucleotides, from about 5 nucleotides to about 100 nucleotides, from about 5 nucleotides to about 90 nucleotides, from about 5 nucleotides to about 85 nucleotides, from about 5 nucleotides to about 80 nucleotides, from about 5 nucleotides to about 75 nucleotides, from about 5 nucleotides to about 70 nucleotides, from about 5 nucleotides to about 65 nucleotides, from about 5 nucleotides to about 60 nucleotides, from about 5 nucleotides to about 55 nucleotides, from about 5 nucleotides to about 50 nucleotides, from about 5 nucleotides to about 45 nucleotides, from about 5 nucleotides to about 40 nucleotides, from about 5 nucleotides to about 35 nucleotides, from about 5 nucleotides to about 30 nucleotides, from about 5 nucleotides to about 25 nucleotides, from about 5 nucleotides to about 20 nucleotides, from about 5 nucleotides to about 15 nucleotides, from about 5 nucleotides to about 10 nucleotides.

[0385] In some embodiments, the length of the polynucleotide may be from about 5 nucleotides to about 200,000 nucleotides, from about 10 nucleotides to about 200,000 nucleotides, from 15 nucleotides to about 200,000 nucleotides, from about 20 nucleotides to about 200,000 nucleotides, from about 30 nucleotides to about 200,000 nucleotides, from about 40 nucleotides to about 200,000 nucleotides, from about 50 nucleotides to about 200,000 nucleotides, from about 100 nucleotides to about 200,000 nucleotides, from about 200 nucleotides to about 200,000 nucleotides, from about 300 nucleotides to about 200,000 nucleotides, from about 400 nucleotides to about 200,000 nucleotides, from about 500 nucleotides to about 200,000 nucleotides, from about 1000 nucleotides to about 200,000 nucleotides, from about 2000 nucleotides to about 200,000 nucleotides, from about 3000 nucleotides to about 200,000 nucleotides, from about 4000 nucleotides to about 200,000 nucleotides, from about 5000 nucleotides to about 200,000 nucleotides, from about 10,000 nucleotides to about 200,000 nucleotides, from about 20,000 nucleotides to about 200,000 nucleotides, from about 30,000 nucleotides to about 200,000 nucleotides, from about 40,000 nucleotides to about 200,000 nucleotides, from about 50,000 nucleotides to about 200,000 nucleotides, from about 100,000 nucleotides to about 200,000 nucleotides, from about 150,000 nucleotides to about 200,000 nucleotides.

[0386] In some embodiments, the length of the polynucleotide may be no more than 200,000 nucleotides, no more than 150,000 nucleotides, no more than 100,000 nucleotides or no more than 50,000 nucleotides.

[0387] 5-hydroxymethyl-modified nucleotide

[0388] In addition, provided herein are polynucleotides comprising one or more modified ribonucleotides, wherein the modified ribonucleotides comprise a nucleoside comprising 5-hydroxymethyl. In some embodiments, the nucleoside of the modified ribonucleotide is 5-hydroxymethyluridine, and the modified ribonucleotide has: a 5'-monophosphate, a 5'-diphosphate or a 5'-triphosphate. International Patent Application PCT / US22 / 27721, filed on July 18, 2022, provides additional details regarding ribonucleotides comprising a nucleoside comprising 5-hydroxymethyl, the entire content of which is hereby incorporated by reference.

[0389] In some embodiments, the nucleoside of the modified ribonucleotide is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure:

[0390]

[0391] Wherein R is a 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0392] In some embodiments, the polynucleotides disclosed herein comprise uridine residues. In some embodiments, at least 5% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine. In some embodiments, less than 100% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0393] In some embodiments, the polynucleotides disclosed herein comprise uridine residues, and at least 5% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0394] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 10% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0395] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 15% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0396] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 20% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0397] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 25% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0398] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 30% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0399] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 35% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0400] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 40% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0401] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 45% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0402] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 50% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0403] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 55% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0404] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 60% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0405] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 65% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0406] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 70% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0407] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 75% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0408] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 80% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0409] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 85% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0410] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 90% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0411] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and at least 95% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0412] In some embodiments, the polynucleotides disclosed herein comprise uridine residues, and at least 99% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0413] In some embodiments, the polynucleotides disclosed herein comprise uridine residues. In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65%, about 5% to 60%, about 5% to 55%, about 5% to 50%, about 5% to 45%, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25%, about 5% to 20%, about 5% to 15%, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0414] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 60% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0415] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 65% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0416] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 70% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0417] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 75% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0418] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 80% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0419] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 85% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0420] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 90% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0421] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 95% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0422] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and more than 99% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0423] In some embodiments, the polynucleotides disclosed herein comprise uridine residues, and about 5% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0424] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 10% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0425] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 15% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0426] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 20% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0427] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 25% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0428] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 30% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0429] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 35% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0430] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 40% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0431] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 45% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0432] In some embodiments, the polynucleotides disclosed herein comprise uridine residues and about 50% of the uridine residues in the polynucleotide comprise 5-hydroxymethyluridine.

[0433] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 55% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0434] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 60% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0435] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 65% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0436] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 75% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0437] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 80% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0438] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 85% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0439] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 90% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0440] In some embodiments, the polynucleotides disclosed herein contain uridine residues and about 95% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0441] In some embodiments, the polynucleotides disclosed herein contain uridine residues, and about 99% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0442] In some embodiments, the polynucleotides disclosed herein contain uridine residues, and 100% of the uridine residues in the polynucleotide contain 5-hydroxymethyluridine.

[0443] In some embodiments, the polyribonucleotides disclosed herein (e.g., polyribonucleotides comprising uridine residues, wherein about 5%-100% of the uridine residues comprise 5-hydroxymethyluridine) comprise one or more additional modified ribonucleotides in addition to 5-hydroxymethyluridine. In some embodiments, the one or more additional modified ribonucleotides comprise nucleosides selected from adenosine, inosine, guanosine, cytidine, or uridine, or any combination thereof. In some embodiments, the one or more additional modified ribonucleotides comprise an acetyl group. In some embodiments, the one or more additional modified ribonucleotides comprise N4-acetylcytidine. In some embodiments, 5%-100% of the cytidine residues in the polyribonucleotide comprising cytidine are N4-acetylcytidine.

[0444] In some embodiments, the length of the polyribonucleotide can be at least 5 nucleotides or longer. In some embodiments, the length of the polyribonucleotide can be at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 55 nucleotides, at least 60 nucleotides, at least 65 nucleotides, at least 70 nucleotides, at least 75 nucleotides, at least 80 nucleotides, at least 85 nucleotides, at least 90 nucleotides, at least 95 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 1000 nucleotides, at least 2000 nucleotides, at least 5000 nucleotides, or longer.

[0445] In some embodiments, the length of the polynucleotide can be from about 5 nucleotides to about 200,000 nucleotides, from about 5 nucleotides to about 150,000 nucleotides, from about 5 nucleotides to about 100,000 nucleotides, from about 5 nucleotides to about 50,000 nucleotides, from about 5 nucleotides to about 10,000 nucleotides, from about 5 nucleotides to about 5000 nucleotides, from about 5 nucleotides to about 1000 nucleotides, from about 5 nucleotides to about 500 nucleotides, from about 5 nucleotides to about 400 nucleotides, from about 5 nucleotides to about 300 nucleotides, from about 5 nucleotides to about 200 nucleotides, from about 5 nucleotides to about 100 nucleotides, from about 5 nucleotides to about 90 nucleotides, from about 5 nucleotides to about 85 nucleotides, from about 5 nucleotides to about 80 nucleotides, from about 5 nucleotides to about 75 nucleotides, from about 5 nucleotides to about 70 nucleotides, from about 5 nucleotides to about 65 nucleotides, from about 5 nucleotides to about 60 nucleotides, from about 5 nucleotides to about 55 nucleotides, from about 5 nucleotides to about 50 nucleotides, from about 5 nucleotides to about 45 nucleotides, from about 5 nucleotides to about 40 nucleotides, from about 5 nucleotides to about 35 nucleotides, from about 5 nucleotides to about 30 nucleotides, from about 5 nucleotides to about 25 nucleotides, from about 5 nucleotides to about 20 nucleotides, from about 5 nucleotides to about 15 nucleotides, from about 5 nucleotides to about 10 nucleotides.

[0446] In some embodiments, the length of the polynucleotide may be from about 5 nucleotides to about 200,000 nucleotides, from about 10 nucleotides to about 200,000 nucleotides, from 15 nucleotides to about 200,000 nucleotides, from about 20 nucleotides to about 200,000 nucleotides, from about 30 nucleotides to about 200,000 nucleotides, from about 40 nucleotides to about 200,000 nucleotides, from about 50 nucleotides to about 200,000 nucleotides, from about 100 nucleotides to about 200,000 nucleotides, from about 200 nucleotides to about 200,000 nucleotides, from about 300 nucleotides to about 200,000 nucleotides, from about 400 nucleotides to about 200,000 nucleotides, from about 500 nucleotides to about 200,000 nucleotides, from about 1000 nucleotides to about 200,000 nucleotides, from about 2000 nucleotides to about 200,000 nucleotides, from about 3000 nucleotides to about 200,000 nucleotides, from about 4000 nucleotides to about 200,000 nucleotides, from about 5000 nucleotides to about 200,000 nucleotides, from about 10,000 nucleotides to about 200,000 nucleotides, from about 20,000 nucleotides to about 200,000 nucleotides, from about 30,000 nucleotides to about 200,000 nucleotides, from about 40,000 nucleotides to about 200,000 nucleotides, from about 50,000 nucleotides to about 200,000 nucleotides, from about 100,000 nucleotides to about 200,000 nucleotides, from about 150,000 nucleotides to about 200,000 nucleotides.

[0447] In some embodiments, the length of the polynucleotide may be no more than 200,000 nucleotides, no more than 150,000 nucleotides, no more than 100,000 nucleotides or no more than 50,000 nucleotides.

[0448] SBI adjuvant

[0449] The polynucleotides encoding one or more rumen-related antigens disclosed herein may further comprise a sequence encoding an adjuvant.

[0450] In some embodiments, the adjuvants disclosed herein can be used to initiate and / or modulate an immune response elicited by the antigens described herein (e.g., fragment antigens or antigen variants). In some embodiments, the adjuvants disclosed herein comprise a complement-binding polypeptide. In some embodiments, the complement-binding polypeptide includes a complement C3d-binding polypeptide. An exemplary C3d-binding polypeptide is the immunoglobulin-binding protein (Sbi) of Staphylococcus aureus.

[0451] As disclosed herein, the Staphylococcus aureus binder of immunoglobulin (Sbi) is an exemplary polypeptide that can bind complement C3d (as described in Clark et al. (2011) Mol Immunol. 48(4):452–462, the entire content of which is incorporated herein by reference). Sbi contains two immunoglobulin-binding domains (domains I and II) and two complement C3d-binding domains (domains III and IV). Sbi domains III and IV can bind C3d (in native C3, iC3b, and C3dg) and can cause fluid-phase depletion of C3 via the alternative activation pathway (see Clark et al. 2011). It has also been shown that Sbi can be secreted and is involved in Staphylococcus aureus immune evasion (Burman et al., 2008 J. Biol. Chem; 283:17579–17593).

[0452] Without wishing to be bound by theory, it is believed that in some embodiments, the complement C3d-binding polypeptide from Staphylococcus aureus Sbi can be used as an adjuvant for enhancing and / or modulating an immune response to an antigen as described herein. In some embodiments, the immune response is elicited by a fragment antigen or antigen variant disclosed herein. In some embodiments, the immune response is elicited by a component of Sbi of Staphylococcus aureus.

[0453] Exemplary Sbi adjuvants and compositions containing such adjuvants are disclosed in International Patent Application PCT / US2022 / 018610, filed on March 3, 2022, the entire content of which is hereby incorporated by reference.

[0454] Composition

[0455] In addition thereto, the present disclosure provides a composition comprising one or more rumen-related antigens (e.g., one or more rumen antigens and / or one or more methanogen antigens). The compositions disclosed herein may also include a polynucleotide encoding the rumen-related antigen.

[0456] In some embodiments, the composition disclosed herein comprises a polynucleotide comprising a first nucleotide sequence encoding one or more rumen antigens and a second nucleotide sequence encoding one or more methanogen antigens.

[0457] In some embodiments, the first nucleotide sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100 rumen antigens.

[0458] In some embodiments, the first nucleotide sequence comprises about 2 - 100, about 3 - 100, about 4 - 100, about 5 - 100, about 6 - 100, about 7 - 100, about 8 - 100, about 9 - 100, about 10 - 100, about 20 - 100, about 30 - 100, about 40 - 100, about 50 - 100, about 60 - 100, about 70 - 100, about 80 - 100, about 90 - 100, about 2 - 90, about 2 - 80, about 2 - 70, about 2 - 60, about 2 - 50, about 2 - 40, about 2 - 30, about 2 - 20, about 2 - 10, about 2 - 15, about 2 - 14, about 2 - 13, about 2 - 12, about 2 - 11, about 2 - 10, about 2 - 9, about 2 - 8, about 2 - 7, about 2 - 6, about 2 - 5, about 2 - 4, about 2 - 3 rumen antigens.

[0459] In some embodiments, the second nucleotide sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100 methanogen antigens.

[0460] In some embodiments, the second nucleotide sequence comprises about 2 - 100, about 3 - 100, about 4 - 100, about 5 - 100, about 6 - 100, about 7 - 100, about 8 - 100, about 9 - 100, about 10 - 100, about 20 - 100, about 30 - 100, about 40 - 100, about 50 - 100, about 60 - 100, about 70 - 100, about 80 - 100, about 90 - 100, about 2 - 90, about 2 - 80, about 2 - 70, about 2 - 60, about 2 - 50, about 2 - 40, about 2 - 30, about 2 - 20, about 2 - 10, about 2 - 15, about 2 - 14, about 2 - 13, about 2 - 12, about 2 - 11, about 2 - 10, about 2 - 9, about 2 - 8, about 2 - 7, about 2 - 6, about 2 - 5, about 2 - 4, about 2 - 3 methanogenic antigens.

[0461] In some embodiments, the compositions disclosed herein comprise polynucleotides comprising one or more rumen - associated antigens and polynucleotides comprising one or more cytokines and / or chemokines. In some embodiments, the cytokines and / or chemokines are expressed in ruminants. In some embodiments, the cytokines and / or chemokines are or include VIP, CXCL10, APRIL, or any combination thereof.

[0462] In some embodiments, the cytokines and / or chemokines comprise the sequence provided by any one of SEQ ID NO:9, 11, or 13 or a sequence having at least 85% identity thereto. The cytokine / chemokine sequences are underlined in SEQ ID NO:9, 11, or 13.

[0463] In some embodiments, the cytokines and / or chemokines include a polypeptide encoded by the cytokine and / or chemokine nucleotide sequence provided by any one of SEQ ID NO:8, 10, or 12 or a sequence having at least 85% identity thereto. The cytokine and / or chemokine sequences are underlined in SEQ ID NO:8, 10, and 12.

[0464] In some embodiments, the compositions disclosed herein are pharmaceutical compositions.

[0465] In some embodiments, the compositions disclosed herein are immunogenic compositions.

[0466] In some embodiments, the compositions disclosed herein are vaccine compositions.

[0467] In some embodiments, the compositions disclosed herein are administered in a dose of from about 5 ng to about 1000 ng, from about 5 ng to about 900 ng, from about 5 ng to about 800 ng, from about 5 ng to about 700 ng, from about 5 ng to about 600 ng, from about 5 ng to about 500 ng, from about 5 ng to about 400 ng, from about 5 ng to about 300 ng, from about 5 ng to about 200 ng, from about 5 ng to about 100 ng, from about 5 ng to about 90 ng, from about 5 ng to about 80 ng, from about 5 ng to about 70 ng, from about 5 ng to about 60 ng, from about 5 ng to about 50 ng, from about 5 ng to about 40 ng, from about 5 ng to about 30 ng, from about 5 ng to about 20 ng, or from about 5 ng to about 10 ng. In some embodiments, the compositions disclosed herein are administered in a dose of from about 10 ng to about 1000 ng, from about 20 ng to about 1000 ng, from about 30 ng to about 1000 ng, from about 40 ng to about 1000 ng, from about 50 ng to about 1000 ng, from about 60 ng to about 1000 ng, from about 70 ng to about 1000 ng, from about 80 ng to about 1000 ng, from about 90 ng to about 1000 ng, from about 100 ng to about 1000 ng, from about 200 ng to about 1000 ng, from about 300 ng to about 1000 ng, from about 40 ng to about 1000 ng, from about 50 ng to about 1000 ng, from about 60 ng to about 1000 ng, from about 700 ng to about 1000 ng, from about 800 ng to about 1000 ng, or from about 900 ng to about 1000 ng.

[0468] In some embodiments, the compositions disclosed herein are administered in a dose of about 5 ng, about 10 ng, about 20 ng, about 30 ng, about 40 ng, about 50 ng, about 60 ng, about 70 ng, about 80 ng, about 90 ng, about 100 ng, 150 ng, about 200 ng, about 250 ng, about 300 ng, about 350 ng, about 400 ng, about 450 ng, about 500 ng, about 550 ng, about 600 ng, about 650 ng, about 700 ng, about 750 ng, about 800 ng, about 850 ng, about 900 ng, about 950 ng, or about 1000 ng.

[0469] In some embodiments, the compositions disclosed herein are administered in a dose of at least 5 ng, at least 10 ng, at least 20 ng, at least 30 ng, at least 40 ng, at least 50 ng, at least 60 ng, at least 70 ng, at least 80 ng, at least 90 ng, at least 100 ng, at least 150 ng, at least 200 ng, at least 250 ng, at least 300 ng, at least 350 ng, at least 400 ng, at least 450 ng, at least 500 ng, at least 550 ng, at least 600 ng, at least 650 ng, at least 700 ng, at least 750 ng, at least 800 ng, at least 850 ng, at least 900 ng, at least 950 ng, or at least 1000 ng.

[0470] pharmaceutical composition

[0471] In some embodiments, a composition comprising one or more rumen-related antigens is a pharmaceutical composition. In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient. The pharmaceutical compositions of the present disclosure comprise the polypeptides disclosed herein, the polynucleotides disclosed herein, or an expression vector comprising the polynucleotides disclosed herein.

[0472] In some embodiments, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier or excipient, as used herein, which includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surfactants, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants, etc., as are suitable for the particular dosage form desired. Remington's The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference) discloses various excipients for formulating pharmaceutical compositions and their known preparation techniques. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions (e.g., NaCl), saline, buffered saline, glycerol, sugars (such as mannitol, sucrose, or others), dextrose, fatty acid esters, and the like, and combinations thereof.

[0473] If desired, the pharmaceutical composition may be admixed with adjuvants (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifying agents, salts for influencing osmotic pressure, buffers, coloring agents, flavoring agents, and / or aromatic substances, etc.), which do not react harmfully with the active compound or interfere with its activity. In certain embodiments, a water-soluble carrier suitable for intravenous administration is used. In some embodiments, the pharmaceutical composition may be sterile.

[0474] If desired, suitable pharmaceutical compositions may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The pharmaceutical compositions can be in the form of liquid solutions, suspensions, or emulsions.

[0475] The pharmaceutical compositions can be formulated according to conventional procedures into pharmaceutical compositions suitable for administration to humans. The formulation of the pharmaceutical compositions should be suitable for the mode of administration. For example, in some embodiments, a composition for intravenous administration is generally a solution in a sterile isotonic aqueous buffer. If necessary, the composition may also include solubilizing agents and local anesthetics to alleviate pain at the injection site. Generally, the components are provided individually or mixed together in unit dosage form, such as as a dry lyophilized powder or an anhydrous concentrate in a sealed container, such as an ampoule or sachet, indicating the amount of the active agent. When the pharmaceutical composition is administered by infusion, an infusion bottle containing sterile pharmaceutical grade water, saline, or dextrose / water can be used for dispensing. When the pharmaceutical composition is administered by injection, ampoules of sterile water for injection or saline can be provided so that the components can be mixed before administration.

[0476] Although the description of the pharmaceutical compositions provided herein mainly relates to pharmaceutical compositions suitable for ethical administration to humans, those skilled in the art will understand that such compositions are generally suitable for in vitro or ex vivo administration to all kinds of animals or cells. To render the compositions suitable for in vitro or ex vivo administration to various animals or cells, it is well known to modify pharmaceutical compositions suitable for administration to humans, and an ordinary skilled person in the art, such as a veterinary pharmacologist, can design and / or perform such modifications using only ordinary experiments, if any.

[0477] The formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the field of pharmacology. Generally, such preparation methods include the steps of associating the active ingredient with a diluent or another excipient and / or one or more other auxiliary components, and then, if necessary and / or desired, shaping and / or packaging the product into the desired single-dose or multi-dose unit.

[0478] The pharmaceutical compositions according to the present disclosure can be prepared, packaged, and / or sold as a single unit dose and / or as multiple unit doses in batches. As used herein, "unit dose" is a discrete amount of the pharmaceutical composition described herein.

[0479] RNA formulations

[0480] In addition thereto, the present disclosure provides compositions and their formulations comprising polynucleotides containing rumen-related antigens. In some embodiments, the compositions comprising the polynucleotides disclosed herein are formulated into lipid nanoparticle (LNP) formulations.

[0481] In some embodiments, the polynucleotides disclosed herein encode polypeptides. In some embodiments, the polynucleotides disclosed herein are or comprise messenger RNA. In some embodiments, a composition comprising a polynucleotide comprising messenger RNA is formulated as a lipid nanoparticle (LNP) formulation.

[0482] In some embodiments, the present disclosure provides an LNP formulation comprising a polynucleotide disclosed herein for a pharmaceutical composition (e.g., an immunogenic composition).

[0483] Methods of using the compositions disclosed herein

[0484] In addition thereto, the present disclosure provides methods for using a polynucleotide disclosed herein or a composition comprising said polynucleotide.

[0485] In some embodiments, the present disclosure provides a method of administering a polynucleotide disclosed herein or a composition comprising a polynucleotide disclosed herein to a cell, tissue or animal (e.g., a ruminant).

[0486] In some embodiments, the present disclosure provides an administration method, e.g., a vaccination method, comprising administering a polynucleotide disclosed herein or a composition comprising a polynucleotide disclosed herein to a cell, tissue or animal (e.g., a ruminant). In some embodiments, ruminants include cattle, sheep, goats, water buffalo, moose, antelopes, reindeer or deer, or combinations thereof.

[0487] In some embodiments, the compositions disclosed herein are characterized in that when administered to an animal, they reduce the methane emissions of the animal compared to other comparable animals that have not received the composition or have received a different composition. In some embodiments, the methane emissions are reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% compared to the methane emissions of other comparable animals that have not received the composition or have received a different composition. In some embodiments, the methane emissions are reduced by at least 5%.

[0488] In some embodiments, the methane emissions are reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or about 90% compared to the methane emissions of other comparable animals that have not received the composition or have received a different composition.

[0489] In some embodiments, the methane emissions are reduced by about 5% to about 95%, about 5% to about 90%, about 5% to about 85%, about 5% to about 80%, about 5% to about 75%, about 5% to about 70%, about 5% to about 65%, about 5% to about 60%, about 5% to about 55%, about 5% to about 50%, about 5% to about 45%, about 5% to about 40%, about 5% to about 35%, about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 5% to about 10%, about 10% to about 95%, about 15% to about 95%, about 20% to about 95%, about 25% to about 95%, about 30% to about 95%, about 35% to about 95%, about 40% to about 95%, about 45% to about 95%, about 50% to about 95%, about 55% to about 95%, about 60% to about 95%, about 65% to about 95%, about 70% to about 95%, about 75% to about 95%, about 80% to about 95%, about 85% to about 95%, about 90% to about 95% compared to the methane emissions of other comparable animals that have not received the composition or have received a different composition.

[0490] In some embodiments, the compositions disclosed herein are characterized in that, when administered to an animal, they reduce the microbial population in the animal compared to an animal that has not been administered the composition or has been administered a different composition. In some embodiments, the microbes include methanogens. In some embodiments, the methanogens are selected from Methanobrevibacter, Methanosphaera, Methanobacterium, Methanosarcinales, Methanomicrobiales, Thermoplasmatales, or combinations thereof. In some embodiments, the methanogens include Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188, Methanosarcina söhngenii, Methanothermobacter thermoautotrophicus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanothermus kandleri, Methanopyrus kandleri, Methanoplanus limicola, Methanocalculus bourgensis, Methanothrix thermophila, Methanoregula boonei, Methanosphaerula palustris, Methanoculleus marisnigri, Methanospirillum hungatei, Methanosarcina acetivorans, or any combination thereof. In some embodiments, the methanogen abundance is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to the methanogen abundance in other comparable animals that have not been administered the composition or have been administered a different composition. In some embodiments, the methanogen abundance is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to the methanogen abundance in other comparable animals that have not been administered the composition or have been administered a different composition.

[0491] In some embodiments, the compositions disclosed herein are characterized in that when administered to an animal, the composition reduces the abundance of all or substantially all methanogens (e.g., total methanogen abundance) in the animal compared to the total methanogen abundance in other comparable animals that have not received the composition or have received a different composition. In some embodiments, the methanogen abundance (e.g., total methanogen abundance) is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to the methanogen abundance in other comparable animals that have not received the composition or have received a different composition. In some embodiments, the methanogen abundance (e.g., total methanogen abundance) is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% compared to the methanogen abundance in other comparable animals that have not received the composition or have received a different composition.

[0492] In some embodiments, the compositions disclosed herein are characterized in that when administered to an animal, the composition reduces the abundance of the same methanogen species in the animal compared to the abundance of at least one methanogen species in other comparable animals that have not received the composition or have received a different composition. In some embodiments, the same methanogen species is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% compared to the abundance of at least one methanogen species in other comparable animals that have not received the composition or have received a different composition. In some embodiments, the abundance of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 18, at least 19, at least 20 methanogen species is reduced.

[0493] In some embodiments, the compositions disclosed herein are characterized in that, when administered to an animal, the composition increases the growth rate of the animal as compared to the growth rate of other comparable animals that have not been administered the composition or have been administered a different composition. In some embodiments, the growth rate is evaluated by measuring the weight of the animal at one or more time points. In some embodiments, the growth rate is evaluated by measuring the weight of the animal at one or more time points. In some embodiments, the weight of the animal is measured daily. In some embodiments, the growth rate of the animal increases over a period of time. In some embodiments, the period of time includes at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months. In some embodiments, the increase in growth rate includes a daily increase in the weight of the animal. In some embodiments, the daily increase in the weight of the animal is an increase of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% as compared to the weight of other comparable animals that have not been administered the composition or have been administered a different composition. In some embodiments, the daily increase in the weight of the animal is an increase of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, or about 90% as compared to the weight of other comparable animals that have not been administered the composition or have been administered a different composition.

[0494] In some embodiments, the compositions disclosed herein are characterized in that, when administered to an animal, the composition improves the energy efficiency of the animal as compared to the energy efficiency of other comparable animals that have not been administered the composition or have been administered a different composition. In some embodiments, improving the energy efficiency includes improving the digestion efficiency. In some embodiments, the digestion efficiency includes one or more or all of the following parameters: (i) the rate of weight gain, (ii) the relationship between weight and intake, or (iii) milk quality. In some embodiments, the milk quality can be evaluated by: weight gain indicators (e.g., average daily gain (ADG) of cattle), intake to weight indicators (e.g., feed conversion ratio or residual feed intake), and / or milk composition indicators. In some embodiments, improving the digestion efficiency includes reducing digestion-related disorders in the animal (e.g., ruminant).

[0495] In some embodiments, the compositions disclosed herein are characterized in that, when administered to an animal, the composition alters the yield of cellulose fermentation.

[0496] In some embodiments, the compositions disclosed herein are administered in one dose. In some embodiments, the compositions are administered in multiple doses. In some embodiments, the composition is administered in a first dose of the composition, followed by one or more subsequent doses of the composition. In some embodiments, the first dose and one or more subsequent doses of the composition comprise the same methanogen antigen and / or rumen antigen. In some embodiments, the first dose and one or more subsequent doses of the composition comprise different methanogen antigens and / or rumen antigens.

[0497] In some embodiments, one or more methanogen antigens and / or one or more rumen antigens are specific for an animal. In some embodiments, one or more methanogen antigens and / or one or more rumen antigens specific for an animal are obtained by a method comprising: (i) identifying one or more methanogen antigens and / or one or more rumen antigens expressed in the animal; and (ii) in response to said identification, selecting one or more methanogen antigens and / or one or more rumen antigens to be included in the composition. In some embodiments, one or more methanogen antigens and / or one or more rumen antigens specific for an animal are different from one or more methanogen antigens and / or one or more rumen antigens specific for a different animal. In some embodiments, different animals include any one or all of the following: (i) animals of different species, (ii) animals of different genders, (iii) animals of different ages, or (iv) animals located in different geographical locations, or (v) the same animal at different time points.

[0498] In some embodiments, the composition is administered to the animal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times. In some embodiments, the composition is administered once every 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months.

[0499] In some embodiments, the composition is administered in combination with one or more additional agents. In some embodiments, the one or more additional agents include chemical additives, biological feed additives. In some embodiments, the composition is administered in combination with one or more additional compositions. In some embodiments, the additional composition immunizes the animal against a disease, e.g., an infectious disease.

[0500] Kit

[0501] Another aspect of the present disclosure further provides a pharmaceutical package or medicine box. In some embodiments, the medicine box may contain the polynucleotides or compositions described herein, for example, a polynucleotide containing a nucleotide sequence encoding a rumen-related antigen and / or a nucleotide sequence encoding a chemokine and / or a cytokine. In some embodiments, the medicine box may be used in any applicable method, for example, the methods described herein.

[0502]

[0503]

[0504]

[0505]

[0506]

[0507]

[0508]

[0509]

[0510]

[0511]

[0512]

[0513]

[0514]

[0515]

[0516]

[0517]

[0518]

[0519]

[0520]

[0521]

[0522]

[0523]

[0524]

[0525]

[0526]

[0527]

[0528]

[0529]

[0530]

[0531]

[0532]

[0533]

[0534]

[0535]

[0536]

[0537]

[0538]

[0539]

[0540]

[0541]

[0542]

[0543]

[0544]

[0545]

[0546]

[0547]

[0548]

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555]

[0556]

[0557]

[0558]

[0559]

[0560]

[0561]

[0562]

[0563]

[0564]

[0565]

[0566]

[0567]

[0568] Example

[0569] Example 1: Description of the method used in the examples described herein

[0570] IVT template production: For experiments testing RNA vaccine candidates in cattle, the constructs defined in this example (which encode bovine-optimized versions of antigens or cytokines targeting methanogens) were amplified from the corresponding custom-synthesized plasmids with a pUC19 backbone (GenScript). The amplification was carried out in a 20 μL reaction at an annealing temperature of 50 °C, with the reaction consisting of 0.25 μM each of the primers T7-AGG_fwd and 120pA_rev, 1X Herculase II buffer, 25 mM each dNTP, 15 ng plasmid (GeneScript), and 0.4 μL Herculase II enzyme (Agilent). After completion of the PCR program, 20 U of DpnI (NEB) was added to each PCR reaction and incubated at 37 °C for 15 minutes to digest the plasmid template. The DpnI-treated PCR products were purified using the DNA Clean&Concentrator-25 kit (Zymo Research) and eluted into 60 μL of nuclease-free water.

[0571] The primer sequences used were as follows:

[0572] T7-AGG_fwd:

[0573] gaattTAATA CGACTCACTA TAAGGcttgt tctttttgca gaagc (SEQ ID NO.:95)

[0574] 120pA_rev:

[0575] TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTTTTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT agaatgtgaagaaactttct ttttattag (SEQ ID NO.:96)

[0576] In vitro transcription (IVT) of RNA vaccine candidates

[0577] For each vaccine candidate, RNA was synthesized in 22 μL of IVT reaction mixture and incubated at 37 °C for 2 h. The reaction mixture consisted of 200 ng of the corresponding template, 20 mM MgCl2, 7.5 mM of each NTP, 7.5 mM CleanCap AG (TriLink), 1X HiScribe transcription buffer, 2 M betaine, and 2 μL of HiScribe polymerase mix (NEB). For RNA conditions using chemically modified nucleotides, UTP was replaced with 5-hydroxymethyluridine triphosphate (TriLink) or cytidine was replaced with N4-acetyl CTP (Jena BioScience) in the IVT mixture at the specified ratios.

[0578] All IVT products were purified using the Monarch 500 μg RNA Cleanup Kit (NEB) and eluted into 83 μL of nuclease-free water. The eluted products were then digested in a 100 μL reaction mixture at 37 °C for 5 min to degrade the DNA template and remove residual 5′-triphosphates on the RNA. The reaction mixture consisted of 1X DNase I buffer, 10 U DNase I (RNase-free) (New England Biolabs), and 100 U CIAP (Promega). The treated samples were purified using the Monarch 500 μg RNA Cleanup Kit (New England Biolabs) and eluted into 100 μL of 1 mM sodium citrate (pH 6.5).

[0579] One-pot in vitro transcription (IVT) of multiplex RNA vaccine candidates For multiplex RNA vaccine candidates, RNA can be synthesized in separate reaction mixtures as described above for the IVT method and then normalized and pooled in a final step, or synthesized in a single or “one-pot” reaction mixture. In the latter case, multiplex RNA was synthesized by mixing 20 mM MgCl2, 7.5 mM of each NTP, 7.5 mM CleanCap AG (TriLink), 1X HiScribe transcription buffer, 2 M betaine, 2 μL of HiScribe polymerase mix (NEB) with equimolar or predetermined molar ratio amounts of each corresponding DNA template (200 ng DNA total) in a 22 μL IVT reaction mixture and incubating at 37 °C for 2 h. For RNA conditions using chemically modified nucleotides, UTP was replaced with 5-hydroxymethyluridine triphosphate (TriLink) or cytidine was replaced with N4-acetyl CTP (Jena BioScience) in the IVT mixture at the specified ratios.

[0580] All IVT products were cleaned using the Monarch 500 μg RNA Cleanup Kit (NEB) and eluted into 83 μL of nuclease-free water. The eluted products were then digested for 5 minutes at 37 °C in 100 μL of reaction mixture to degrade the DNA template and remove residual 5'-triphosphates on the RNA. The reaction mixture consisted of 1X DNase I buffer, 10 U of DNase I (RNase-free) (New England Biolabs), and 100 U of CIAP (Promega). Samples treated with the Monarch 500 μg RNA Cleanup Kit (New England Biolabs) were cleaned and eluted into 100 μL of 1 mM sodium citrate (pH 6.5).

[0581] Formulations for in vivo RNA experiments

[0582] Formulations of RNA in lipid nanoparticles (RNA-LNP) were prepared using a microfluidic mixer (Precision Nanosystems, Vancouver, BC). Briefly, the GenVoy-ILM lipid mixture (Precision Nanosystems NWW0042) was diluted to 12.5 mM in absolute ethanol and combined with an aqueous solution of RNA (0.14 mg / mL) in PNI buffer (Precision Nanosystems NWW0043) using the formulation parameters recommended by the manufacturer. The formulation was immediately diluted 30:1 in phosphate-buffered saline (Gibco 10010023), concentrated using an Amicon centrifugal filter (MilliporeSigma UFC901008), and adjusted to the appropriate final volume using PBS. The formulation was stored at 4 °C for up to 2 days before the prime dose and at 4 °C for up to 25 days before the booster dose.

[0583] RNA administration studies in cattle

[0584] Animal experiments were conducted according to the guidelines set forth by Texas A&M University (TAMU, College Station, MA, USA) and were approved by the TAMU Institutional Animal Care and Use (IACUC) committee. Cattle were housed at the TAMU McGregor Research facility and consisted of Angus crossbred cattle breeds, with no more than 0.25 indicus (Bos indicus) indicus component. Calves were weaned at approximately 205 days of age and waited at least 4 weeks after weaning, then were trained on GreenFeed Pasture Systems (C-Lock Inc.) and waited at least 8 weeks, then received vaccination treatment.

[0585] During some RNA vaccine studies (such as M1 and M2), calves (n = 4 or 5 in each case) received two RNA administrations on Day 0 (prime) and Day 21 (boost). Unless otherwise stated, the RNA injection consisted of 2 mL of RNA-LNP formulation (0.5 mg RNA dose per animal) and was delivered via intramuscular injection in the neck. Unless otherwise stated, blood, saliva, and rumen fluid samples were collected from each animal on Days -1, 21, 34, and 90 and transported on dry ice for analysis.

[0586] During other RNA vaccine studies (such as M3), calves (n = 10 in each case) received two RNA administrations on Day 0 (prime, 1°), Day 25 (boost, 2°), and Day 104* (boost, 3°). Unless otherwise stated, the RNA injection consisted of 2 mL of RNA-LNP formulation (0.55 mg RNA dose per animal) and was delivered via intramuscular injection in the neck. Blood samples were collected on Days -1, 25, 42, 90, 109*, and 122*, and rumen fluid samples were collected on Days -1, 90, 109*, and 122*. Unless otherwise stated, samples were transported on dry ice for analysis. (*For conditions F1 and F3 only.)

[0587] Blood (8 - 10 mL) was collected via jugular venipuncture and stored on ice for >2 hours to allow it to clot, then centrifuged. Serum was collected and stored at -20°C until thawed for assays.

[0588] Saliva was collected into a conical flask using a vacuum device. Each collection harvested >10 mL of saliva and was stored at -20°C until thawed for assays.

[0589] Use an esophageal tube and a pump to collect rumen fluid for aspirating rumen fluid, and immediately freeze it rapidly in liquid nitrogen or place it on ice until centrifugation at -4°C. Aspirate the solid portion (i.e., the pellet) of the centrifuged sample and place it in a microtube, and rapidly freeze it in liquid nitrogen before storing at -80°C, and transport it to CosmosID Inc. (Germantown, MD) on dry ice for sequencing. Store the liquid portion at -20°C until thawed for determination. For Study M3, separate samples were processed for volatile fatty acid (VFA) analysis. For Studies M1 and M2, animals were randomly assigned to treatment groups by body weight (BW) and housed together.

[0590] From day -8 to day -1 (representing the pre-vaccine baseline), measure the intestinal methane (CH4), oxygen (O2), and carbon dioxide (CO2) emissions of each calf via the GreenFeed Pasture system (C-Lock Inc.), and measure again from day 22 to day 29. During the adaptation and experimental period (day -32 to day 90), measure the feed intake of each calf via the GrowSafe feed intake system (GrowSafe Systems, Ltd.) and RFID ear tags.

[0591] For Study M3, monitor the CH4 emissions and dry matter intake (DMI) of animals during the pre-trial baseline period, and assign animals to treatment groups and house them individually based on the initial CH4 / DMI and BW. Measure the gas emissions of each calf continuously from day -22 to the end of the study, and determine the pre-vaccine intestinal methane baseline after the calves are placed in the final pen and before injection (day -6 to day 0). During the adaptation and experimental period, measure the feed intake of each calf via the GrowSafe feed intake system (GrowSafe Systems, Ltd.) and RFID ear tags.

[0592] Sequencing and Bioinformatics Analysis

[0593] To extract DNA, use the QIAGEN DNeasy PowerSoil Pro kit to isolate DNA from the samples according to the manufacturer's protocol. Allow the unfractionated samples to thaw at 4°C for up to 16 hours, and optionally homogenize and / or centrifuge before extraction. Quantify the extracted DNA samples using a Qubit 4 fluorometer and the Qubit dsDNA HS assay kit (ThermoFisher Scientific).

[0594] For library preparation and sequencing, the Nextera XT DNA Library Preparation Kit (Illumina) and IDT unique dual-indexing were used to prepare DNA libraries with a total DNA input of 1 ng. Genomic DNA was fragmented using a proportional amount of Illumina NexteraXT fragmentase. Unique dual-indexes were added to each sample, followed by 12 PCR cycles to construct the library. The DNA library was purified using AMPure magnetic beads (Beckman Coulter) and eluted in QIAGEN EB buffer. The DNA library was quantified using a Qubit 4 fluorometer and Qubit dsDNA HS Assay Kit. The library was then sequenced on the Illumina NextSeq 2000 platform at 2x150 bp.

[0595] For bioinformatics analysis, the unassembled sequencing reads were directly analyzed through the CosmosID-HUB microbiome platform (CosmosID Inc., Germantown, MD) described elsewhere (Ottensen et al., 2016; Ponnusamy et al., 2016; Hasan et al., 2014; Lax et al., 2014) for multi-kingdom microbiome analysis and antibiotic resistance and virulence gene analysis and quantification of the relative abundance of organisms. Briefly, the system utilizes a curated genomic database and high-performance data mining algorithms to rapidly demultiplex hundreds of millions of metagenomic sequence reads into discrete microbes that generate a specific sequence.

[0596] ELISA

[0597] The ELISA assay measured the antigen-specific IgG and IgA responses to the RNA vaccine formulation. To coat the ELISA plate, the antigen protein was reconstituted from the lyophilized state in H2O (e.g., OVA protein, 2000 μg / mL) or synthesized via an E. coli-based cell-free protein expression system (Liberum Biotech) and plasmid template DNA containing the sequence of the antigen protein (e.g., mru1499) along with the start / stop codons, upstream T7 promoter, ribosome binding site, and downstream T7 terminator. The reaction was incubated at 27 °C for 8 hours and then diluted 1:10 in PBS. The Nunc ELISA plate (ThermoFisher Scientific) was then coated with the antigen protein solution (50 μL / well) and incubated overnight at 4 °C.

[0598] Wash the plate three times with PBS-Tween 1% (PBST) and block it with 200 μL SuperBlock (Thermo Fisher Scientific) for 1 hour at room temperature. The diluent is made from a 1:2 mixture of SuperBlock (Thermo Fisher Scientific) and H2O. Add serial dilutions of the serum samples in the diluent (range 1:10–1:1010) (90 - 135 μL / well) to each well and incubate for 2 hours at room temperature. Wash the plate three times in PBST. For IgG titers, then incubate the plate with 50 μL / well of HRP-conjugated sheep anti-cow IgG (ab112618, Abcam) at a ratio of 1:3,000 in the diluent for 1 h at room temperature. For IgA titers, then incubate the plate with 50 μL / well of HRP-conjugated sheep anti-cow IgA H&L (ab112755, Abcam) at a ratio of 1:1,000 in the diluent for 1 h at room temperature. Wash the plate three times in PBST and incubate with SigmaFast OPD solution (Sigma Aldrich) at 100 μL / well for 10 min at room temperature. Add 50 μL / well of 2M HCl to terminate the reaction. Read the absorbance at 450 nm on a GloMax plate reader (Promega).

[0599] The endpoint titer is defined here as the reciprocal of the highest analyte dilution that gives a reading above the cut-off value. The cut-off value is calculated by adding the mean of the untreated (UTD) values to the standard deviation of the untreated (UTD) values. The geometric mean titer (GMT) and geometric standard deviation (GSD) are obtained across the condition groups.

[0600] The vaccine formulations used in Examples 2 to 5.

[0601] Ssp refers to Secpep1. HNpep refers to the PPa2 secretion signal. HNadj refers to the Sbi adjuvant. HNmod1 refers to N4-acetyl CTP. HNmod2 refers to 5-hydroxymethyluridine triphosphate.

[0602] The vaccine formulation used in Example 5.

[0603] Methods for antigen cluster generation.

[0604] One method for generating a multi-component RNA vaccine in Examples 4 and 5 includes using bioinformatics methods to identify a grouping of two or more antigens (e.g., DNA or amino acid sequences) that are related to each other (e.g., share a certain level of sequence identity or structural identity, such as >80%) and are related to two or more methanogens or methanogen-related proteins in the rumen. (e.g., the antigens within the grouping collectively have >80% identity with more than one methanogen genome).

[0605] In one embodiment, such groupings are generated from a pool of antigens of length 50aa and represent all possible 50aa frames present in a set of open reading frames (ORFs) generated from rumen metagenomic data. In some cases, the set of ORFs is limited to entries that share a certain sequence identity (e.g., >80%) with the genomes of methanogen species or methanogen-related proteins. In some cases, sequences including "hypothetical proteins" and / or de novo peptide designs that share structural similarity with methanogen-related proteins (e.g., structural identity predicted via AlphaFold or LLM) are included. Alternatively, in some cases, a pool of 50aa frames is generated from a protein or genomic database, and the pool of frames is limited to the selection of methanogen species (e.g., the most abundant methanogen species in a rumen sample, Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanosphaera stadtmanae). In some cases, the set of ORFs is limited to entries predicted by an algorithm to be surface-associated proteins (e.g., >0.5 confidence index). In some cases, the generated antigen groupings consist of 2, 3, 4, or 5 antigens that have >80% identity with each other, and the groupings contain antigens related to 2, 3, 4, or 5 different methanogen species. In some cases, the final antigen grouping is defined as the complete protein sequence from which the 50aa frame is derived.

[0606] A method for a multi-component formulation composition.

[0607] A multi-component RNA vaccine targeting multiple methanogen proteins and / or proteins related to multiple methanogens / archaea used in Examples 4 and 5 is generated by selecting a combination of antigens and antigen groupings using algorithms or rational methods to provide coverage of multiple methane-related microorganisms present in the rumen. As shown in Table 3 or Table 5, the vaccine formulations are described as consisting of multiple antigens (e.g., 3, 8, or 5 antigens per formulation), related to multiple methane-related species (e.g., 3 or 5 species per formulation), and combined in a specified ratio by molar concentration or mass.

[0608] Specifically, in this embodiment, F2 contains three antigens C3.1 (SEQ ID NO:35), C3.2 (SEQ ID NO:37) and C3.3 (SEQ ID NO:39), which are generated via the antigen cluster generation workflow described above. The antigens of the F2 formulation have regions with a certain level of similarity (e.g., sequence identity) in common and provide coverage of at least three methane-related species. In addition, the antigens of the F2 formulation are related to the name / function of "signal peptidase" (e.g., the highest BlastP match). Therefore, they are characterized as membrane-bound enzymes and / or are crucial for converting secreted proteins into their mature forms by cleaving the signal peptide from the N-terminal protein during or after protein transport through the membrane.

[0609] F3 includes two groups of two antigens each (C7.1 (SEQ ID NO:55), C7.2 (SEQ ID NO.:57), C7.3 (SEQ ID NO.:59), C7.4 (SEQ ID NO.:61)), and one group of four antigens (C8.1 (SEQ ID NO.:63), C8.2 (SEQ ID NO.:65), C8.3 (SEQ ID NO.:67), C8.4 (SEQ ID NO.:69)), where the first two groups are generated via the antigen cluster generation workflow and the latter group is selected via rational design. Each of the first two antigen groups correspondingly has regions with a certain level of similarity (e.g., sequence identity) in common and provides coverage of at least two methane-related species. In addition, the antigens of the F2 formulation are related to the name / function of "adhesin", "adhesin-like" or "immunoglobulin (Ig)-like", and / or have regions with a certain level of similarity in common with domains containing adhesin / adhesin-like / Ig-like domains (e.g., BlastP match). Therefore, they are characterized as cell surface components that promote binding to other cells or surfaces. Overall, the F3 formulation contains eight antigens that cover at least five methane-related species.

[0610] F4 contains a panel of five antigens: C9.1 (SEQ ID NO.:79), C9.2 (SEQ ID NO.:81), C9.3A (SEQ ID NO.:83), C9.4C (SEQ ID NO.:91), and C9.5 (SEQ ID NO.:93), which were generated via a rational design approach. The antigens of the F4 formulation are related to the name / function of "archaeal oligosaccharyltransferase" or "AglB" and / or have regions that share a certain level of similarity with the oligosaccharyltransferase / AglB protein (e.g., BlastP matches). Thus, they are characterized as enzymes that are essential for N-glycosylation (the covalent attachment of oligosaccharides to target proteins). Overall, the F4 formulation contains five antigens that cover at least five methane-related species.

[0611] F1 is a non-methanogenic antigen control ovalbumin (OVA) that is derived from the chicken (Gallus gallus) and is designed to generate an immune response that is not specific to methanogens.

[0612] Table 3 Compositions of various mRNA vaccine formulations.

[0613]

[0614]

[0615] Table 5: Additional exemplary compositions of various mRNA vaccine formulations. Each row of the table specifies the formulation name, antigen name, species relevance, molar input rate (%), and mass input rate (%). The formulations are composed of combinations of antigens and antigen panels derived from the methods described above.

[0616]

[0617]

[0618] Example 2: Generation of antigen-specific antibodies with a multi-component vaccine formulation

[0619] This example describes the antigen-specific IgG titers generated after vaccinating cattle with an exemplary vaccine against OVA and mru1499. The method used in this example was provided in Example 1 above.

[0620] As Figures 1A - 1B shown, the antigen-specific IgG titers of OVA-IgG and mru1499-IgG (adhesin) in the serum or saliva of animals receiving one or two doses of the multi-component RNA vaccine were detected by ELISA. Additionally, as shown in Table 4, antigen-specific IgA titers were also detected from the serum or saliva of vaccinated animals.

[0621] Table 4: Antigen-specific IgA and IgG titers in serum or saliva for various RNA vaccine formulations. Each row of the table specifies the RNA experimental group size, dosing conditions, and RNA vaccine formulation. The ELISA setup is shown in the table below, and the recorded titers measure the IgA or IgG responses to an exemplary multi-component RNA vaccine formulation and an exemplary RNA vaccine formulation targeting methanogen proteins and having various secretion signals. All ELISAs used serum or saliva samples on day 34.

[0622]

[0623]

[0624] *Saliva sample.

[0625] These data demonstrate that single-component or multi-component RNA vaccine formulations can generate antigen-specific antibody responses in cattle. This data supports the development of single-component or multiple vaccination methods (e.g., where two or more antigens are used) for vaccinating animals (e.g., ruminants).

[0626] Example 3: In vivo effects on methanogen abundance and methane emissions in cattle vaccinated with a vaccine against methanogen proteins

[0627] This example describes the in vivo effects of an exemplary RNA vaccine formulation targeting methanogen proteins and having various secretion signals on methanogen abundance and methane emissions in cattle. The methods used in this example are provided in Example 1 above.

[0628] As Figure 2 shown, compared to control animals that were untreated or not dosed with a vaccine formulation, calves vaccinated with an exemplary multi-component RNA vaccine showed a decrease in the methanogen species Methanobrevibacter boviskoreani (Mbb.) M1 in the rumen fluid on days 20, 34, and 90 after vaccination. Similarly, Figures 3A - 3B calves vaccinated with an exemplary RNA vaccine targeting methanogen proteins and having various secretion signals showed a decrease in the methanogen species Methanobrevibacter boviskoreani (Mbb.) M1 in the rumen fluid. In the rumen fluid of calves vaccinated with an RNA vaccine targeting methanogen proteins, the normalized relative abundance of archaeal species generally also decreased ( Figure 3B ). The archaeal abundance increased in animals vaccinated with an RNA vaccine construct having an HNpep secretion signal, the mru1499 antigen, and an HN adjuvant.

[0629] Figure 4Shows the abundances of methanogens and archaeal species in the rumen fluid of cattle inoculated with an exemplary RNA vaccine formulation targeting methanogens (and in some cases including cytokines). The RNA used also includes Ac4C and / or 5hmU modifications, as shown. Animals inoculated with the RNA vaccine formulation targeting methanogens (mru1499) and those additionally inoculated with the cytokines CXCL10 or VIP showed lower abundances of methanogens and archaeal species (manifested as negative Δ values) compared to the day 0 levels corresponding to each group. Additionally, these groups showed a decrease in total archaeal abundance compared to the untreated group. The RNA vaccine formulation with both Ac4C and 5hmU modifications led to a decrease in the abundance of the methanogen species Methanobrevibacter ruminantium M1, however, the total archaeal abundance increased compared to the untreated group.

[0630] Furthermore, for calves inoculated with an exemplary RNA vaccine formulation targeting methanogen proteins and having various secretion signals, methane emissions based on feed intake were also measured. Figure 5 The data in show that calves inoculated with an exemplary construct targeting mru1499 and having the PPa2 secretion peptide and Sbi adjuvant had lower methane emissions compared to before vaccination (compare the last two bars on the right). Figure 6 Shows a reduction in methane emissions in animals inoculated with an exemplary RNA vaccine formulation targeting methanogens and / or treated with RNA expressing cytokines (CXCL10, VIP).

[0631] In summary, the data in this example demonstrate that inoculation with an RNA vaccine formulation targeting methanogens and / or treatment with RNA expressing cytokines expressed by cattle can reduce the abundance of methanogens and / or reduce methane emissions. This data further supports the development of a vaccination method that includes methanogen antigens and / or rumen-related antigens to reduce methanogens in the animal digestive tract and / or reduce methane emissions.

[0632] Example 4: In vivo effects on methanogen abundance and methane emissions in cattle inoculated with a multi-component RNA vaccine against multiple methanogen proteins

[0633] This example describes the in vivo effects on methanogen abundance and methane emissions in cattle inoculated with an exemplary multi-component RNA vaccine formulation targeting multiple methanogen proteins. The methods used in this example are provided in Example 1 above.

[0634] As Figures 7A - 7BAs shown, relative to the abundance at the PRE time point, calves inoculated with an exemplary multi-component RNA vaccine formulation targeting multiple methanogen proteins showed a reduction in total archaea at +5d POST and +18d POST. From the PRE to the +18d POST time point, a 44% reduction in total archaeal abundance was achieved in calves inoculated with the F3 multi-component RNA vaccine formulation (-32%, normalized to the CNT(OVA) group). Additionally, relative to the abundance at the PRE time point and normalized to the CNT(OVA) group, calves inoculated with an exemplary multi-component RNA vaccine formulation targeting multiple methanogen proteins showed a reduction in each individual archaeal species identified at +5d POST. Note that the CNT(OVA) negative control is a vaccine formulation targeting the non-methanogen protein ovalbumin to generate a non-methanogen-specific immune response.

[0635] In addition, for calves inoculated with an exemplary multi-component RNA vaccine formulation targeting multiple methanogens, methane emissions based on feed intake were also measured. Figures 8A - 8B The data in show that, relative to the control CNT-OVA, calves inoculated with the F3 or F4 vaccine formulations (as described in Table 3) had lower methane emissions (CH4 / day) after injection ( Figure 8A , the last two bars on the right). Additionally, relative to the control CNT-OVA, all tested exemplary multi-component RNA vaccine formulations targeting multiple methanogen proteins demonstrated lower methane emissions per unit of feed intake (CH4 / day / lb of feed) after injection ( Figure 8B ).

[0636] In summary, the data in this example demonstrate that inoculation with a multi-component RNA vaccine formulation targeting one or more methanogen antigens and / or one or more methanogen species can reduce the abundance of methanogens and / or reduce methane emissions. This data further supports the development of a vaccination method that includes methanogen antigens or rumen-related antigens to reduce methanogens in the animal digestive tract or reduce methane emissions.

[0637] Example 5: In Vivo Effects on the Growth Efficiency of Cattle Inoculated with Vaccines Against Methanogen Proteins

[0638] This example describes the in vivo effects on the growth efficiency of cattle inoculated with an exemplary RNA vaccine targeting methanogen proteins and various secretion signals (and in some cases, multi-component formulations, cytokines, and Ac4C and / or 5hmU modifications), measured via average daily gain (ADG, lb / day) or the average amount of weight gained by the animal per day during a certain feeding period. The methods used in this example are provided in Example 1 above.

[0639] AsFigure 9 As shown, compared to control animals that were not treated or administered a vaccine preparation, calves inoculated with exemplary RNA vaccines (F3, F4) that target methanogen proteins and have a secpep1 or HNpep secretion signal had a significantly increased average daily gain (ADG) during the time periods "D0 - D20" (20-day period after the primary injection) and "D20 - D90" (70-day period after the booster injection). For the secpep1 preparation, the average ADG normalized to untreated (UTD) increased by more than 0.8 pounds per day during the D0 - D20 time period (a +53% change compared to the baseline ADG), and by more than 1.0 pounds per day during the D20 - D90 time period (a +65% change compared to the baseline ADG). Additionally, the data shows that compared to control animals that were not treated or administered a vaccine preparation, exemplary RNA vaccine preparations that target methanogens and have cytokine and / or 5hmU modifications also increased the ADG during the time periods D0 - D20 and D20 - D90.

[0640] Additionally, this example describes the in vivo effect on the growth efficiency of cattle inoculated with exemplary multi-component RNA vaccines against multiple methanogen proteins, measured via average daily gain (ADG, lb / day). As Figures 10A - 10B shown, compared to the animals in the CNT (OVA) group inoculated with a preparation targeting the non-methanogen protein ovalbumin to generate a non-methanogen-specific immune response, calves inoculated with a multi-component RNA vaccine against multiple methanogen proteins had an increased ADG during the time periods "D0 - D25" (25-day period after the primary injection) and "D25 - D90" (65-day period after the booster injection).

[0641] The data in this example demonstrate that inoculation with RNA vaccine preparations targeting methanogens can improve the growth efficiency of cattle by their average daily gain. Additionally, the data tables demonstrate that compared to non-methanogen-specific vaccines, inoculation with RNA vaccine preparations targeting one or more methanogen antigens and / or one or more methanogen species can improve the growth efficiency of cattle. Without wishing to be bound by any particular theory, in some embodiments, inoculation with a polynucleotide comprising one or more rumen-related antigens reduces one or more microorganisms (e.g., methanogens) in the digestive tract of the animal, thereby reducing methane emissions and increasing the growth efficiency of the animal (e.g., ruminant). Additionally, without wishing to be bound by any particular theory, since methane produced in the digestive tract of the animal is energy lost when the animal consumes food (e.g., not absorbed by the body), reducing methane emissions allows the animal to absorb more energy from the food for growth, thereby increasing the growth efficiency of the animal.

[0642] This data further supports the development of a vaccination method that includes rumen-related antigens (e.g., rumen antigens and / or methanogen antigens) to improve the growth efficiency of ruminants.

[0643] Serial No. Embodiment

[0644] Embodiment 1. An isolated polynucleotide encoding one or more rumen-related antigens, fragments thereof, or variants thereof.

[0645] Embodiment 2. The isolated polynucleotide according to Embodiment 1, wherein the one or more rumen-related antigens include one or more rumen antigens and / or one or more methanogen antigens.

[0646] Embodiment 3. The isolated polynucleotide according to Embodiment 1 or 2, wherein the one or more rumen-related antigens include one or more rumen antigens.

[0647] Embodiment 4. The isolated polynucleotide according to any one of the foregoing embodiments, wherein the one or more rumen antigens are derived from a polypeptide involved in attachment to fermentative bacteria, or a fragment or variant fragment thereof.

[0648] Embodiment 5. The isolated polynucleotide according to any one of the foregoing embodiments, wherein the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 rumen antigens.

[0649] Embodiment 6. The isolated polynucleotide according to Embodiment 1 or 2, wherein the one or more rumen-related antigens include one or more methanogen antigens.

[0650] Embodiment 7. The isolated polynucleotide according to Embodiment 6, wherein the polynucleotide comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 methanogen antigens.

[0651] Embodiment 8. The isolated polynucleotide according to Embodiment 6, wherein the polynucleotide comprises about 2 to about 20, about 2 to about 15, about 2 to about 10, about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 5, about 2 to about 4, about 2 to about 3, about 3 to about 20, about 4 to about 20, about 5 to about 20, about 6 to about 20, about 7 to about 20, about 8 to about 20, about 9 to about 20, about 10 to about 20, or about 15 to about 20 methanogen antigens.

[0652] Embodiment 9. The isolated polynucleotide according to any one of Embodiments 6 to 8, wherein the one or more methanogen antigens are the same, for example, having the same sequence.

[0653] Embodiment 10. The isolated polynucleotide according to any one of Embodiments 6 to 8, wherein the one or more methanogen antigens are different, for example, having different sequences.

[0654] Embodiment 11. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 10, wherein the one or more methanogen antigens are derived from a polypeptide found on the cell surface of a wild-type methanogen, or a fragment or variant thereof.

[0655] Embodiment 12. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 11, wherein the one or more methanogen antigens are secreted.

[0656] Embodiment 13. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 12, wherein the one or more methanogen antigens comprise a peptide involved in adhesion, attachment or motility, or a fragment or variant of a peptide involved in adhesion, attachment, motility.

[0657] Embodiment 14. The isolated polynucleotide according to Embodiment 12 or 13, wherein the secreted methanogen antigen comprises a signal peptide.

[0658] Embodiment 15. The isolated polynucleotide according to Embodiment 14, wherein the signal peptide can be predicted using a prediction algorithm, and optionally wherein the prediction score is at least 0.5.

[0659] Embodiment 16. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 15, wherein the one or more methanogen antigens comprise one or more peptides having at least 80% sequence identity to a methanogen protein.

[0660] Embodiment 17. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 16, wherein the polynucleotide comprises multiple methanogen antigens, each methanogen antigen having at least 80% sequence identity to each other.

[0661] Embodiment 18. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 17, wherein the polynucleotide comprises multiple methanogen antigens, wherein each methanogen antigen among the multiple methanogen antigens is associated with a different methanogen species.

[0662] Embodiment 19. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 18, wherein the polynucleotide comprises a plurality of methanogenic antigens, and wherein the plurality of methanogenic antigens are associated with at least 2 different, at least 3 different, at least 4 different or at least 5 different methanogenic species.

[0663] Embodiment 20. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 19, wherein the polynucleotide comprises a plurality of methanogenic antigens, and wherein each methanogenic antigen of the plurality of methanogenic antigens is associated with the same methanogenic species.

[0664] Embodiment 21. The isolated polynucleotide according to any one of Embodiments 18 to 20, wherein the methanogenic species include: Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosarcina stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188, Methanosarcina söhngenii, Methanothermus fervidus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanobacterium candelariense, Methanocella paludicola, Methanococcoides burtonii, Methanothrix thermophila, Methanoregula boonei, Methanosphaerula palustris, Methanoculleus bourgensis, Methanospirillum hungatei, Methanosarcina acetivorans.

[0665] Embodiment 22. The isolated polynucleotide according to any one of Embodiments 18 to 21, wherein the methanogenic species is or includes Methanobrevibacter ruminantium, Methanobrevibacter smithii or Methanobrevibacter oralis.

[0666] Embodiment 23. The isolated polynucleotide according to any one of Embodiments 18 to 21, wherein the methanogenic species is or includes Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile or Methanosarcina stadtmanae.

[0667] Embodiment 24. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 23, wherein the one or more methanogenic antigens comprise one or more peptides that have at least 80% sequence identity with a polypeptide having signal peptidase activity.

[0668] Embodiment 25. The isolated polynucleotide according to Embodiment 24, wherein the polypeptide having signal peptidase activity:

[0669] (i) is membrane-bound;

[0670] (ii) has the ability to cleave one or more signal peptides;

[0671] (iii) plays a role in converting a secreted protein into a mature form (e.g., from a non-secreted form to a secreted form); and / or

[0672] (iv) or any combination thereof.

[0673] Embodiment 26. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 25, wherein the one or more methanogenic antigens comprise one or more peptides that: (1) have at least 80% sequence identity with an immunoglobulin (Ig)-like polypeptide, or (2) have a substantially similar function to a polypeptide containing an Ig-like domain.

[0674] Embodiment 27. The isolated polynucleotide according to Embodiment 26, wherein the polypeptide containing an Ig-like domain comprises a polypeptide characterized as a cell surface protein that promotes binding to other cells and / or the cell surface.

[0675] Embodiment 28. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 27, wherein the one or more methanogenic antigens comprise an adhesin or a fragment or variant thereof.

[0676] Embodiment 29. The isolated polynucleotide according to Embodiment 28, wherein the one or more methanogenic antigens comprise an adhesin protein provided in Table 1 or a sequence having at least 85% identity thereto.

[0677] Embodiment 30. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 29, wherein the one or more methanogenic antigens comprise mru1499 or a fragment or variant thereof.

[0678] Embodiment 31. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 30, wherein the one or more methanogenic antigens comprise an antigen sequence provided in any one of SEQ ID NO:2, 6, or 8 or a sequence having at least 85% identity thereto, or are encoded by a sequence provided in any one of SEQ ID NO:1, 5, or 7 or a sequence having at least 85% identity thereto.

[0679] Embodiment 32. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 31, wherein the methanogenic antigen comprises a pilin or a fragment or variant thereof.

[0680] Embodiment 33. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 32, wherein the methanogenic antigen comprises a flagellin or a fragment or variant thereof.

[0681] Embodiment 34. The isolated polynucleotide according to any one of Embodiments 1 to 2 or 6 to 33, wherein the one or more methanogenic antigens comprise one or more peptides that: (1) have at least 80% sequence identity with an archaeal oligosaccharyltransferase (AglB) polypeptide, or (2) have a substantially similar function to the AglB polypeptide.

[0682] Embodiment 35. The isolated polynucleotide according to Embodiment 34, wherein the AglB polypeptide is characterized by having N-glycosylation activity.

[0683] Embodiment 36. The isolated polynucleotide according to any one of the preceding embodiments, wherein the one or more methanogenic antigens comprise:

[0684] (i) one or more peptides having at least 80% sequence identity with a methanogenic protein;

[0685] (ii) one or more secreted antigens comprising a signal peptide;

[0686] (iii) multiple peptides having at least 80% sequence identity with each other;

[0687] (iv) multiple peptides related to at least 2 different, at least 3 different, at least 4 different or at least 5 different methanogenic species;

[0688] (v) one or more peptides having at least 80% sequence identity with a polypeptide having signal peptidase activity;

[0689] (vi) or any combination thereof.

[0690] Embodiment 37. The isolated polynucleotide according to Embodiment 36, wherein the polynucleotide comprises three methanogenic antigens.

[0691] Embodiment 38. The isolated polynucleotide according to Embodiment 37, wherein the three methanogenic antigens are related to at least three different methanogenic species.

[0692] Embodiment 39. The isolated polynucleotide according to any one of Embodiments 1 to 35, wherein the one or more methanogenic antigens comprise:

[0693] (i) one or more peptides having at least 80% sequence identity with a methanogenic protein;

[0694] (ii) one or more secreted antigens comprising a signal peptide;

[0695] (iii) multiple peptides related to at least 2 different, at least 3 different, at least 4 different or at least 5 different methanogenic species;

[0696] (iv) one or more peptides that have at least 80% sequence identity with an AglB polypeptide or have substantially similar functions to an AglB polypeptide;

[0697] (v) or any combination thereof.

[0698] Embodiment 40. The isolated polynucleotide according to Embodiment 39, wherein the polynucleotide comprises five methanogenic antigens.

[0699] Embodiment 41. The isolated polynucleotide according to Embodiment 40, wherein the five methanogenic antigens are related to at least five different methanogenic species.

[0700] Embodiment 42. The isolated polynucleotide according to any one of Embodiments 1 to 35, wherein the one or more methanogenic antigens comprise:

[0701] (i) one or more peptides that have at least 80% sequence identity with a methanogenic protein;

[0702] (ii) one or more secreted antigens comprising a signal peptide;

[0703] (iii) multiple peptides that have at least 80% sequence identity with each other;

[0704] (iv) multiple peptides that are related to at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogenic species;

[0705] (v) one or more peptides that have at least 80% sequence identity with a polypeptide containing an Ig-like domain or have substantially similar functions to a polypeptide containing an Ig-like domain; and / or

[0706] (vi) any combination thereof.

[0707] Embodiment 43. The isolated polynucleotide according to Embodiment 42, wherein the polynucleotide comprises eight methanogenic antigens.

[0708] Embodiment 44. The isolated polynucleotide according to Embodiment 43, wherein the eight methanogenic antigens are related to at least three different methanogenic species.

[0709] Embodiment 45. The isolated polynucleotide according to any one of the foregoing embodiments, wherein each of the one or more rumen antigens and / or the one or more methanogenic antigens is located on a separate nucleotide sequence.

[0710] Embodiment 46. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least two methanogenic antigens, and the at least two methanogenic antigens are located on separate nucleotide sequences.

[0711] Embodiment 47. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least three methanogenic antigens, and the at least three methanogenic antigens are located on separate nucleotide sequences.

[0712] Embodiment 48. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least four methanogenic antigens, and the at least four methanogenic antigens are located on separate nucleotide sequences.

[0713] Embodiment 49. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least five methanogenic antigens, and the at least five methanogenic antigens are located on separate nucleotide sequences.

[0714] Embodiment 50. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least six methanogenic antigens, and the at least six methanogenic antigens are located on separate nucleotide sequences.

[0715] Embodiment 51. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least seven methanogenic antigens, and the at least seven methanogenic antigens are located on separate nucleotide sequences.

[0716] Embodiment 52. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least eight methanogenic antigens, and the at least eight methanogenic antigens are located on separate nucleotide sequences.

[0717] Embodiment 53. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least nine methanogenic antigens, and the at least nine methanogenic antigens are located on separate nucleotide sequences.

[0718] Embodiment 54. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 45, wherein the polynucleotide comprises at least ten methanogenic antigens, and the at least ten methanogenic antigens are located on separate nucleotide sequences.

[0719] Embodiment 55. The isolated polynucleotide according to any one of Embodiments 1 to 45, wherein the one or more rumen antigens and / or the one or more methanogen antigens are located on the same nucleotide sequence.

[0720] Embodiment 56. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 55, wherein the one or more methanogen antigens comprise the polypeptide antigen sequences provided in Table 2, or variants and / or fragments thereof.

[0721] Embodiment 57. The isolated polynucleotide according to any one of Embodiments 1 to 2 and 6 to 55, wherein the one or more methanogen antigens comprise a polypeptide antigen sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to the antigen sequences provided in Table 2.

[0722] Embodiment 58. The isolated polynucleotide according to any one of the foregoing embodiments, wherein the polynucleotide comprises a signal peptide.

[0723] Embodiment 59. The isolated polynucleotide according to Embodiment 58, wherein the signal peptide has at least 85% homology to an archaeal signal peptide.

[0724] Embodiment 60. The isolated polynucleotide according to Embodiment 58, wherein the signal peptide has at least 85% homology to a bacterial signal peptide.

[0725] Embodiment 61. The isolated polynucleotide according to any one of Embodiments 58 to 60, wherein the signal peptide is or comprises the PPA2 signal peptide, or a fragment or variant thereof.

[0726] Embodiment 62. The isolated polynucleotide according to any one of Embodiments 58 to 60, wherein the signal peptide is or comprises the SSP signal peptide, or a fragment or variant thereof.

[0727] Embodiment 63. The isolated polynucleotide according to Embodiment 58, wherein the signal peptide is or comprises the SARS-CoV-2 spike secretion signal, or a fragment or variant thereof.

[0728] Embodiment 64. The isolated polynucleotide according to any one of Embodiments 58 to 63, wherein the signal peptide is located at the N-terminus of the rumen-related antigen sequence.

[0729] Embodiment 65. The isolated polynucleotide according to Embodiment 2, wherein the polynucleotide comprises:

[0730] (i) a first nucleotide sequence that encodes one or more rumen antigens,

[0731] (ii) a second nucleotide sequence that encodes one or more methanogen antigens; and / or

[0732] (iii) a third nucleotide sequence that encodes a chemokine and / or a cytokine.

[0733] Embodiment 66. The isolated polynucleotide according to Embodiment 65, wherein the first nucleotide sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 rumen antigens.

[0734] Embodiment 67. The isolated polynucleotide according to Embodiment 65 or 66, wherein the second nucleotide sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 methanogen antigens.

[0735] Embodiment 68. The isolated polynucleotide according to any one of Embodiments 65 to 67, wherein the first nucleotide sequence, the second nucleotide sequence and / or the third nucleotide sequence are located on one polynucleotide.

[0736] Embodiment 69. The isolated polynucleotide according to any one of Embodiments 65 to 67, wherein the first nucleotide sequence, the second nucleotide sequence and / or the third nucleotide sequence are located on different polynucleotides.

[0737] Embodiment 70. The isolated polynucleotide according to any one of the foregoing embodiments, wherein the polynucleotide comprises a transmembrane domain.

[0738] Embodiment 71. The isolated polynucleotide according to any one of the foregoing embodiments, which further comprises a complement C3d-binding polypeptide of the immunoglobulin-binding protein (Sbi) from Staphylococcus aureus.

[0739] Embodiment 72. The isolated polynucleotide according to Embodiment 71, wherein the complement C3d-binding polypeptide is or comprises:

[0740] (i) domain III of Sbi of Staphylococcus aureus, or a functional fragment or variant thereof;

[0741] (ii) domain IV of Sbi of Staphylococcus aureus, or a functional fragment or variant thereof; or

[0742] (iii) both (i) and (ii).

[0743] Embodiment 73. The isolated polynucleotide as described in any one of the foregoing embodiments, wherein the polynucleotide is or comprises DNA.

[0744] Embodiment 74. The isolated polynucleotide as described in any one of the foregoing embodiments, wherein the polynucleotide is or comprises RNA.

[0745] Embodiment 75. The isolated polynucleotide as described in Embodiment 74, wherein the RNA comprises a 5' cap.

[0746] Embodiment 76. The isolated polynucleotide as described in Embodiment 74 or 75, wherein the RNA comprises a polyA tail.

[0747] Embodiment 77. The isolated polynucleotide as described in any one of claims 74 to 76, wherein the polynucleotide sequence comprises one or more ribonucleotides, the ribonucleotides comprise a nucleoside containing an acetyl group, wherein the nucleoside is N4-acetylcytidine, and the modified ribonucleotide has the following structure:

[0748]

[0749] wherein R is 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0750] Embodiment 78. The isolated polynucleotide as described in Embodiment 77, wherein the polyribonucleotide further comprises one or more modified ribonucleotides other than N4-acetylcytidine, optionally wherein the nucleosides are selected from: adenosine, inosine, guanosine, cytidine or uridine, or any combination thereof.

[0751] Embodiment 79. The isolated polynucleotide as described in Embodiment 78, wherein the nucleoside of the one or more modified ribonucleotides is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure:

[0752]

[0753] wherein R is 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0754] Embodiment 80. The isolated polynucleotide as described in any one of Embodiments 74 to 76, wherein the polynucleotide sequence comprises one or more ribonucleotides, the ribonucleotides comprise a nucleoside containing a hydroxymethyl group, wherein the nucleoside is 5-hydroxymethyluridine and has the following structure:

[0755]

[0756] wherein R is a 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0757] Embodiment 81. The isolated polynucleotide according to Embodiment 80, wherein the polynucleotide further comprises one or more modified ribonucleotides other than 5-hydroxymethyluridine, and the one or more modified ribonucleotides comprise nucleosides selected from the group consisting of adenosine, inosine, guanosine, cytidine or uridine, or any combination thereof.

[0758] Embodiment 82. The isolated polynucleotide according to Embodiment 80 or 81, wherein the nucleoside of the one or more modified ribonucleotides is N4-acetylcytidine, and the modified ribonucleotide has the following structure:

[0759]

[0760] wherein R is a 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

[0761] Embodiment 83. A polypeptide encoded by the polynucleotide according to any one of the preceding embodiments.

[0762] Embodiment 84. A composition comprising one or more polynucleotides according to any one of Embodiments 1 to 82, or a polypeptide according to Embodiment 83.

[0763] Embodiment 85. The composition according to Embodiment 84, wherein the composition is a pharmaceutical composition.

[0764] Embodiment 86. The composition according to Embodiment 84, wherein the composition is an immunogenic composition.

[0765] Embodiment 87. The composition according to Embodiment 84, wherein the composition is a vaccine composition.

[0766] Embodiment 88. The composition according to any one of Embodiments 83 to 87, wherein the composition is formulated for delivery with a carrier.

[0767] Embodiment 89. The composition according to Embodiment 88, wherein the carrier is a lipid nanoparticle, a cationic lipid, a polymeric particle.

[0768] Embodiment 90. The composition according to any one of Embodiments 83 to 87, wherein the composition is formulated for delivery without a carrier.

[0769] Embodiment 91. A method comprising administering the composition according to any one of Embodiments 84 to 90 to a cell, a tissue or an animal.

[0770] Embodiment 92. The method according to embodiment 91, wherein the method is a vaccination method.

[0771] Embodiment 93. The method according to embodiment 90 or 91, wherein the animal is a ruminant.

[0772] Embodiment 94. The method according to any one of embodiments 90 to 92, wherein the ruminant is a cow, sheep, goat, buffalo, moose, antelope, reindeer or deer.

[0773] Embodiment 95. The method according to any one of embodiments 90 to 92, wherein the animal is a domestic animal.

[0774] Embodiment 96. The method according to any one of embodiments 90 to 95, wherein the composition is characterized in that, compared with other comparable animals that have not received the composition or have received a different composition, administering the composition to the animal reduces the methane emissions of the animal.

[0775] Embodiment 97. The method according to embodiment 96, wherein the methane emissions are reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% compared with animals that have not received the composition or have received a different composition.

[0776] Embodiment 98. The method according to embodiment 97, wherein the methane emissions are reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or about 90% compared with other comparable animals that have not received the composition or have received a different composition.

[0777] Embodiment 99. The method according to any one of embodiments 90 to 98, wherein administering the composition to the animal reduces the microbial population in the animal compared with animals that have not received the composition or have received a different composition.

[0778] Embodiment 100. The method according to embodiment 99, wherein the microorganism is a methanogen.

[0779] Embodiment 101. The method according to embodiment 100, wherein the methanogens include one or more methanogens from the following clades: Methanobrevibacter, Methanosphaera, Methanobacterium, Methanosarcinales, Methanomicrobiales, Methanothermobacter, Candida methanolytica, Thermoplasmatales.

[0780] Embodiment 102. The method according to embodiment 100, wherein the methanogens include Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188, Methanosarcina söehngenii, Methanothermobacter thermautotrophicus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanobacterium candelari, Methanoculleus labreanum, Methanococcoides burtonii, Methanothrix thermophila, Methanoregula boonei, Methanosphaerula palustris, Methanocorpusculum bavaricum, Methanospirillum hungatei, Methanosarcina acetivorans, or any combination thereof.

[0781] Embodiment 103. The method according to any one of embodiments 100 to 102, wherein the methanogen abundance is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% compared to the methanogen abundance in animals that did not receive the composition or received a different composition.

[0782] Embodiment 104. The method according to any one of embodiments 100 to 102, wherein the methanogen abundance is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or about 90% compared to the abundance of the methanogens in other comparable animals that did not receive the composition or received a different composition.

[0783] Embodiment 105. The method according to any one of embodiments 100 to 104, wherein the composition is characterized in that administering the composition to the animal reduces the abundance of all or substantially all methanogens (e.g., total methanogen abundance) in the animal compared to the methanogen abundance in other comparable animals that did not receive the composition or received a different composition.

[0784] Embodiment 106. The method according to embodiment 105, wherein the total methanogen abundance is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% compared to the methanogen abundance in other comparable animals that did not receive the composition or received a different composition.

[0785] Embodiment 107. The method according to embodiment 105, wherein the total methanogen abundance is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or about 90% compared to the methanogen abundance in other comparable animals that did not receive the composition or received a different composition.

[0786] Embodiment 108. The method according to any one of embodiments 90 to 107, wherein the composition is characterized in that administering the composition to the animal increases the growth rate of the animal compared to the growth rate of other comparable animals that did not receive the composition or received a different composition.

[0787] Embodiment 109. The method according to embodiment 108, wherein the growth rate is evaluated by measuring the body weight of the animal at one or more time points.

[0788] Embodiment 110. The method according to embodiment 109, wherein the body weight of the animal is measured daily.

[0789] Embodiment 111. The method according to any one of embodiments 108 to 110, wherein the growth rate of the animal increases over a period of time.

[0790] Embodiment 112. The method according to claim 11, wherein the period of time includes at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months or at least 12 months.

[0791] Embodiment 113. The method according to any one of embodiments 108 to 110, wherein the increase in the growth rate includes a daily increase in the body weight of the animal.

[0792] Embodiment 114. The method according to embodiment 113, wherein the daily increase in the weight of the animal is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90% higher compared to the daily increase in the weight of other comparable animals that did not receive the composition or received a different composition.

[0793] Embodiment 115. The method according to embodiment 113, wherein the daily increase in the weight of the animal is approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85% or approximately 90% higher compared to the daily increase in the weight of other comparable animals that did not receive the composition or received a different composition.

[0794] Embodiment 116. The method according to any one of embodiments 91 to 115, wherein the composition alters the yield of cellulose fermentation.

[0795] Embodiment 117. The method according to any one of embodiments 91 to 116, wherein the composition is delivered together with a carrier.

[0796] Embodiment 118. The method according to any one of embodiments 91 to 117, wherein the composition is not delivered using a carrier.

[0797] Embodiment 119. The method according to any one of embodiments 91 to 118, which comprises administering a dose of the composition to the animal.

[0798] Embodiment 120. The method according to any one of embodiments 91 to 119, the method comprising administering multiple doses of the composition to the animal.

[0799] Embodiment 121. The method according to embodiment 120, wherein a first dose of the composition is administered to the animal, followed by one or more subsequent doses of the composition.

[0800] Embodiment 122. The method according to embodiment 121, wherein the first dose and the one or more subsequent doses of the composition comprise the same methanogen antigen and / or rumen antigen.

[0801] Embodiment 123. The method according to embodiment 121, wherein the first dose and the one or more subsequent doses of the composition comprise different methanogenic antigens and / or rumen antigens.

[0802] Embodiment 124. The method according to any one of embodiments 91 to 123, wherein the one or more methanogenic antigens and / or the one or more rumen antigens are specific to the animal.

[0803] Embodiment 125. The method according to embodiment 124, wherein the one or more methanogenic antigens and / or the one or more rumen antigens specific to the animal are obtained by a method comprising:

[0804] (i) identifying one or more methanogenic antigens and / or one or more rumen antigens expressed in the animal; and

[0805] (ii) in response to the identification, selecting one or more methanogenic antigens and / or the one or more rumen antigens to be included in the composition.

[0806] Embodiment 126. The method according to embodiment 124 or 125, wherein the one or more methanogenic antigens and / or the one or more rumen antigens specific to the animal are different from the one or more methanogenic antigens and / or the one or more rumen antigens specific to a different animal.

[0807] Embodiment 127. The method according to embodiment 126, wherein the different animals include:

[0808] (i) animals of different species,

[0809] (ii) animals of different genders,

[0810] (iii) animals of different ages, or

[0811] (iv) animals located in different geographical locations;

[0812] (v) the same animal at different time points; and / or

[0813] (vi) any combination thereof.

[0814] Embodiment 128. The method according to any one of embodiments 120 to 127, wherein the composition is administered to the animal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times.

[0815] Embodiment 129. The method according to any one of embodiments 120 to 128, wherein the composition is administered once every 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months or 6 months.

[0816] Embodiment 130. The method according to any one of embodiments 91 to 129, wherein the composition is administered in combination with one or more additional agents.

[0817] Embodiment 131. The method according to embodiment 130, wherein the one or more additional agents include chemical additives, biological feed additives.

[0818] Embodiment 132. The method according to any one of embodiments 91 to 131, wherein the composition is administered in combination with one or more additional compositions.

[0819] Embodiment 133. The method according to embodiment 132, wherein the additional composition immunizes the animal against a disease, for example, an infectious disease.

[0820] Embodiment 134. A method of manufacturing a composition, the composition comprising one or more polynucleotides according to any one of embodiments 1 to 82.

[0821] Embodiment 135. The method according to embodiment 134, wherein the composition is an RNA composition.

[0822] Embodiment 136. The method according to embodiment 134 or 135, wherein:

[0823] (i) the method is an in vitro transcription reaction method; and / or

[0824] (ii) the method produces a plurality of polynucleotides.

[0825] Embodiment 137. The isolated polynucleotide according to any one of embodiments 1 to 5 or 58 to 81, wherein the rumen antigen includes an antigen expressed in any one or all of the following: (a) rumen ciliates symbiotic with methanogens; (b) hydrogen-producing organisms supplying methanogens; (c) taxa associated with low feed efficiency.

[0826] Embodiment 138. The isolated polynucleotide as described in Embodiment 137, wherein the rumen ciliate symbiotic with methanogens comprises one or more or any combination of the following: Dasytricha ruminantium; Diploplastron affine, Enoploplastron triloricatum; Entodinium simplex; Entodinium caudatum; Entodinium longinucleatum; Epidinium ecaudatum; Eremoplastron bovis; Eudiplodinium maggii; Ostracodinium obtusum; or Polyplastron multivesiculatum.

[0827] Embodiment 139. The isolated polynucleotide as described in Embodiment 137, wherein the hydrogen-producing organisms comprise one or more or any combination of the following: Butyrivibrio fibrisolvens, Bacteroides thetaiotaomicron, Ruminococcus flavefaciens, Ruminococcus albus.

[0828] Embodiment 140. The isolated polynucleotide as described in Embodiment 137, wherein the taxa associated with low feed efficiency comprise one or more of the following: Veillonellaceae, Prevotellaceae, Lachnospiraceae, Succinivibrionaceae, Fibrobacteraceae, Anaerovibrio, Clostridiales, Prevotella, Ruminococcaceae.

[0829] Embodiment 141. The method as described in any one of Embodiments 100 to 104, wherein the composition is characterized in that, compared with the abundance of the same methanogen species in other comparable animals that have not been administered the composition or have been administered a different composition, administering the composition to the animal reduces the abundance of at least one methanogen species in the animal.

[0830] Embodiment 142. The method as described in Embodiment 141, wherein, compared with the abundance of the same methanogen species in other comparable animals that have not been administered the composition or have been administered a different composition, the abundance of at least one methanogen species is reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90%.

[0831] Embodiment 143. The method according to embodiment 141, wherein the abundance of at least one methanogenic species is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85% or about 90% compared to the abundance of the same methanogenic species in other comparable animals that have not been administered the composition or have been administered a different composition.

[0832] Embodiment 144. The method according to any one of embodiments 91 to 123, wherein the one or more methanogenic antigens and / or the one or more rumen antigens are present and / or expressed in the animal and one or more additional animals.

[0833] Embodiment 145. The method according to embodiment 144, wherein the animal and the one or more additional animals are or include:

[0834] (i) animals of the same or different species,

[0835] (ii) animals of the same or different genders,

[0836] (iii) animals of substantially the same age or stage of development, or

[0837] (iv) animals located in the same or substantially similar geographical locations; or

[0838] (v) any combination of (i)-(iv).

[0839] Embodiment 146. The method according to embodiment 144 or 156, wherein the composition is administered to the animal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 times.

[0840] Embodiment 147. The method according to any one of embodiments 144 to 146, wherein the composition is administered once every 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months or 6 months.

[0841] Embodiment 148. The method according to any one of embodiments 144 to 147, wherein the composition is administered in combination with one or more additional agents.

[0842] Embodiment 149. The method according to embodiment 148, wherein the one or more additional agents include chemical additives, biological feed additives.

[0843] Embodiment 150. The method according to any one of embodiments 144 to 149, wherein the composition is administered in combination with one or more additional compositions.

[0844] Embodiment 151. The method according to embodiment 150, wherein the additional composition immunizes the animal against a disease, e.g., an infectious disease.

[0845] Equivalent embodiments

[0846] Those skilled in the art will recognize or be able to ascertain many equivalents to the specific embodiments of the invention described herein using only routine experimentation. It should be understood that, unless otherwise indicated or unless it would be apparent to a person of ordinary skill in the art that there would be a contradiction or inconsistency, the present invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc. from one or more of the recited claims are introduced into another claim that depends from the same base claim (or any other relevant claim). In addition, it should be understood that any embodiment or aspect of the present invention can be explicitly excluded from the claims, whether or not a particular exclusion is recited in the specification. The scope of the present invention is not intended to be limited to the above description, but as set forth in the appended claims.

Claims

1. An isolated polynucleotide encoding one or more rumen - associated antigens, fragments thereof, variants thereof, or variant fragments thereof.

2. The isolated polynucleotide according to claim 1, wherein the one or more rumen - associated antigens include one or more rumen antigens and / or one or more methanogen antigens.

3. The isolated polynucleotide according to claim 1 or 2, wherein the one or more rumen - associated antigens include one or more rumen antigens.

4. The isolated polynucleotide according to any one of the preceding claims, wherein the one or more rumen antigens are derived from a polypeptide involved in attachment to fermentative bacteria, or a fragment, variant, or variant fragment thereof.

5. The isolated polynucleotide according to claim 3 or 4, wherein the one or more rumen antigens comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 rumen antigens.

6. The isolated polynucleotide according to claim 1 or 2, wherein the one or more rumen - associated antigens include one or more methanogen antigens.

7. The isolated polynucleotide according to claim 6, wherein the one or more methanogen antigens comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, or at least 20 methanogen antigens.

8. The isolated polynucleotide according to claim 6 or 7, wherein the one or more methanogen antigens are the same.

9. The isolated polynucleotide according to claim 6 or 7, wherein the one or more methanogen antigens are different.

10. The isolated polynucleotide according to any one of claims 6 to 9, wherein the one or more methanogen antigens comprise: (i) one or more peptides having at least 80% sequence identity with a methanogen protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides having at least 80% sequence identity with each other; (iv) multiple peptides associated with at least 2 different, at least 3 different, at least 4 different, or at least 5 different methanogen species; (v) one or more peptides having at least 80% sequence identity with a polypeptide having signal peptidase activity; (vi) one or more peptides having at least 80% sequence identity with an AglB polypeptide or having a substantially similar function to an AglB polypeptide; (vii) one or more peptides having at least 80% sequence identity with a polypeptide containing an Ig - like domain or having a substantially similar function to a polypeptide containing an Ig - like domain; or (viii) or any combination thereof.

11. The isolated polynucleotide according to any one of claims 6 to 9, wherein the one or more methanogen antigens comprise: (i) one or more peptides having at least 80% sequence identity with a methanogen protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides having at least 80% sequence identity with each other; (iv) multiple peptides associated with at least two different, at least three different, at least four different or at least five different methanogenic bacterial species; (v) one or more peptides having at least 80% sequence identity with a polypeptide having signal peptidase activity; (vi) or any combination thereof.

12. The isolated polynucleotide according to claim 11, wherein the polynucleotide comprises three methanogenic bacterial antigens, optionally wherein the three methanogenic bacterial antigens are associated with at least three different methanogenic bacterial species.

13. The isolated polynucleotide according to any one of claims 6 to 9, wherein the one or more methanogenic bacterial antigens comprise: (i) one or more peptides having at least 80% sequence identity with a methanogenic bacterial protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides associated with at least two different, at least three different, at least four different or at least five different methanogenic bacterial species; (iv) one or more peptides having at least 80% sequence identity with an AglB polypeptide or having a substantially similar function to an AglB polypeptide; or (v) any combination thereof.

14. The isolated polynucleotide according to claim 13, wherein the polynucleotide comprises five methanogenic bacterial antigens, optionally wherein the five methanogenic bacterial antigens are associated with at least five different methanogenic bacterial species.

15. The isolated polynucleotide according to any one of claims 6 to 9, wherein the one or more methanogenic bacterial antigens comprise: (i) one or more peptides having at least 80% sequence identity with a methanogenic bacterial protein; (ii) one or more secreted antigens comprising a signal peptide; (iii) multiple peptides having at least 80% sequence identity with each other; (iv) multiple peptides associated with at least two different, at least three different, at least four different or at least five different methanogenic bacterial species; (v) one or more peptides having at least 80% sequence identity with a polypeptide containing an Ig-like domain or having a substantially similar function to a polypeptide containing an Ig-like domain; or (vi) any combination thereof.

16. The isolated polynucleotide according to claim 15, wherein the polynucleotide comprises eight methanogenic bacterial antigens, optionally wherein the eight methanogenic bacterial antigens are associated with at least three different methanogenic bacterial species.

17. The isolated polynucleotide according to any one of claims 1 to 2 or 6 to 16, wherein the one or more methanogenic bacterial antigens are derived from a polypeptide found on the cell surface of a wild-type methanogenic bacterium, or a fragment or variant thereof.

18. The isolated polynucleotide according to any one of claims 1 to 2 or 6 to 17, wherein the methanogenic bacterial antigen is secreted.

19. The isolated polynucleotide according to any one of claims 1 to 2 or 6 to 18, wherein the methanogenic bacterial antigen comprises a peptide involved in adhesion, attachment or motility, or a fragment or variant of a peptide involved in adhesion, attachment, motility.

20. The isolated polynucleotide according to any one of claims 1 to 2 or 6 to 18, wherein the methanogenic antigen comprises: Adhesin or a fragment or variant thereof; pili protein or a fragment or variant thereof; and / or flagellin, or a fragment or variant thereof.

21. The isolated polynucleotide according to claim 20, wherein the methanogen antigen comprises an adhesin protein provided in Table 1 or a sequence having at least 85% identity thereto.

22. The isolated polynucleotide according to any one of claims 1 to 2 or 6 to 21, wherein the methanogen antigen comprises: an antigen provided in Table 2 or a fragment or variant or variant fragment thereof; or a sequence having at least 85% identity to the antigen sequence provided in Table 2.

23. The isolated polynucleotide according to any one of the preceding claims, wherein the one or more rumen antigens and / or the one or more methanogen antigens are located on different polynucleotides.

24. The isolated polynucleotide according to any one of claims 1 to 23, wherein the one or more rumen antigens and / or the one or more methanogen antigens are located on a single polynucleotide.

25. The isolated polynucleotide according to any one of the preceding claims, wherein the polynucleotide comprises a signal peptide or a variant or fragment thereof.

26. The isolated polynucleotide according to claim 25, wherein the signal peptide has at least 85% homology to an archaeal signal peptide or to a bacterial signal peptide.

27. The isolated polynucleotide according to claim 25 or 26, wherein the signal peptide is or comprises: (i) the PPA2 signal peptide, or a fragment or variant thereof; (ii) the SSP signal peptide, or a fragment or variant thereof; (iii) the SARS-CoV-2 spike secretion signal, or a fragment or variant thereof; or (iv) any combination of (i)-(iii).

28. The isolated polynucleotide according to any one of claims 25 to 27, wherein the signal peptide is located at the N-terminus of the rumen-related antigen sequence.

29. The isolated polynucleotide according to any one of the preceding claims, wherein the polynucleotide comprises: (i) a first nucleotide sequence encoding one or more rumen antigens, (ii) a second nucleotide sequence encoding one or more methanogen antigens; and / or (iii) a third nucleotide sequence encoding a chemokine and / or a cytokine.

30. The isolated polynucleotide according to claim 29, wherein: the first nucleotide sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 rumen antigens; and the second nucleotide sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 methanogen antigens.

31. The isolated polynucleotide according to any one of the preceding claims, wherein the polynucleotide comprises a transmembrane domain.

32. The isolated polynucleotide according to any one of the preceding claims, which further comprises a complement C3d-binding polypeptide of the immunoglobulin-binding protein (Sbi) from Staphylococcus aureus.

33. The isolated polynucleotide according to claim 32, wherein the complement C3d-binding polypeptide is or comprises: (i) The domain III of Sbi from Staphylococcus aureus, or a functional fragment or variant thereof; (ii) The domain IV of Sbi from Staphylococcus aureus, or a functional fragment or variant thereof; or (iii) Both (i) and (ii).

34. The isolated polynucleotide according to any one of the preceding claims, wherein the polynucleotide is or comprises DNA.

35. The isolated polynucleotide according to any one of claims 1 to 34, wherein the polynucleotide is or comprises RNA.

36. The isolated polynucleotide according to claim 35, wherein the polynucleotide sequence comprises one or more ribonucleotides, and the ribonucleotides comprise nucleosides containing acetyl groups, wherein the nucleoside is N4-acetylcytidine, and the modified ribonucleotide has the following structure: wherein R is 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

37. The isolated polynucleotide according to claim 36, wherein the polyribonucleotide further comprises one or more modified ribonucleotides other than N4-acetylcytidine, optionally wherein the nucleosides are selected from: adenosine, inosine, guanosine, cytidine or uridine, or any combination thereof.

38. The isolated polynucleotide according to claim 36, wherein the nucleoside of the one or more modified ribonucleotides is 5-hydroxymethyluridine, and the modified ribonucleotide has the following structure: wherein R is 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

39. The isolated polynucleotide according to any one of claims 33 to 35, wherein the polynucleotide sequence comprises one or more ribonucleotides, and the ribonucleotides comprise nucleosides containing hydroxymethyl groups, wherein the nucleoside is 5-hydroxymethyluridine and the modified ribonucleotide has the following structure: wherein R is 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

40. The isolated polynucleotide according to claim 39, wherein the polyribonucleotide further comprises one or more modified ribonucleotides other than 5-hydroxymethyluridine, and the one or more modified ribonucleotides comprise nucleosides selected from: adenosine, inosine, guanosine, cytidine or uridine, or any combination thereof.

41. The isolated polynucleotide according to claim 39 or 40, wherein the nucleoside of the one or more modified ribonucleotides is N4-acetylcytidine, and the modified ribonucleotide has the following structure: wherein R is 5'-monophosphate, 5'-diphosphate or 5'-triphosphate.

42. A polypeptide encoded by the polynucleotide according to any one of the preceding claims.

43. A composition comprising one or more polyribonucleotides according to any one of claims 1 to 41, or the polypeptide according to claim 42.

44. The composition according to claim 43, wherein the composition is a pharmaceutical composition.

45. The composition according to claim 44, wherein the composition is an immunogenic composition and / or a vaccine composition.

46. A method comprising administering a composition according to any one of claims 43 to 45 to a cell, tissue or animal.

47. The method according to claim 46, wherein the method is a vaccination method and the animal is a ruminant or a domestic animal.

48. The method according to claim 46 or 47, wherein the composition is characterized in that administering the composition to the animal reduces the methane emissions of the animal compared to other comparable animals to which the composition has not been administered or to which a different composition has been administered.

49. The method according to claim 48, wherein the reduction in methane emissions is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% compared to other comparable animals to which the composition has not been administered or to which a different composition has been administered.

50. The method according to any one of claims 46 to 49, wherein administering the composition to the animal reduces the microbial population in the animal compared to other comparable animals to which the composition has not been administered or to which a different composition has been administered.

51. The method according to claim 50, wherein the microbe is a methanogen, optionally wherein the methanogen comprises methanogens from one or more of the following clades: Methanobrevibacter, Methanosphaera, Methanobacterium, Methanosarcinales, Methanomicrobiales, Methanothermobacter, Candida methanolytica, Thermoplasmatales.

52. The method according to claim 51, wherein the methanogen comprises Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter boviskoreani, Methanosphaera stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188, Methanosarcina söhngenii, Methanothermus thermautotrophicus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanothermus kandleri, Methanopyrus kandleri, Methanoplanus limicola, Methanocalculus thermophilicus, Methanoregula boonei, Methanosphaerula palustris, Methanoculleus bourgensis, Methanothrix soehngenii, or any combination thereof.

53. The method according to any one of claims 46 to 52, wherein the composition is characterized in that administering the composition to the animal increases the growth rate of the animal compared to the growth rate of other comparable animals to which the composition has not been administered or to which a different composition has been administered.

54. The method according to claim 53, wherein the increase in growth rate comprises a daily increase in the body weight of the animal, optionally wherein the daily increase in the body weight of the animal is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the body weight increase compared to other comparable animals to which the composition has not been administered or to which a different composition has been administered.

55. The method according to any one of claims 46 to 54, which comprises administering a dose of the vaccine composition to the animal.

56. The method according to any one of claims 46 to 54, which comprises administering multiple doses of the vaccine composition to the animal.

57. The method according to claim 56, wherein a first dose of the composition is administered to the animal, followed by one or more subsequent doses of the composition.

58. The method according to claim 56, wherein the first dose and the one or more subsequent doses of the composition comprise the same methanogen antigen and / or rumen antigen.

59. The method according to claim 56, wherein the first dose and the one or more subsequent doses of the composition comprise different methanogen antigens and / or rumen antigens.

60. The method according to any one of claims 57 to 59, wherein the composition is administered to the animal at least 1 time, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times or at least 30 times.

61. The method according to any one of claims 46 to 60, wherein the composition is administered in combination with one or more additional agents, optionally wherein the one or more additional agents comprise chemical additives, biological feed additives.

62. The method according to any one of claims 46 to 61, wherein the composition is administered in combination with one or more additional compositions, optionally wherein the additional composition immunizes the animal against a disease, for example, an infectious disease.

63. A composition comprising the isolated polynucleotide according to any one of claims 1 to 41, or the pharmaceutical composition according to claim 43 or 44, for administration to an animal (e.g., vaccination).

64. Use of a composition in the preparation of a medicament for administration to an animal (e.g., vaccination), the composition comprising the isolated polynucleotide according to any one of claims 1 to 41, or the pharmaceutical composition according to claim 43 or 44.

65. The composition according to claim 63, or the use according to claim 64, wherein the isolated polynucleotide or pharmaceutical composition is administered to the animal.

66. The composition according to claim 65, or the use according to claim 65, wherein administration of the isolated polynucleotide or pharmaceutical composition results in, compared to other comparable animals not administered the composition or administered a different composition: (i) a reduction in methane emissions; (ii) a decrease in the abundance of one or more microorganisms (e.g., methanogens) in the digestive tract of the animal; and / or (iii) an increase in the growth rate of the animal.

67. The composition according to claim 65 or 66, or the use according to claim 65 or 66, wherein the animal is a ruminant or a domestic animal.

68. The composition according to any one of claims 65 to 67, or the use according to any one of claims 65 to 67, wherein the methanogens include Methanobrevibacter ruminantium, Methanobrevibacter smithii, Methanobrevibacter oralis, Methanomicrobium mobile, Methanobrevibacter wolinii, Methanobrevibacter arboriphilus, Methanobrevibacter gottschalkii, Methanosarcina stadtmanae, Methanosarcina mazei, Methanobrevibacter coexigens, Methanobrevibacter sp. UBA188, Methanosarcina söehngenii, Methanothermus fervidus, Methanococcus aeolicus, Methanococcus jannaschii, Methanococcus voltae, Methanococcus vannielii, Methanococcus maripaludis, Methanothermus kandleri, Methanopyrus kandleri, Methanococcoides burtonii, Methanothrix thermophila, Methanoregula boonei, Methanosphaera stadtmanae, Methanoculleus bourgensis, Methanospirillum hungatei, Methanosarcina acetivorans, or any combination thereof.

Images