Genetic engineering strain for de novo synthesis of beta-nicotinamide mononucleotide by using mixed carbon source, method and application
Through the systematic metabolic engineering transformation of E. coli, a genetically engineered strain E.coli N12-8, which uses glucose and glycerol as carbon sources to synthesize NMNs, was constructed, which solved the problem of high substrate cost in the prior art and achieved efficient and economical NMN synthesis.
Patent Information
- Application Number
- CN202510272949.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-07-01
AI Technical Summary
Existing biosynthesis methods for NMN require the use of nicotinamide ribose or nicotinamide as substrates, increasing the reaction cost.
Through systematic metabolic engineering, E. coli N12-8 was constructed, and a genetically engineered strain E.coli N12-8, which uses glucose and glycerol as mixed carbon sources to synthesize NMN. This strain overexpressed a variety of key enzyme genes and optimized glycerol metabolism through deletion and point mutant genes, achieving efficient synthesis of NMN.
High-efficiency synthesis of NMN with glucose and glycerol as carbon sources without the need for addition of other substrates is achieved, reducing biosynthesis costs and increasing NMN production.
Smart Images

Figure CN120230693A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a genetically engineered strain, method and application for de novo synthesis of β-nicotinamide mononucleotide using a mixed carbon source. Background Art
[0002] β-Nicotinamide mononucleotide (β-NMN) belongs to the derivatives of vitamin B group and is a naturally occurring bioactive nucleotide. It is widely present in natural foods such as vegetables, fungi, meats and shrimps, participates in various biochemical reactions in the human body, and is closely related to immunity and metabolic regulation. In the human body, NMN directly participates in the synthesis of coenzyme I nicotinamide adenine dinucleotide (NAD + ) and exerts its functions through NAD + . Compared with NAD + , NMN is more easily taken into cells, can cross the cell membrane by active transport, and then be effectively converted into NAD + intracellularly. NMN can be used as an effective tool for treating diseases such as type II diabetes, obesity and heart failure caused by a high-fat diet. NMN can also activate the NAD + substrate-dependent enzyme sirtuins (histone deacetylases, also known as silent regulatory proteins), regulate cell survival and death, maintain the redox balance state, and delay the physiological and pathological changes related to age and aging. Therefore, the global market demand for NMN continues to grow at a high speed, and NMN has attracted much attention as a promising anti-aging health product.
[0003] At present, the production methods of NMN are mainly divided into chemical synthesis method and biological synthesis method. The chemical synthesis method has a mature process and is the main production method of NMN, but there are problems such as cumbersome synthesis route, harsh reaction conditions, difficult chiral separation of products, and use of organic solvents, resulting in a high selling price of the product. Using molecular biology technology to construct recombinant strains for biosynthesis of NMN has become an alternative method, which has the advantages of non-toxicity, mild processing conditions, high substrate specificity, strong product selectivity, high conversion efficiency, etc. However, in the prior art, the biosynthesis of NMN mostly requires the use of nicotinamide ribose (202111027058.1; 202410298474.2) or nicotinamide (202211339662.2; 202010498732.3) as substrates, increasing the reaction cost. To solve this problem, the present invention uses Escherichia coli as the chassis cell, constructs a de novo synthesis pathway of NMN through systematic metabolic engineering transformation, realizes a new process for fermenting and producing NMN using a mixed carbon source of glucose and glycerol, further reduces the biosynthesis cost of NMN, and provides a reference basis for the industrial fermentation production of NMN. Summary of the Invention
[0004] The object of the present invention is to overcome the deficiencies in the prior art and provide a genetically engineered strain, method and application for de novo synthesis of β-nicotinamide mononucleotide using a mixed carbon source.
[0005] The technical solution adopted by the present invention to solve its technical problems is as follows:
[0006] A genetically engineered strain for de novo synthesis of NMN using a mixed carbon source, which is based on the previously constructed genetically engineered bacterium E. coli N12 (Food Science, 2023, 44(22): 158-164.), overexpresses the glucose-6-phosphate 1-dehydrogenase gene zwf, overexpresses the 6-phosphogluconate dehydrogenase gene gnd, overexpresses the aspartate aminotransferase gene aspC, overexpresses the phosphoenolpyruvate carboxylase gene ppc, deletes the glycerol kinase gene glpK, and overexpresses the point-mutated glycerol kinase gene glpK G913A , deletes the glycerol dehydrogenase gene gldA to obtain the genetically engineered bacterium E. coli N12-7; uses an expression vector to tandemly express the nicotinic acid nucleotide pyrophosphorylase gene nadC, the NAD synthetase gene ftnadE, the quinoline synthase gene nadA, and the aspartate oxidase gene nadB to obtain the recombinant plasmid P-1, and introduces the constructed recombinant plasmid P-1 into E. coli N12-7 to obtain the genetically engineered bacterium E. coli N12-8.
[0007] Furthermore, E. coli N12 has a deletion of the nicotinamidase gene pncA, a deletion of the nicotinamide nucleotide amidohydrolase gene pncC, a deletion of the nicotinamide nucleotide adenylyltransferase gene nadR, a deletion of the 5ˋ-nucleotidase gene ushA, a deletion of the phosphotransferase gene aphA, a deletion of the ribonucleotide monophosphate phosphatase gene nagD, a deletion of the pyrimidine 5'-nucleotidase gene yjjG, a deletion of the 5' / 3'-nucleotidase gene surE on the genome of E. coli W3110, overexpresses the nicotinic acid transporter gene niaP from Burkholderia cenocepacia, overexpresses the nicotinamide riboside transporter protease gene pnuC from Bacillus mycoides, overexpresses the PRPP transporter gene prsA, and deletes the DNA-binding transcriptional repressor gene purR;
[0008] Alternatively, the zwf, gnd, aspC, ppc, glpK, gldA, nadA, nadB, and nadC genes are all from Escherichia coli and are all wild-type genes, or are mutant genes encoding the corresponding proteins or genes that have been artificially modified, including substitution, deletion, or insertion of one or more amino acid residues at one or more sites. The proteins encoded by the mutant or artificially modified genes have corresponding activities and no functional defects; the ftnadE gene is from Francisella tularensis;
[0009] Alternatively, the gene sequence of ftnadE is SEQ ID NO.1;
[0010] The aforementioned glpK G913A has a gene sequence of SEQ ID NO.2;
[0011] Furthermore, the above genes have all been registered in Gene Bank, and those skilled in the art can obtain these genes through PCR. As an example, the pncA gene is Gene ID 946276, the pncC gene is Gene ID 947169, the nadR gene is Gene ID 948911, the ushA gene is Gene ID 947331, the aphA gene is Gene ID 948562, the nagD gene is Gene ID 945283, the yjjG gene is Gene ID 948899, the surE gene is Gene ID 947211, the niaP gene is Gene ID 56561280, the pnuC gene is Gene ID 66264729, the prsA gene is Gene ID 945772, the purR gene is Gene ID 945266, the zwf gene is Gene ID 946370, the gnd gene is Gene ID 946554, the aspC gene is Gene ID 94553, the ppc gene is Gene ID 948457, the glpK gene is Gene ID 948423, the gldA gene is GeneID 948440, the nadA gene is Gene ID 945351, the nadB gene is Gene ID 947049, and the nadC gene is Gene ID948869.
[0012] Use of the above-described genetically engineered strain in the fermentative production of β-nicotinamide mononucleotide.
[0013] Construction method of the above-described genetically engineered strain, which method is to introduce plasmid P-1 into the obtained strain E. coli N12-7 by electroporation.
[0014] Furthermore, the method for constructing the genetically engineered strain E. coli N12-7 was obtained by gradually modifying E. coli N12 (Food Science, 2023, 44(22): 158-164.) using CRISPR / Cas9-mediated gene editing technology. The steps are as follows:
[0015] (1) Integrate the glucose-6-phosphate 1-dehydrogenase gene zwf at the pseudogene locus yeep, which is controlled by the trc promoter;
[0016] (2) Integrate the 6-phosphogluconate dehydrogenase gene gnd at the pseudogene locus yjiv, which is controlled by the trc promoter;
[0017] (3) Integrate the aspartate aminotransferase gene aspC at the pseudogene locus rph, which is controlled by the trc promoter;
[0018] (4) Integrate the phosphoenolpyruvate carboxylase gene ppc at the pseudogene locus yghX, which is controlled by the trc promoter;
[0019] (5) Delete the glycerol kinase gene glpK;
[0020] (6) Integrate the point-mutated glycerol kinase gene glpK at the pseudogene locus yncI G913A , which is controlled by the trc promoter;
[0021] (7) Delete the glycerol dehydrogenase gene gldA;
[0022] The operation order of steps (1) to (7) in the above steps is not limited and can be carried out in any order that can be implemented by those skilled in the art. Preferably, it is carried out in the order of steps (1) to (7) in sequence.
[0023] Alternatively, the method for constructing the plasmid P-1 is to construct a four-gene tandem plasmid P-1 of nadC-ftnadE-nadA-nadB using an expression vector, wherein nadA and nadB are assembled into an enzyme complex using a fusion protein linker to improve the enzymatic efficiency; the construction of the recombinant plasmid includes the preparation of a linearized vector, the acquisition of target fragments, and homologous recombination; the nadA-linker-nadB gene is inserted at the KpnI and ApaI restriction enzyme sites, the ftnadE gene is inserted at the SalI and HindIII restriction enzyme sites, and the nadC gene is inserted at the SamI and BamHI restriction enzyme sites; the selected linker peptide linker is a commonly used flexible linker peptide, which mostly contains glycine residues, can connect different domains of a single protein, does not interfere with the function of each domain, and at the same time combines recombinant DNA technology to make two interacting enzymes more harmonious. Combining glycine and serine residues to form a GS linker peptide, it has become the most commonly used artificially designed flexible linker peptide at present, and the sequence of (GGGGS)n (generally n≤6) can ensure that the functional domains are properly separated and interact with each other.
[0024] Furthermore, the gene sequence of the fusion protein linker is SEQ ID NO.3;
[0025] Alternatively, the expression vector is any one of common Escherichia coli expression vectors, including pCS expression vector, pET expression vector, pTrc99a expression vector or pBAD expression vector; the gene sequence of the pCS expression vector is SEQ ID NO.4;
[0026] Alternatively, the gene sequence of the trc promoter is SEQ ID NO.5;
[0027] The gene sequence of the trc terminator is SEQ ID NO.6;
[0028] Alternatively, the CRISPR / Cas9-mediated gene editing technology includes constructing a recombinant fragment and a pGRB plasmid, co-transforming the pGRB plasmid and the recombinant fragment into electrocompetent cells containing pREDCas9, and the step of plasmid elimination to obtain a recombinant genetically engineered strain.
[0029] Furthermore, the construction of the pGRB plasmid includes: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with a linearized vector fragment; preferably, the target sequence is 5’-NGG-3’;
[0030] The constructed recombinant fragment includes a recombinant fragment for gene integration or a recombinant fragment for gene knockout; among them, the steps for constructing a recombinant fragment for gene integration include: using the genome of the starting strain as a template, designing upstream and downstream homologous arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment through PCR overlap technology.
[0031] Further, for the construction of the recombinant plasmid, appropriate restriction enzyme sites are selected according to the target gene, and the expression vector PCS plasmid is digested with double enzymes. The target gene fragment containing the restriction enzyme site and the promoter is obtained by PCR amplification. After recovering the digested and PCR products, recombinant II is carried out, and the recombinant plasmid is obtained after transformation, screening, and identification.
[0032] A method for fermenting and producing β-nicotinamide mononucleotide NMN using the genetically engineered strain as described above includes the following steps:
[0033] Contact the genetically engineered strain with the fermentation medium, carry out fermentation culture, and prepare NMN.
[0034] Further, the fermentation culture includes shake flask fermentation or fermenter fermentation;
[0035] During shake flask fermentation, the inoculum size of the genetically engineered strain is 15-20%, the fermentation conditions are 37°C, shaking culture at 220 r / min, maintaining the pH at 6.7-7.2 during fermentation, adjusting the pH by adding ammonia water, and fermenting for 24-26 h; during the fermentation process, a mixed solution of glucose and glycerol can also be added to maintain the fermentation. Preferably, the mass-volume concentration of the mixed solution of glucose and glycerol is 60% (m / v), and the mass ratio of glucose to glycerol is 1:1. In the present invention, there is no special limitation on the addition amount of the mixed solution of glucose and glycerol, as long as the concentrations of glucose and glycerol in the fermentation broth can be maintained below 5 g / L;
[0036] The fermenter fermentation culture is as follows: Take the bacterial solution of the genetically engineered bacterium, evenly coat it on the activated slant, and carry out subculture; inoculate the strain on the activated slant into the seed medium, culture at 37°C for 8-10 h, and maintain the pH value at 6.8-7.2 during the culture process by adding ammonia water; inoculate the seed liquid into the fermentation medium at an inoculum size of 15-20% to start fermentation culture; control the initial fermentation pH value at 6.8-7.2; maintain the pH value at 6.8-7.2 during the fermentation process by adding ammonia water; when the glucose and glycerol in the medium are consumed, add a mixed solution of glucose and glycerol with a mass-volume concentration of 80% (m / v), and the mass ratio of glucose to glycerol is 1:1, to maintain the mixed concentration of glucose and glycerol in the fermentation medium below 1 g / L, and ferment for 26-30 h to obtain.
[0037] Furthermore, the shake flask fermentation is carried out in a 500 mL Erlenmeyer flask. When the shake flask fermentation lasts for 24 h, the concentration of NMN in the fermentation broth can reach 1.8 g / L.
[0038] Alternatively, the fermentation tank fermentation is carried out in a 5 L fermentation tank. After 26 h of fermentation in the 5 L fermentation tank, the yield of NMN reaches 8.2 g / L.
[0039] Alternatively, the fermentation medium is an Escherichia coli fermentation medium.
[0040] Alternatively, the composition of the seed medium for shake flask fermentation is: glucose 10 - 15 g / L, glycerol 10 - 15 g / L, KH2PO4 1.0 - 1.5 g / L, MgSO4·7H2O 0.4 - 0.8 g / L, yeast powder 4 - 6 g / L, peptone 2 - 3 g / L, methionine 0.3 - 0.5 g / L, FeSO4·7H2O 10 - 12 mg / L, MnSO4·H2O 10 - 12 mg / L, V B1 、V B3 、V B5 、V B12 each 1 - 1.5 mg / L.
[0041] Alternatively, the composition of the fermentation medium for shake flask fermentation is: glucose 10 - 15 g / L, glycerol 10 - 15 g / L, KH2PO4 2.0 - 2.5 g / L, MgSO4·7H2O 0.5 - 1.0 g / L, yeast powder 5 - 8 g / L, peptone 3 - 4 g / L, methionine 0.5 - 0.7 g / L, FeSO4·7H2O 10 - 12 mg / L, MnSO4·H2O 10 - 12 mg / L, V B1 、V B3 、V B5 、V B12 each 1 - 1.5 mg / L.
[0042] Alternatively, the medium used for the activated slant is: glucose 1 - 2 g / L, peptone 10 - 15 g / L, beef extract 10 - 15 g / L, yeast powder 5 - 8 g / L, NaCl 2.5 - 5 g / L, agar 20 g / L.
[0043] Alternatively, the seed culture medium for fermentation culture in the fermenter is as follows: glucose 15 - 20 g / L, glycerol 10 - 15 g / L, KH2PO4 2.5 - 3.0 g / L, MgSO4·7H2O 0.5 - 1.0 g / L, citric acid 2 - 3 g / L, ammonium sulfate 1.0 - 1.5 g / L, methionine 0.5 - 1 g / L, yeast powder 5 - 8 g / L, peptone 3 - 4 g / L, FeSO4·7H2O 10 - 12 mg / L, MnSO4·H2O 10 - 12 mg / L, V B1 V B3 V B5 V B12 each 1 - 1.5 mg / L;
[0044] Alternatively, the fermentation culture medium for fermentation culture in the fermenter is as follows: glucose 10 - 15 g / L, glycerol 10 - 15 g / L, KH2PO4 4.5 - 6.5 g / L, MgSO4·7H2O 1.2 - 2.0 g / L, yeast powder 6 - 10 g / L, peptone 4 - 6 g / L, ammonium sulfate 2.0 - 2.5 g / L, methionine 0.2 - 0.5 g / L, K2HPO4 4.5 - 6.5 g / L, FeSO4·7H2O 20 - 25 mg / L, MnSO4·7H2O 10 - 15 mg / L, V B1 V B3 V B5 V B12 each 2 - 4 mg / L.
[0045] The advantages and positive effects achieved by the present invention are as follows:
[0046] 1. By systematically modifying the NMN synthetic metabolism of Escherichia coli, the present invention realizes the de novo synthesis of NMN using glucose and glycerol as mixed carbon sources, and no other substrates need to be added during the fermentation process, thus saving the fermentation cost.
[0047] 2. By introducing the point - mutated glycerol kinase gene glpK G913A the co - utilization of glucose and glycerol is realized, and then by knocking out the glycerol dehydrogenase gene gldA, glycerol can be metabolized into DHAP without relying on PEP supply. Since both PEP and DHAP are important intermediates for the de novo synthesis of NMN, introducing the above - mentioned glycerol metabolism can significantly improve the de novo synthesis metabolic flux of NMN.
[0048] 3. The present invention uses the peptide - peptide interaction fusion protein linker to assemble quinoline synthase nadA and aspartate oxidase nadB into an enzyme complex, improving the conversion efficiency of aspartate to quinolinic acid and providing sufficient precursors for the de novo synthesis of NMN. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1 This is the metabolic engineering strategy diagram of the genetically engineered bacterium E. coli N12-8 in the present invention; wherein, 6-PGL: 6-phosphogluconolactone; 6-PG: 6-phosphogluconate dehydrogenase; Ru5P: ribulose-5-phosphate; PRPP: phosphoribosyl-1-pyrophosphate; NaMN: nicotinic acid mononucleotide; NMN: nicotinamide mononucleotide; PEP: phosphoenolpyruvate; OAA: oxaloacetic acid; ASP: aspartic acid; IA: iminoaspartic acid; QA: quinolinic acid; G-3-P: glyceraldehyde-3-phosphate; DHAP: dihydroxyacetone phosphate; DHA: docosahexaenoic acid; PYR: pyruvate;
[0050] Figure 2 This is the electrophoresis diagram of the construction and verification of the zwf gene integration fragment in the present invention; wherein: M: 1kb DNA marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: target fragment; 4: overlapping fragment; 5: original bacterium control; 6: positive bacterium identification fragment;
[0051] Figure 3 This is the electrophoresis diagram of the construction and verification of the gnd gene integration fragment in the present invention; wherein: M: 1kb DNA marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: target fragment; 4: overlapping fragment; 5: original bacterium control; 6: positive bacterium identification fragment;
[0052] Figure 4 This is the electrophoresis diagram of the construction and verification of the aspC gene integration fragment in the present invention; wherein: M: 1kb DNA marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: target fragment; 4: overlapping fragment; 5: original bacterium control; 6: positive bacterium identification fragment;
[0053] Figure 5 This is the electrophoresis diagram of the construction and verification of the ppc gene integration fragment in the present invention; wherein: M: 1kb DNA marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: target fragment; 4: overlapping fragment; 5: original bacterium control; 6: positive bacterium identification fragment;
[0054] Figure 6 This is the electrophoresis diagram of the construction and verification of the glpK gene knockout fragment in the present invention; M: 1kb DNA marker; 1: downstream homologous arm; 2: upstream homologous arm; 3: overlapping fragment; 4: original bacterium control; 5: positive bacterium identification fragment;
[0055] Figure 7 This is glpK in the present invention G913AElectrophoretogram of construction and verification of gene integration fragments; wherein: M: 1kb DNA marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: target fragment; 4: overlapping fragment; 5: original bacterium control; 6: positive bacterium identification fragment;
[0056] Figure 8 Electrophoretogram of construction and verification of gldA gene knockout fragment in the present invention; M: 1kb DNA marker; 1: upstream homologous arm; 2: downstream homologous arm; 3: overlapping fragment; 4: original bacterium control; 5: positive bacterium identification fragment;
[0057] Figure 9 Electrophoretogram of construction and verification of P-1 recombinant plasmid in the present invention; M: 1kb DNA marker; 1: pCS empty plasmid; 2: Ptrc-nadC target gene fragment; 3: Ptrc-nadE target gene fragment; 4: Ptrc-nadA-linker-nadB target gene fragment; 5: original bacterium control; 6: positive bacterium identification fragment;
[0058] Figure 10 Comparison chart of the results of flask fermentation of NMN by strain E. coli N12-8 using glucose as the carbon source and using glucose and glycerol as the mixed carbon source in the present invention;
[0059] Figure 11 Result chart of fermentation tank fermentation of NMN by strain E. coli N12-8 using glucose and glycerol as the mixed carbon source in the present invention. Detailed implementation manners
[0060] The present invention will be further described below in conjunction with the embodiments. The following embodiments are narrative and not restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.
[0061] All kinds of experimental operations involved in the specific embodiments are conventional techniques in the art. For the parts not specifically annotated in this article, those of ordinary skill in the art can refer to various commonly used reference books, scientific and technological literatures, or relevant specifications, manuals, etc. before the application date of the present invention for implementation.
[0062] A genetically engineered strain for de novo synthesis of NMN using a mixed carbon source. The genetically engineered strain is based on the previously constructed genetically engineered bacterium E. coli N12 (Food Science, 2023, 44(22): 158-164.), overexpresses the glucose-6-phosphate 1-dehydrogenase gene zwf, overexpresses the 6-phosphogluconate dehydrogenase gene gnd, overexpresses the aspartate aminotransferase gene aspC, overexpresses the phosphoenolpyruvate carboxylase gene ppc, deletes the glycerol kinase gene glpK, and overexpresses the point-mutated glycerol kinase gene glpK G913A, the glycerol dehydrogenase gene gldA was deleted to obtain the genetically engineered bacterium E. coli N12-7. The nicotinic acid nucleotide pyrophosphorylase gene nadC, NAD synthase gene ftnadE, quinoline synthase gene nadA, and aspartate oxidase gene nadB were tandemly expressed using an expression vector, and the constructed recombinant plasmid P-1 was introduced into E. coli N12-7 to obtain the genetically engineered bacterium E. coli N12-8.
[0063] Furthermore, E. coli N12 has the nicotinamidase gene pncA deleted from the genome of E. coli W3110, the nicotinamide nucleotide amidohydrolase gene pncC deleted, the nicotinamide nucleotide adenylyltransferase gene nadR deleted, the 5'-nucleotidase gene ushA deleted, the phosphotransferase gene aphA deleted, the ribonucleotide monophosphate enzyme gene nagD deleted, the pyrimidine 5'-nucleotidase gene yjjG deleted, the 5' / 3'-nucleotidase gene surE deleted, overexpresses the nicotinic acid transporter gene niaP from Burkholderia cenocepacia, overexpresses the nicotinamide riboside transporter protease gene pnuC from Bacillus mycoides, overexpresses the PRPP transporter gene prsA, and has the DNA-binding transcriptional repressor gene purR deleted.
[0064] The above genes have all been registered in Gene Bank, and those skilled in the art can obtain these genes by PCR. As an example, the pncA gene is Gene ID 946276, the pncC gene is Gene ID 947169, the nadR gene is Gene ID 948911, the ushA gene is Gene ID 947331, the aphA gene is Gene ID 948562, the nagD gene is Gene ID 945283, the yjjG gene is Gene ID 948899, the surE gene is Gene ID 947211, the niaP gene is Gene ID 56561280, the pnuC gene is Gene ID 66264729, the prsA gene is Gene ID 945772, and the purR gene is Gene ID 945266.
[0065] Furthermore, the zwf, gnd, aspC, ppc, glpK, gldA, nadA, nadB, and nadC genes are all from Escherichia coli, and are all wild-type genes, or are mutant genes encoding the corresponding proteins or genes modified artificially, including substitution, deletion, or insertion of one or more amino acid residues at one or more sites. The proteins encoded by the mutant or artificially modified genes have corresponding activities and no functional defects; the ftnadE gene is from Francisella tularensis.
[0066] The above genes have all been registered in Gene Bank, and those skilled in the art can obtain these genes by PCR. As an example, the zwf gene is Gene ID 946370, the gnd gene is Gene ID 946554, the aspC gene is Gene ID 94553, the ppc gene is Gene ID 948457, the glpK gene is Gene ID 948423, the gldA gene is Gene ID 948440, the nadA gene is Gene ID 945351, the nadB gene is Gene ID 947049, and the nadC gene is Gene ID 948869.
[0067] Furthermore, the gene sequence of the ftnadE is SEQ ID NO.1;
[0068] The glpK G913A has a gene sequence of SEQ ID NO.2;
[0069] The method for constructing the above-mentioned genetically engineered strain E. coli N12-7 is obtained by gradually modifying E. coli N12 (Food Science, 2023, 44(22): 158-164.) using the CRISPR / Cas9-mediated gene editing technology. The steps are as follows:
[0070] (1) Integrate the glucose-6-phosphate 1-dehydrogenase gene zwf at the pseudogene locus yeep, which is controlled by the trc promoter;
[0071] (2) Integrate the 6-phosphogluconate dehydrogenase gene gnd at the pseudogene locus yjiv, which is controlled by the trc promoter;
[0072] (3) Integrate the aspartate aminotransferase gene aspC at the pseudogene locus rph, which is controlled by the trc promoter;
[0073] (4) Integrate the phosphoenolpyruvate carboxylase gene ppc at the pseudogene locus yghX, which is controlled by the trc promoter;
[0074] (5) Lack of glycerol kinase gene glpK;
[0075] (6) Integrate a point-mutated glycerol kinase gene glpK at the pseudogene locus yncI G913A , which is controlled by the trc promoter;
[0076] (7) Lack of glycerol dehydrogenase gene gldA;
[0077] The order of operations in steps (1) to (7) above is not limited and can be carried out in any order implementable by those skilled in the art. Preferably, the manner of carrying out steps (1) to (7) in sequence is adopted.
[0078] The method for constructing plasmid P-1 as described above uses a pCS expression vector to construct a four-gene tandem plasmid P-1 of nadC-ftnadE-nadA-nadB, in which nadA and nadB are assembled into an enzyme complex using a fusion protein linker to improve the enzymatic efficiency. The construction of the recombinant plasmid includes the preparation of a linearized vector, the acquisition of target fragments, and homologous recombination. The nadA-linker-nadB gene is inserted at the KpnI and ApaI restriction enzyme sites, the ftnadE gene is inserted at the SalI and HindIII restriction enzyme sites, and the nadC gene is inserted at the SamI and BamHI restriction enzyme sites. The linker peptide linker selected in this study is a commonly used flexible linker peptide, which mostly contains glycine residues and can connect different domains of a single protein without interfering with the functions of each domain. At the same time, combined with recombinant DNA technology, two interacting enzymes can interact more harmoniously. Combining glycine and serine residues to form a GS linker peptide, it has become the most commonly used artificially designed flexible linker peptide at present, and the sequence of (GGGGS)n (generally n≤6) can ensure that the functional domains are properly separated and interact with each other.
[0079] Furthermore, the gene sequence of the fusion protein linker is SEQ ID NO.3;
[0080] The method for constructing E. coli N12-8 as described above is to introduce plasmid P-1 into the obtained strain E. coli N12-7 by electroporation.
[0081] Furthermore, specifically, the expression vector can be various common E. coli expression vectors, including but not limited to any one of the pCS expression vector, pET expression vector, pTrc99a expression vector, or pBAD expression vector.
[0082] Preferably, the vector is the pCS expression vector, and the gene sequence of the pCS expression vector is SEQ ID NO.4.
[0083] Furthermore, the gene sequence of the trc promoter is SEQ ID NO.5;
[0084] The gene sequence of the trc terminator is SEQ ID NO.6;
[0085] Alternatively, the CRISPR / Cas9-mediated gene editing technology includes steps of constructing a recombinant fragment and a pGRB plasmid, co-transforming the pGRB plasmid and the recombinant fragment into electrocompetent cells containing pREDCas9, and plasmid curing to obtain a recombinant genetically engineered strain.
[0086] Furthermore, the construction of the pGRB plasmid includes: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with a linearized vector fragment; preferably, the target sequence is 5'-NGG-3';
[0087] The construction of the recombinant fragment includes constructing a recombinant fragment for gene integration or a recombinant fragment for gene knockout; among them, the steps of constructing a recombinant fragment for gene integration include: using the genome of the starting strain as a template, designing upstream and downstream homologous arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment through PCR overlap technology.
[0088] Furthermore, for the construction of the recombinant plasmid, appropriate restriction enzyme sites are selected according to the target gene, the expression vector PCS plasmid is digested with two restriction enzymes, a target gene fragment containing the restriction enzyme sites and the promoter is obtained by PCR amplification, and after recovering the digested and PCR products, they are used for II recombination, and the recombinant plasmid is obtained after transformation, screening, and identification.
[0089] Use of the genetically engineered strain as described above in the fermentation production of NMN.
[0090] A method for fermentatively producing NMN using the genetically engineered strain as described above, comprising the following steps: contacting the genetically engineered strain with a fermentation medium, performing fermentation culture, and preparing NMN.
[0091] Furthermore, the fermentation culture includes shake flask fermentation or fermenter fermentation;
[0092] When performing shake flask fermentation, the inoculum size of the genetically engineered strain is 15-20%, the fermentation conditions are 37°C, shaking culture at 220 r / min, maintaining the pH at 6.7-7.2 during the fermentation process, adjusting the pH by adding ammonia water, and fermenting for 24-26 h; during the fermentation process, a mixed solution of glucose and glycerol can also be added to maintain the fermentation. Preferably, the mass-volume concentration of the mixed solution of glucose and glycerol is 60% (m / v), and the mass ratio of glucose to glycerol is 1:1. In the present invention, there is no special limitation on the addition amount of the mixed solution of glucose and glycerol, and the concentrations of glucose and glycerol in the fermentation broth can be maintained below 5 g / L.
[0093] The shake flask fermentation is carried out in a 500 mL Erlenmeyer flask. When the shake flask fermentation lasts for 24 h, the concentration of NMN in the fermentation broth can reach 1.8 g / L.
[0094] The fermentation tank fermentation culture is as follows: Take the bacterial solution of the genetically engineered bacteria of NMN, evenly coat it on the activated slant, and carry out subculture; inoculate the strain on the activated slant into the seed medium, culture at 37°C for 8-10 h, and maintain the pH value at 6.8-7.2 by adding ammonia water during the culture process; inoculate the seed liquid into the fermentation medium at an inoculum size of 15-20% to start fermentation culture; control the initial fermentation pH value at 6.8-7.2; maintain the pH value at 6.8-7.2 by adding ammonia water during the fermentation process; when the glucose and glycerol in the medium are consumed, feed a mixed solution of glucose and glycerol with a mass-volume concentration of 80% (m / v), and the mass ratio of glucose to glycerol is 1:1, and maintain the mixed concentration of glucose and glycerol in the fermentation medium below 1 g / L, and ferment for 26-30 h to obtain the product.
[0095] The fermentation tank fermentation is carried out using a 5 L fermentation tank. After 26 h of fermentation in the 5 L fermentation tank, the yield of NMN reaches 8.2 g / L.
[0096] Furthermore, the fermentation medium is an Escherichia coli fermentation medium;
[0097] Or, the composition of the seed medium for shake flask fermentation is: glucose 10-15 g / L, glycerol 10-15 g / L, KH2PO4 1.0-1.5 g / L, MgSO4·7H2O 0.4-0.8 g / L, yeast powder 4-6 g / L, peptone 2-3 g / L, methionine 0.3-0.5 g / L, FeSO4·7H2O 10-12 mg / L, MnSO4·H2O 10-12 mg / L, V B1 、V B3 、V B5 、V B12 each 1-1.5 mg / L;
[0098] Alternatively, the fermentation medium for shake flask fermentation consists of: glucose 10 - 15 g / L, glycerol 10 - 15 g / L, KH2PO4 2.0 - 2.5 g / L, MgSO4·7H2O 0.5 - 1.0 g / L, yeast powder 5 - 8 g / L, peptone 3 - 4 g / L, methionine 0.5 - 0.7 g / L, FeSO4·7H2O 10 - 12 mg / L, MnSO4·H2O 10 - 12 mg / L, V B1 V B3 V B5 V B12 each 1 - 1.5 mg / L;
[0099] Furthermore, the medium used for the activation slant is: glucose 1 - 2 g / L, peptone 10 - 15 g / L, beef extract 10 - 15 g / L, yeast powder 5 - 8 g / L, NaCl 2.5 - 5 g / L, agar 20 g / L;
[0100] Alternatively, the seed medium for fermentation tank fermentation is: glucose 15 - 20 g / L, glycerol 10 - 15 g / L, KH2PO4 2.5 - 3.0 g / L, MgSO4·7H2O 0.5 - 1.0 g / L, citric acid 2 - 3 g / L, ammonium sulfate 1.0 - 1.5 g / L, methionine 0.5 - 1 g / L, yeast powder 5 - 8 g / L, peptone 3 - 4 g / L, FeSO4·7H2O 10 - 12 mg / L, MnSO4·H2O 10 - 12 mg / L, V B1 V B3 V B5 V B12 each 1 - 1.5 mg / L;
[0101] Alternatively, the fermentation medium for fermentation tank fermentation is: glucose 10 - 15 g / L, glycerol 10 - 15 g / L, KH2PO4 4.5 - 6.5 g / L, MgSO4·7H2O 1.2 - 2.0 g / L, yeast powder 6 - 10 g / L, peptone 4 - 6 g / L, ammonium sulfate 2.0 - 2.5 g / L, methionine 0.2 - 0.5 g / L, K2HPO4 4.5 - 6.5 g / L, FeSO4·7H2O 20 - 25 mg / L, MnSO4·7H2O 10 - 15 mg / L, V B1 V B3 V B5 V B12 each 2 - 4 mg / L.
[0102] Specifically, the related preparation and detection are as follows:
[0103] 1. Gene editing method
[0104] In the present invention, the CRISPR / Cas9-mediated gene editing method can be carried out with reference to the literature (Metabolic Engineering, 2015, 31: 13-21.). CRISPR / Cas9 is a precise and efficient new gene targeting modification technology. The two plasmids used in this method are pGRB and pREDCas9 respectively. The pREDCas9 plasmid is a temperature-sensitive plasmid, carrying an elimination system for the gRNA plasmid, the Red recombination system of phage λ and a Cas9 protein expression system, with streptomycin resistance (working concentration: 100 mg / L), and the suitable culture temperature is 32 °C; the pGRB plasmid, with pUC18 as the backbone, contains the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, with ampicillin resistance (working concentration: 100 mg / L), and the suitable culture temperature is 37 °C.
[0105] The specific steps of this method are as follows:
[0106] 1.1 Construction of pGRB plasmid
[0107] The purpose of constructing the plasmid pGRB is to transcribe the corresponding gRNA, so as to form a complex with the Cas9 protein, and identify the target site of the target gene through base pairing and PAM, realizing the double-strand break of the target DNA. The pGRB plasmid was constructed by the method of recombining a DNA fragment containing the target sequence with a linearized vector fragment.
[0108] 1.1.1 Design of target sequence
[0109] Use CRISPRRGEN Tools to design the target sequence (PAM: 5’-NGG-3’), specifically as follows:
[0110] yeep target sequence: ACAGAATATTCGCGAAAAAA
[0111] yjiv target sequence: AAGCTGGGGAATGCCAGACC
[0112] rph target sequence: GCAGTAGATTTGAAAGCGCT
[0113] yghX target sequence: CCCACTTTGCCTGTCGCTTG
[0114] glpK target sequence: TGGATCCTCGACCATGTGGA
[0115] gldA target sequence: GTTGCCAAATAACCCGAATA
[0116] yncI target sequence: GAGTGCCATGAAATCACTGA
[0117] 1.1.2 Preparation of DNA Fragment Containing Target Sequence
[0118] Design primers: 5'-Linearized vector terminal sequence (15bp)-Restriction enzyme site-Target sequence (excluding PAM sequence)-Linearized vector terminal sequence (15bp)-3' and its reverse complementary primer (pGRB identification primer: pGRB-Test-S: GTCTCATGAGCGGATACATATTTG; pGRB-Test-A: ATGAGAAAGCGCCACGCT). Prepare the DNA fragment containing the target sequence by annealing single-stranded DNA. Reaction conditions: Pre-denaturation at 95°C for 5 min; Annealing at 50°C for 1 min; Incubation at 4°C. The annealing system is as shown in Table 1 below:
[0119] Table 1 Annealing System
[0120]
[0121] 1.1.3 Preparation of Linear Vector
[0122] The linearization of the vector is carried out by inverse PCR amplification.
[0123] 1.1.4 Recombination Reaction
[0124] The recombination system is as shown in Table 2 below. All the recombination enzymes used are from the IIOne Step Cloning Kit series. Recombination conditions: 37°C for 30 min.
[0125] Table 2 Recombination System
[0126]
[0127] 1.1.5 Transformation of Plasmid
[0128] Take 20 μL of the above reaction solution, i.e., the liquid after plasmid recombination reaction, add it to 100 mL of DH5α competent cells for transformation. Gently mix and incubate on ice for 20 min, heat shock at 42°C for 42 s, immediately incubate on ice for 2 - 3 min, add 900 μL of SOC, and recover at 37°C for 1 h. Centrifuge at 8000 rpm for 2 min, discard part of the supernatant, leave about 200 μL, resuspend the bacteria and spread them on a plate containing 100 mg / L ampicillin. Invert the plate and incubate overnight at 37°C. After single colonies grow on the plate, identify them by colony PCR and select positive recombinants.
[0129] 1.2 Preparation of Recombinant DNA Fragment
[0130] The recombinant fragment for knockout consists of upstream and downstream homologous arms of the gene to be knocked out (upstream homologous arm - downstream homologous arm); the recombinant fragment for integration consists of upstream and downstream homologous arms of the integration site and the gene fragment to be integrated (upstream homologous arm - target gene - downstream homologous arm). Using the primer design software Oligo 7, with the upstream and downstream sequences of the gene to be knocked out or the integration site as templates, upstream and downstream homologous arm primers were designed (amplification length is about 300 - 500bp); with the gene to be integrated as the template, amplification primers for the integrated gene were designed. After separately amplifying the upstream and downstream homologous arms and the target gene fragment by PCR, the recombinant fragment was prepared by overlap PCR. The system and method of PCR are shown in Table 3 below:
[0131] Table 3 PCR amplification system
[0132]
[0133]
[0134] The system of overlap PCR is shown in Table 4 below:
[0135] Table 4 Overlap PCR amplification system
[0136] Component Volume <![CDATA[5×PrimeSRARBuffer(Mg 2+ Plus)]]> 10 μL dNTP Mixture 4 μL Forward Primer 2 μL Reverse Primer 2 μL (Forward Homologous Arm / Target Fragment / Reverse Homologous Arm) <200 ng PrimeSRARHSDNA Polymerase 0.5 μL <![CDATA[ddH2O]]> Up to 50 μL
[0137] PCR reaction conditions (Takara PrimeSTAR HS DNA Polymerase): Pre-denaturation (95°C) for 5 min; denaturation (98°C) for 10 s, annealing (60°C) for 15 s, extension at 72°C, cycle 30 times; continue extension at 72°C for 10 min; incubation (4°C).
[0138] 1.3 Transformation of plasmid and recombinant DNA fragment
[0139] 1.3.1 Transformation of pREDCas9
[0140] The pREDCas9 plasmid was electrotransformed into the electrocompetent cells of W3110 by electroporation. After the cells were resuscitated and cultured, they were spread on an LB plate containing spectinomycin (working concentration: 100 mg / L) and cultured overnight at 32°C. Single colonies growing on the resistant plate were subjected to colony PCR with identification primers to screen for positive recombinants.
[0141] 1.3.2 Preparation of electrocompetent cells of the target strain containing pREDCas9
[0142] Cultured at 32°C until OD 600 reached 0.1, IPTG with a final concentration of 0.1 mM was added, and the culture was continued until OD 600When it is 0.2 - 0.3, competent cell preparation is carried out. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium required for competent cell preparation and the preparation process refer to the conventional standard operation.
[0143] 1.3.3 Transformation of pGRB and recombinant DNA fragments
[0144] pGRB and the recombinant DNA fragments are simultaneously electrotransformed into electrocompetent cells containing pREDCas9. The bacteria after electrotransformation and resuscitation culture are spread on an LB plate containing 100 μg / mL ampicillin and spectinomycin, and cultured overnight at 32 °C. Colony PCR verification is carried out using the upstream primer of the upstream homologous arm and the downstream primer of the downstream homologous arm, or by designing specific identification primers, and positive recombinants are screened and the bacteria are preserved.
[0145] 1.4 Elimination of plasmids
[0146] 1.4.1 Elimination of pGRB
[0147] The positive recombinants are placed in an LB medium containing 20 mmol / L arabinose and cultured overnight at 32 °C. After appropriate dilution, they are spread on an LB plate with 100 μg / mL spectinomycin resistance and cultured overnight at 32 °C. Single colonies are respectively transferred to LB plates containing 100 μg / mL ampicillin and spectinomycin resistance, and single colonies that do not grow on the ampicillin plate but grow on the spectinomycin resistance plate are selected and the bacteria are preserved.
[0148] 1.4.2 Elimination of pREDCas9 plasmid
[0149] The positive recombinants are transferred to a non-resistant LB liquid medium and cultured overnight at 42 °C. After appropriate dilution, they are spread on a non-resistant LB plate and cultured overnight at 37 °C. For LB plates with and without spectinomycin resistance, single colonies that do not grow on the spectinomycin resistance plate but grow on the non-resistant plate are selected and the bacteria are preserved.
[0150] 2. Specific process for constructing E. coli N12 - 8 strain
[0151] This invention is based on the genetically engineered bacterium E. coli N12 constructed in the early stage (Food Science, 2023, 44(22): 158 - 164.), overexpressing the glucose - 6 - phosphate 1 - dehydrogenase gene zwf, overexpressing the 6 - phosphogluconate dehydrogenase gene gnd, overexpressing the aspartate aminotransferase gene aspC, overexpressing the phosphoenolpyruvate carboxylase gene ppc, deleting the glycerol kinase gene glpK, and overexpressing the point - mutated glycerol kinase gene glpK G913A, The glycerol dehydrogenase gene gldA was deleted to obtain the genetically engineered bacterium E. coli N12-7. The nicotinic acid nucleotide pyrophosphorylase gene nadC, NAD synthase gene ftnadE, quinoline synthase gene nadA, and aspartate oxidase gene nadB were tandemly expressed using an expression vector, and the constructed recombinant plasmid P-1 was introduced into E. coli N12-7 to obtain the genetically engineered bacterium E. coli N12-8.
[0152] 2.1 Integrate Ptrc-zwf (a fragment containing the trc promoter and the zwf gene) at the pseudogene yeep locus
[0153] Using the E. coli W3110 genome (ATCC27325) as a template, upstream homologous arm primers UP-yeep-S (SEQ ID NO.7), UP-yeep-Ptrc-A (SEQ ID NO.8) and downstream homologous arm primers DN-yeep-Ptrc-S (SEQ ID NO.9), DN-yeep-A (SEQ ID NO.10) were designed according to the upstream and downstream sequences of its yeep gene, and the upstream and downstream homologous arms of the yeep gene were amplified; primers UP-Ptrc-zwf-S (SEQ ID NO.11), DN-Ptrc-zwf-A (SEQ ID NO.12) were designed according to the zwf gene, and the zwf gene fragment was amplified. The promoter Ptrc was designed in the downstream primer of the upstream homologous arm of the yeep gene and the upstream primer of the zwf gene. The above fragments were used to obtain the integration fragment of the zwf gene (upstream homologous arm of the yeep gene - Ptrc-zwf - downstream homologous arm of the yeep gene) by overlap PCR. The DNA fragment containing the target sequence used for constructing pGRB-yeep was prepared by annealing primers gRNA-yeep-S (SEQ ID NO.13) and gRNA-yeep-A (SEQ ID NO.14), and the recombinant pGRB-yeep was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-yeep were electrotransformed into the competent cells of E. coli N12 containing the pREDCas9 vector, and the cells recovered after electrotransformation were spread on an LB plate containing ampicillin and gentamicin (working concentration: 100 mg / L), and positive recombinants were verified by PCR after overnight culture at 32°C. Then, pGRB-yeep used for gene editing was eliminated to obtain the strain E. coli N12-1. The verification diagram is as Figure 2 shown.
[0154] 2.2 Integrate Ptrc-gnd (a fragment containing the trc promoter and the gnd gene) at the pseudogene yjiv locus
[0155] Using the E. coli W3110 genome as a template, upstream homologous arm primers UP-yjiv-S (SEQ ID NO.15), UP-yjiv-Ptrc-A (SEQ ID NO.16) and downstream homologous arm primers DN-yjiv-Ptrc-S (SEQ ID NO.17), DN-yjiv-A (SEQ ID NO.18) were designed according to the upstream and downstream sequences of its yjiv gene, and the upstream and downstream homologous arms of the yjiv gene were amplified; primers UP-Ptrc-gnd-S (SEQ ID NO.19), DN-Ptrc-gnd-A (SEQ ID NO.20) were designed according to the gnd gene, and the gnd gene fragment was amplified. The promoter Ptrc was designed in the downstream primer of the upstream homologous arm of the yjiv gene and the upstream primer of the gnd gene. The above fragments were used to obtain the integration fragment of the gnd gene (upstream homologous arm of the yjiv gene - Ptrc - gnd - downstream homologous arm of the yjiv gene) by the method of overlap PCR. The DNA fragment containing the target sequence used for constructing pGRB-yjiv was prepared by annealing primers gRNA-yjiv-S (SEQ ID NO.21) and gRNA-yjiv-A (SEQ ID NO.22), and the recombinant pGRB-yjiv was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-yjiv were electrotransformed into the competent E. coli N12-1 cells containing the pREDCas9 vector. The transformed cells were spread on an LB plate containing ampicillin and gentamycin (working concentration: 100 mg / L), and the positive recombinants were verified by PCR after overnight culture at 32°C. Then, pGRB-yjiv used for gene editing was removed to obtain the strain E. coli N12-2. The verification diagram is as shown in Figure 3 shown.
[0156] 2.4 Integrate Ptrc-aspC (fragment containing the trc promoter and the aspC gene) at the pseudogene rph locus
[0157] Using the E. coli W3110 genome as a template, upstream homologous arm primers UP-rph-S (SEQ ID NO.23), UP-rph-Ptrc-A (SEQ ID NO.24) and downstream homologous arm primers DN-rph-Ptrc-S (SEQ ID NO.25), DN-rph-A (SEQ ID NO.26) were designed according to the upstream and downstream sequences of its rph gene, and the upstream and downstream homologous arms of the rph gene were amplified; primers UP-Ptrc-aspC-S (SEQ ID NO.27), DN-Ptrc-aspC-A (SEQ ID NO.28) were designed according to the aspC gene, and the aspC gene fragment was amplified. The promoter Ptrc was designed in the downstream primer of the upstream homologous arm of the rph gene and the upstream primer of the aspC gene. The above fragments were used to obtain the integration fragment of the aspC gene (upstream homologous arm of the rph gene - Ptrc - aspC - downstream homologous arm of the rph gene) by overlapping PCR. The DNA fragment containing the target sequence used for constructing pGRB-rph was prepared by annealing primers gRNA-rph-S (SEQ ID NO.29) and gRNA-rph-A (SEQ ID NO.30), and the recombinant pGRB-rph was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-rph were electrotransformed into competent E. coli N12-2 cells containing the pREDCas9 vector. The transformed cells were spread on an LB plate containing ampicillin and gentamicin (working concentration: 100 mg / L) and cultured overnight at 32°C. Positive recombinants were verified by PCR, and then pGRB-rph used for gene editing was eliminated to obtain strain E. coli N12-3. The verification diagram is as Figure 4 shown.
[0158] 2.5 Integrate Ptrc-ppc (fragment containing the trc promoter and the ppc gene) at the pseudogene yghX locus
[0159] Using the E. coli W3110 genome as a template, upstream homologous arm primers UP-yghX-S (SEQ ID NO.31), UP-yghX-Ptrc-A (SEQ ID NO.32) and downstream homologous arm primers DN-yghX-Ptrc-S (SEQ ID NO.33), DN-yghX-A (SEQ ID NO.34) were designed according to the upstream and downstream sequences of its yghX gene, and the upstream and downstream homologous arms of the yghX gene were amplified; primers UP-Ptrc-ppc-S (SEQ ID NO.35), DN-Ptrc-ppc-A (SEQ ID NO.36) were designed according to the ppc gene, and the ppc gene fragment was amplified. The promoter Ptrc was designed in the downstream primer of the upstream homologous arm of the yghX gene and the upstream primer of the ppc gene. The above fragments were used to obtain the integration fragment of the ppc gene (upstream homologous arm of the yghX gene - Ptrc - ppc - downstream homologous arm of the yghX gene) by overlapping PCR. The DNA fragment containing the target sequence used for constructing pGRB-yghX was prepared by annealing primers gRNA-yghX-S (SEQ ID NO.37) and gRNA-yghX-A (SEQ ID NO.38), and the recombinant pGRB-yghX was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-yghX were electrotransformed into competent E. coli N12-3 cells containing the pREDCas9 vector. The bacteria after resuscitation culture after electrotransformation were spread on an LB plate containing ampicillin and gentamicin (working concentration: 100 mg / L), and positive recombinants were verified by PCR after overnight culture at 32°C. Then, pGRB-yghX used for gene editing was eliminated to obtain the strain E. coli N12-4. The verification figure is as Figure 5 shown.
[0160] 2.6 glpK gene knockout
[0161] According to the upstream and downstream sequences of the glpK gene, the upstream homologous arm primers UP-glpK-S (SEQ ID NO.39), UP-glpK-A (SEQ ID NO.40) and the downstream homologous arm primers DN-glpK-S (SEQ ID NO.41), DN-glpK-A (SEQ ID NO.42) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the gene of interest was prepared by annealing the primers gRNA-glpK-S (SEQ ID NO.43) and gRNA-glpK-A (SEQ ID NO.44), and the recombinant pGRB-glpK was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-glpK were electrotransformed into the competent cells of E. coli N12-4 containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-glpK used for gene editing was eliminated, namely strain E. coli N12-5. The verification diagram is as Figure 6 shown.
[0162] 2.7 Integrate Ptrc-glpK G913A (fragment containing the trc promoter and the glpK G913A gene) at the pseudogene yncI locus
[0163] Using the genome of E. coli W3110 as a template, according to the upstream and downstream sequences of its yncI gene, the upstream homologous arm primers UP-yncI-S (SEQ ID NO.45), UP-yncI-Ptrc-A (SEQ ID NO.46) and the downstream homologous arm primers DN-yncI-Ptrc-S (SEQ ID NO.47), DN-yncI-A (SEQ ID NO.48) were designed, and the upstream and downstream homologous arms of the yncI gene were amplified; according to the glpK G913A gene, the primers UP-Ptrc-glpK G913A -S (SEQ ID NO.49), DN-Ptrc-glpK G913A -A (SEQ ID NO.50) were designed, and the glpK G913A gene fragment was amplified. The promoter Ptrc was designed in the downstream primer of the upstream homologous arm of the yncI gene and the upstream primer of the glpK G913A gene. The above fragments were obtained by overlapping PCR to obtain the integration fragment of the glpK G913A gene (upstream homologous arm of the yncI gene - Ptrc-glpK G913A-yncI gene downstream homologous arm), the DNA fragment containing the target sequence used for constructing pGRB-yncI was prepared by annealing primers gRNA-yncI-S (SEQ ID NO.51) and gRNA-yncI-A (SEQ ID NO.52), and the recombinant pGRB-yncI was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-yncI were electrotransformed into competent E. coli N12-5 cells containing the pREDCas9 vector, and the cells recovered after electrotransformation were spread on an LB plate containing ampicillin and gentamycin (working concentration: 100 mg / L), and positive recombinants were verified by PCR after overnight culture at 32 °C. Then, pGRB-yncI used for gene editing was eliminated to obtain strain E. coli N12-6. The verification diagram is as shown in Figure 7 shown.
[0164] 2.8 gldA gene knockout
[0165] According to the upstream and downstream sequences of the gldA gene, upstream homologous arm primers UP-gldA-S (SEQ ID NO.53), UP-gldA-A (SEQ ID NO.54) and downstream homologous arm primers DN-gldA-S (SEQ ID NO.55), DN-gldA-A (SEQ ID NO.56) were designed. Using the genome of strain E. coli W3110 as a template, the upstream and downstream homologous arms were amplified by PCR technology, and the gene knockout fragment (upstream homologous arm - downstream homologous arm) was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gene of interest was prepared by annealing primers gRNA-gldA-S (SEQ ID NO.57) and gRNA-gldA-A (SEQ ID NO.58), and the recombinant pGRB-gldA was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-gldA were electrotransformed into competent E. coli N12-6 cells containing the pREDCas9 plasmid, and single colonies were obtained after recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-gldA used for gene editing was eliminated, namely strain E. coli N12-7. The verification diagram is as shown in Figure 8 shown.
[0166] 2.9 Construction of recombinant plasmid P-1
[0167] Using the E. coli W3110 genome as a template, the target gene nadA-liker primers Ptrc-nadA-linker-S (SEQ ID NO.59), nadA-linker-A (SEQ ID NO.60) and the target gene nadB-linker primers Ptrc-nadB-linker-S (SEQ ID NO.61), nadB-linker-A (SEQ ID NO.62) were designed according to the nadA-linker-nadB gene. The nadA-linker and nadB-linker fragments were obtained by PCR amplification technology, and the overlapping target fragment Ptrc-nadA-liker-nadB was obtained by recombinant PCR. Using the E. coli W3110 genome and the ftnadE gene synthesized by Ascentage (Tianjin) Biotechnology Co., Ltd. according to E. coli codon optimization as templates, the target gene primers Ptrc-nadC-S (SEQ ID NO.63), Ptrc-nadC-A (SEQ ID NO.64), Ptrc-ftnadE-S (SEQID NO.65) and Ptrc-ftnadE-A (SEQ ID NO.66) were designed according to the nadC and ftnadE genes. The target fragments Ptrc-ftnadE and Ptrc-nadC were obtained by PCR amplification technology. Primers with restriction enzyme sites were designed using the pCS plasmid as a template, including KpnI-Ptrc-S (SEQ ID NO.67), ApaI-Ptrc-A (SEQ ID NO.68), SalI-Ptrc-S (SEQ ID NO.69), HindIII-Ptrc-A (SEQ IDNO.70), SamI-Ptrc-S (SEQ ID NO.71) and BamHI-Ptrc-A (SEQ ID NO.72). The promoter Ptrc was designed in the upstream primers of the target gene and the restriction enzyme site. The target gene fragments ApaI-Ptrc-nadA-linker-nadB-KpnI, SalI-Ptrc-ftnadE-HindIII and SamI-Ptrc-nadC-BamHI were amplified by PCR. The pCS empty plasmid vector was digested with double enzymes to linearize it, and the target genes were successively ligated into the pCS empty plasmid vector. The recombinant plasmid was introduced into DH5α competent cells by chemical transformation method. The bacteria after chemical transformation and resuscitation culture were spread on an LB plate containing kanamycin (working concentration: 100 mg / L), and positive recombinants were verified by PCR after overnight culture at 37°C. After subculturing into a shake tube, it was preserved and the plasmid P-1 was extracted.The recombinant plasmid P-1 was introduced into competent N12-7 cells by electroporation. The cells recovered after electroporation were spread on an LB plate containing kanamycin (working concentration: 100 mg / L). After overnight culture at 37°C, positive recombinants were verified by PCR, namely strain E. coli N12-8. The verification diagram of the recombinant plasmid is as follows. Figure 9 as shown.
[0168] 3. Primers used in the strain construction process
[0169] All primers used in the strain construction process are shown in the following table:
[0170]
[0171]
[0172]
[0173]
[0174]
[0175] Example 2: Shake-flask fermentation of NMN using genetically engineered strain E. coli N12-8
[0176] The composition of the fermentation medium for shake-flask fermentation was as follows: glucose 10 g / L, glycerol 10 g / L, peptone 4 g / L, yeast extract 6 g / L, anhydrous citric acid 2 g / L, methionine 0.3 g / L, KH2PO4 5.5 g / L, K2HPO4 5 g / L, FeSO4·7H2O 2 g / L, FeSO4 20 mg / L, V B1 、V B3 、V B5 、V B12 2 mg / L each.
[0177] Fermentation process ①: The strain stored at -80°C was streaked on an activated slant and cultured at 37°C for 12 h, and subcultured once. A loopful of slant seeds was scraped with an inoculation loop and inoculated into a 500 mL Erlenmeyer flask containing 30 mL of seed medium, sealed with nine layers of gauze, and cultured at 37°C and 220 rpm for 10 h. Inoculate into a 500 ml Erlenmeyer flask containing fermentation medium (final volume 30 ml) at an inoculation amount of 15% of the volume of the seed culture solution, sealed with nine layers of gauze, and cultured with shaking at 37°C and 200 r / min. During the fermentation process, the pH was maintained at 6.7 - 7.2 by adding ammonia water; a 60% (m / v) glucose solution was added. There was no specific limitation on the addition amount of glucose, as long as the glucose concentration in the fermentation broth could be maintained below 5 g / L. After 24 h of shake-flask fermentation, the yield of NMN in the fermentation broth of strain E. coli N12-8 was 1.1 g / L.
[0178] Fermentation process ②: Inoculate the strain preserved at -80°C by streaking on an activated slant, culture at 37°C for 12 h, and subculture once. Scrape a loopful of slant seeds with an inoculation loop and inoculate it into a 500 mL Erlenmeyer flask containing 30 mL of seed medium, seal it with nine layers of gauze, and culture at 37°C and 220 rpm for 10 h. Inoculate into a 500 ml Erlenmeyer flask containing fermentation medium at an inoculum size of 15% of the volume of the seed culture solution (the final volume is 30 ml), seal it with nine layers of gauze, culture at 37°C and 200 r / min with shaking. During the fermentation process, maintain the pH at 6.7 - 7.2 by adding ammonia water; add a mixed solution of glucose and glycerol with a mass concentration of 60% (m / v), and the mass ratio of glucose to glycerol is 1:1. There is no special limitation on the addition amount of glucose and glycerol, as long as the concentrations of glucose and glycerol in the fermentation broth can be maintained below 5 g / L. After 24 h of shake flask fermentation, the yield of NMN in the fermentation broth of strain E. coli N12 - 8 is 1.8 g / L.
[0179] Among them, the composition of the seed medium for the shake flask fermentation is: glucose 10 - 15 g / L, glycerol 10 - 15 g / L, KH2PO4 1.0 - 1.5 g / L, MgSO4·7H2O 0.4 - 0.8 g / L, yeast extract 4 - 6 g / L, peptone 2 - 3 g / L, methionine 0.3 - 0.5 g / L, FeSO4·7H2O 10 - 12 mg / L, MnSO4·H2O 10 - 12 mg / L, V B1 、V B3 、V B5 、V B12 Each is 1 - 1.5 mg / L;
[0180] The composition of the fermentation medium for the shake flask fermentation is: glucose 10 - 15 g / L, glycerol 10 - 15 g / L, KH2PO4 2.0 - 2.5 g / L, MgSO4·7H2O 0.5 - 1.0 g / L, yeast extract 5 - 8 g / L, peptone 3 - 4 g / L, methionine 0.5 - 0.7 g / L, FeSO4·7H2O 10 - 12 mg / L, MnSO4·H2O 10 - 12 mg / L, V B1 、V B3 、V B5 、V B12 Each is 1 - 1.5 mg / L;
[0181] The medium used for the activated slant is: glucose 1 - 2 g / L, peptone 10 - 15 g / L, beef extract 10 - 15 g / L, yeast extract 5 - 8 g / L, NaCl 2.5 - 5 g / L, agar 20 g / L.
[0182] The strain E. coli N12-8 was used in fermentation processes ① and ②. The comparison graph of the fermentation results of NMN is shown in Figure 10 , and it can be seen from Figure 10 that by using a mixed carbon source of glucose and glycerol and performing 24-hour shake flask fermentation, the yield of NMN in the fermentation broth of the strain E. coli N12-8 was 1.8 g / L. Compared with shake flask fermentation using glucose as the single carbon source, the NMN yield increased by 63.6%.
[0183] Example 3: Fermentation tank batch fermentation of NMN using genetically engineered bacterium E. coli N12-8
[0184] The medium used for activating the slant in a 5L fermentation tank was: glucose 2 g / L, peptone 12 g / L, beef extract 12 g / L, yeast powder 6 g / L, NaCl 4 g / L, agar 20 g / L.
[0185] The seed medium for the 5L fermentation tank was: glucose 10 g / L, glycerol 10 g / L, KH2PO4 2.5 g / L, MgSO4·7H2O 1.0 g / L, citric acid 2 g / L, ammonium sulfate 1.0 g / L, methionine 0.5 g / L, yeast powder 5 g / L, peptone 4 g / L, FeSO4·7H2O 10 mg / L, MnSO4·H2O 10 mg / L, V B1 、V B3 、V B5 、V B12 each at 1 mg / L;
[0186] The fermentation medium for the 5L fermentation tank was: glucose 10 g / L, glycerol 10 g / L, KH2PO4 1 g / L, MgSO4·7H2O 2.0 g / L, yeast powder 6 g / L, peptone 4 g / L, ammonium sulfate 2.0 g / L, methionine 0.3 g / L, K2HPO4 5.5 g / L, FeSO4·7H2O 20 mg / L, MnSO4·7H2O 20 mg / L, V B1 、V B3 、V B5 、V B12 each at 2 mg / L.
[0187] Fermentation process: Take the bacterial solution of strain E. coli N12-8, evenly coat it on the activated slant, and conduct subculture; inoculate the strain on the activated slant into the seed medium, culture at 37 °C for 8-10 h, and maintain the pH value at 6.8-7.2 by adding ammonia water during the culture process; inoculate the seed liquid into the fermentation medium at an inoculation amount of 15-20%, and start fermentation culture; control the initial pH value of fermentation at 6.8-7.2; maintain the pH value at 6.8-7.2 by adding ammonia water during the fermentation process; when the mixed solution of glucose and glycerol in the medium is consumed, add a mixed solution of glucose and glycerol with a mass-volume concentration of 80% (m / v), and the mass ratio of glucose to glycerol is 1:1, and maintain the concentration of glucose and glycerol in the fermentation medium below 1 g / L. After culturing in a 5 L fermenter for 26 h, the yield of NMN reaches 8.2 g / L, and the fermentation process curve is shown in Figure 11 .
[0188] Among them, the medium used for the activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L;
[0189] The seed medium for fermentation culture in the fermenter is: glucose 15-20 g / L, glycerol 10-15 g / L, KH2PO4 2.5-3.0 g / L, MgSO4·7H2O 0.5-1.0 g / L, citric acid 2-3 g / L, ammonium sulfate 1.0-1.5 g / L, methionine 0.5-1 g / L, yeast powder 5-8 g / L, peptone 3-4 g / L, FeSO4·7H2O 10-12 mg / L, MnSO4·H2O 10-12 mg / L, V B1 、V B3 、V B5 、V B12 1-1.5 mg / L each;
[0190] The fermentation medium for fermentation culture in the fermenter is: glucose 10-15 g / L, glycerol 10-15 g / L, KH2PO4 4.5-6.5 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 6-10 g / L, peptone 4-6 g / L, ammonium sulfate 2.0-2.5 g / L, methionine 0.2-0.5 g / L, K2HPO4 4.5-6.5 g / L, FeSO4·7H2O 20-25 mg / L, MnSO4·7H2O 10-15 mg / L, V B1 、V B3 、V B5 、V B12 2-4 mg / L each.
[0191] The fermentation results are shown in Figure 11 , and it can be seen from Figure 11 that through systematic metabolic engineering, the genetically engineered bacterium E. coli N12 was modified (Food Science, 2023, 44(22): 158-164.). For example, the supply of precursors PRPP and aspartic acid was strengthened by overexpressing glucose-6-phosphate 1-dehydrogenase, 6-phosphogluconate dehydrogenase, aspartate aminotransferase, and phosphoenolpyruvate carboxylase in the genome; the metabolism of glycerol to precursor DHAP was enhanced by deleting glycerol kinase, overexpressing point-mutated glycerol kinase in the genome, and deleting glycerol dehydrogenase; the metabolism of aspartic acid to NMN was enhanced by tandemly expressing nicotinic acid nucleotide pyrophosphorylase, NAD synthase, quinoline synthase, and aspartate oxidase using an expression vector, ultimately achieving de novo synthesis of NMN.
[0192] In the prior art, Zhang Xueli et al. developed a method for de novo synthesis of NMN using engineered Escherichia coli. By overexpressing nadA / B / C / D / E genes, mazG gene, nadV gene, and two transporter genes in E. coli BL21, the engineered bacterium S17 produced 1.02 g / L of NMN after 24 h of shake-flask fermentation with glucose as the raw material, but 1 g / L of aspartic acid, 1 g / L of nicotinamide, and 10 g / L of glutamic acid needed to be supplemented (ACS Synthetic Biology, 2024, 13(8): 2425-2435.). In comparison, the engineered bacterium E. coli N12-8 constructed in the present invention produced 1.8 g / L of NMN after 24 h of shake-flask fermentation with glucose and glycerol as the raw materials, and no precursors needed to be supplemented during the fermentation process. Further, after culturing in a 5 L fermenter for 26 h, the yield of NMN can reach 8.2 g / L, which is the highest level of reported de novo synthesis of NMN.
[0193] The sequences used in the present invention are as follows:
[0194] The gene sequence of ftnadE is:
[0195] ATGAAAATTGTGAAAGATTTTAGCCCGAAAGAATATAGTCAGAAACTGGTGAACTGGC
[0196] TGAGCGATAGCTGCATGAACTATCCGGCGGAAGGCTTTGTGATTGGCCTGAGCGGCGG
[0197] CATTGATAGCGCGGTGGCGGCGAGCCTGGCGGTGAAAACCGGCCTGCCGACCACCGCG
[0198] CTGATTCTGCCGAGCGATAACAATCAGCATCAAGATATGCAAGATGCGCTGGAACTGA
[0199] TTGAAATGCTGAACATTGAACATTATACCATTAGCATTCAGCCGGCGTATGAAGCGTTT
[0200] CTGGCGAGCACGCAGAGCTTTACCAACCTGCAGAACAACCGTCAGCTGGTGATTAAAG
[0201] GCAACGCGCAAGCGCGCCTGCGCATGATGTATCTGTATGCGTATGCGCAGCAGTATAA
[0202] CCGCATTGTGATTGGCACCGATAACGCGTGCGAATGGTATATGGGCTATTTTACCAAAT
[0203] TTGGCGATGGCGCGGCGGATATTCTGCCGCTGGTGAACCTGAAAAAAAGCCAAGTGTT
[0204] TGAACTGGGCAAATATCTGGATGTGCCGAAAAACATTCTGGATAAAGCGCCGAGCGCG
[0205] GGCCTGTGGCAAGGTCAGACCGATGAAGATGAAATGGGCGTGACCTATCAAGAAATTG
[0206] ATGATTTTCTGGATGGCAAACAAGTGAGCGCGAAAGCGCTGGAACGCATTAACTTTTGGCATAACCGCAGCCATCATAAACGCAAACTGGCGCTGACCCCGAACTTTTAA;
[0207] The said glpK G913A has the gene sequence as follows:
[0208] ATGACTGAAAAAAAATATATCGTTGCGCTCGACCAGGGCACCACCAGCTCCCGCGCGG
[0209] TCGTAATGGATCACGATGCCAATATCATTAGCGTGTCGCAGCGCGAATTTGAGCAAAT
[0210] CTACCCAAAACCAGGTTGGGTAGAACACGACCCAATGGAAATCTGGGCCACCCAAAGC
[0211] TCCACGCTGGTAGAAGTGCTGGCGAAAGCCGATATCAGTTCCGATCAAATTGCAGCTA
[0212] TCGGTATTACGAACCAGCGTGAAACCACTATTGTCTGGGAAAAAGAAACCGGCAAGCC
[0213] TATCTATAACGCCATTGTCTGGCAGTGCCGTCGTACCGCAGAAATCTGCGAGCATTTAA
[0214] AACGTGACGGTTTAGAAGATTATATCCGCAGCAATACCGGTCTGGTGATTGACCCGTA
[0215] CTTTTCTGGCACCAAAGTGAAGTGGATCCTCGACCATGTGGAAGGCTCTCGCGAGCGT
[0216] GCACGTCGTGGTGAATTGCTGTTTGGTACGGTTGATACGTGGCTTATCTGGAAAATGAC
[0217] TCAGGGCCGTGTCCATGTGACCGATTACACCAACGCCTCTCGTACCATGTTGTTCAACA
[0218] TCCATACCCTGGACTGGGACGACAAAATGCTGGAAGTGCTGGATATTCCGCGCGAGAT
[0219] GCTGCCAGAAGTGCGTCGTTCTTCCGAAGTATACGGTCAGACTAACATTGGCGGCAAA
[0220] GGCGGCACGCGTATTCCAATCTCCGGGATCGCCGGTGACCAGCAGGCCGCGCTGTTTG
[0221] GTCAGTTGTGCGTGAAAGAAGGGATGGCGAAGAACACCTATGGCACTGGCTGCTTTAT
[0222] GCTGATGAACACTGGCGAGAAAGCGGTGAAATCAGAAAACGGCCTGCTGACCACCAT
[0223] CGCCTGCGGCCCGACTGGCGAAGTGAACTATGCGTTGGAA A GTGCGGTGTTTATGGCA
[0224] GGCGCATCCATTCAGTGGCTGCGCGATGAAATGAAGTTGATTAACGACGCCTACGATT
[0225] CCGAATATTTCGCCACCAAAGTGCAAAACACCAATGGTGTGTATGTGGTTCCGGCATTT
[0226] ACCGGGCTGGGTGCGCCGTACTGGGACCCGTATGCGCGCGGGGCGATTTTCGGTCTGA
[0227] CTCGTGGGGTGAACGCTAACCACATTATACGCGCGACGCTGGAGTCTATTGCTTATCAG
[0228] ACGCGTGACGTGCTGGAAGCGATGCAGGCCGACTCTGGTATCCGTCTGCACGCCCTGC
[0229] GCGTGGATGGTGGCGCAGTAGCAAACAATTTCCTGATGCAGTTCCAGTCCGATATTCTC
[0230] GGCACCCGCGTTGAGCGCCCGGAAGTGCGCGAAGTCACCGCATTGGGTGCGGCCTATC
[0231] TCGCAGGCCTGGCGGTTGGCTTCTGGCAGAACCTCGACGAGCTGCAAGAGAAAGCGGT
[0232] GATTGAGCGCGAGTTCCGTCCAGGCATCGAAACCACTGAGCGTAATTACCGTTACGCAGGCTGGAAAAAAGCGGTTAAACGCGCGATGGCGTGGGAAGAACACGACGAATAA;
[0233] The gene sequence of the linker of the fusion protein is as follows:
[0234] GGTGGTGGTGGTTCAGGTGGTGGTGGTTCAGGTGGTGGTGGTTCA;
[0235] The gene sequence of the pCS expression vector is as follows:
[0236] TAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCT
[0237] TTCGTCTTCACCTCGAGAATTGTGAGCGGATAACAATTGACATTGTGAGCGGATAACA
[0238] AGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGAGGAGAAAGGT
[0239] ACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGC
[0240] CCGGGGGATCCCATGGTACGCGTGCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCG
[0241] AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGAC
[0242] AAATCCGCCGCCCTAGACCTAGGGGATATATTCCGCTTCCTCGCTCACTGACTCGCTAC
[0243] GCTCGGTCGTTCGACTGCGGCGAGCGGAAATGGCTTACGAACGGGGCGGAGATTTCCT
[0244] GGAAGATGCCAGGAAGATACTTAACAGGGAAGTGAGAGGGCCGCGGCAAAGCCGTTT
[0245] TTCCATAGGCTCCGCCCCCCTGACAAGCATCACGAAATCTGACGCTCAAATCAGTGGT
[0246] GGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGCGGCTCCCTCGT
[0247] GCGCTCTCCTGTTCCTGCCTTTCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTT
[0248] GTCTCATTCCACGCCTGACACTCAGTTCCGGGTAGGCAGTTCGCTCCAAGCTGGACTGT
[0249] ATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGA
[0250] GTCCAACCCGGAAAGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTGATTT
[0251] AGAGGAGTTAGTCTTGAAGTCATGCGCCGGTTAAGGCTAAACTGAAAGGACAAGTTTT
[0252] GGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAGTTGGTAGCTCAGAGAA
[0253] CCTTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGC
[0254] AGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTTCTAGATTTC
[0255] AGTGCAATTTATCTCTTCAAATGTAGCACCTGAAGTCAGCCCCATACGATATAAGTTGT
[0256] TACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAA
[0257] CAAATCCAGATGGAGTTCTGAGGTCATTACTGGATCTATCAACAGGAGTCCAAGCGAG
[0258] CTCTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGAT
[0259] GCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTC
[0260] GCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCC
[0261] GCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGA
[0262] TATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCG
[0263] CGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGAT
[0264] CATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTC
[0265] GCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCAT
[0266] CAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCC
[0267] CGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACA
[0268] GCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCA
[0269] GTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGC
[0270] TGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAG
[0271] CCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAAT
[0272] CATGCGAAACGATCCTCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGA
[0273] TCCTTGGCGGCAAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAATTCCGACGTC;
[0274] The gene sequence of the trc promoter is as follows:
[0275] TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC;
[0276] The gene sequence of the trc terminator is as follows:
[0277] CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAAT;
[0278] Although embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will understand that: without departing from the spirit and scope of the present invention and the appended claims, various substitutions, changes, and modifications are possible. Therefore, the scope of the present invention is not limited to the content disclosed in the embodiments.
Claims
1. A genetically engineered strain for synthesizing NMN from scratch using a mixed carbon source, characterized in that: The genetically engineered strain is based on the genetically engineered bacteria E. coli N12 constructed in the early stage, and the strain overexpresses the glucose-6-phosphate 1-dehydrogenase gene zwf, overexpresses the 6-phosphogluconate dehydrogenase gene gnd, overexpresses the aspartate aminotransferase gene aspC, overexpresses the phosphoenolpyruvate carboxylase gene ppc, deletes the glycerol kinase gene glpK, and overexpresses the point-mutated glycerol kinase gene glpK. G913A , the glycerol dehydrogenase gene gldA was deleted to obtain the genetically engineered bacterium E.coli N12-7; an expression vector was used to tandemly express the nicotinic acid nucleotide pyrophosphorylase gene nadC, the NAD synthetase gene ftnadE, the quinoline synthase gene nadA, and the aspartate oxidase gene nadB to obtain the recombinant plasmid P-1, and the constructed recombinant plasmid P-1 was introduced into E.coli N12-7 to obtain the genetically engineered bacterium E.coliN12-8.
2. The genetically engineered strain according to claim 1, characterized in that: The E. coli N12 is a gene of E. coli W3110 in which the nicotinamide enzyme gene pncA, the nicotinamide nucleotide amidohydrolase gene pncC, the nicotinamide nucleotide adenylyltransferase gene nadR, the 5'-nucleotidase gene ushA, the phosphotransferase gene aphA, the ribonucleotide monophosphatase gene nagD, the pyrimidine 5'-nucleotidase gene yjjG, the 5' / 3'-nucleotidase gene surE are deleted, the nicotinic acid transporter gene niaP derived from Burkholderia cenocepacia is overexpressed, the nicotinamide ribose transporter protease gene pnuC derived from Bacillus mycoides is overexpressed, the PRPP transporter gene prsA is overexpressed, and the DNA binding transcription inhibitor gene purR is deleted; Alternatively, the zwf, gnd, aspC, ppc, glpK, gldA, nadA, nadB, and nadC genes are all from Escherichia coli, are wild-type genes, or are mutants encoding corresponding proteins or artificially modified genes, including substitution, deletion, or insertion of one or more amino acid residues at one or more sites, and the proteins encoded by the mutants or artificially modified genes have corresponding activities and no functional defects; the ftnadE gene is from Francisella tularensis; Alternatively, the gene sequence of ftnadE is SEQ ID NO.1; The glpK G913A The gene sequence is SEQ ID NO.
2.
3. The genetically engineered strain according to claim 1 or 2, characterized in that: The above genes have been registered in Gene Bank, and those skilled in the art can obtain these genes by PCR. As an example, the pncA gene is Gene ID 946276, the pncC gene is Gene ID 947169, the nadR gene is Gene ID 948911, the ushA gene is Gene ID 947331, the aphA gene is Gene ID 948562, the nagD gene is Gene ID 945283, the yjjG gene is Gene ID 948899, the surE gene is Gene ID 947211, the niaP gene is Gene ID 56561280, the pnuC gene is Gene ID66264729, the prsA gene is Gene ID 945772, the purR gene is Gene ID 945266, the zwf gene is Gene ID946370, the gnd gene is Gene ID 946554, and the aspC gene is Gene ID 94553, the ppc gene is Gene ID 948457, the glpK gene is Gene ID 948423, the gldA gene is Gene ID 948440, the nadA gene is Gene ID 945351, the nadB gene is Gene ID 947049, and the nadC gene is Gene ID 948869.
4. Use of the genetically engineered strain according to any one of claims 1 to 3 in the fermentation production of β-nicotinamide mononucleotide.
5. The method for constructing a genetically engineered strain according to any one of claims 1 to 3, characterized in that: The method comprises the following steps: introducing the P-1 plasmid into the obtained strain E. coli N12-7 by using the electroporation method.
6. The construction method according to claim 5, characterized in that: The genetically engineered strain E.coli N12-7 is constructed by gradually modifying E.coli N12 using CRISPR / Cas9-mediated gene editing technology, and the steps are as follows: (1) The glucose-6-phosphate 1-dehydrogenase gene zwf was integrated into the pseudogene site yeep and controlled by the trc promoter; (2) integration of the 6-phosphogluconate dehydrogenase gene gnd at the pseudogene site yjiv, controlled by the trc promoter; (3) integration of the aspartate aminotransferase gene aspC at the pseudogene site rph, controlled by the trc promoter; (4) integration of the phosphoenolpyruvate carboxylase gene ppc at the pseudogene site yghX, controlled by the trc promoter; (5) deletion of the glycerol kinase gene glpK; (6) Integration of point mutation of glycerol kinase gene glpK at pseudogene site yncI G913A , controlled by the trc promoter; (7) deletion of the glycerol dehydrogenase gene gldA; The operation order of steps (1) to (7) in the above steps is not limited, and they can be performed in any order that can be implemented by those skilled in the art. Alternatively, the construction method of the plasmid P-1 is to use an expression vector to construct a nadC-ftnadE-nadA-nadB four-gene tandem plasmid P-1, wherein nadA and nadB are assembled into an enzyme complex using a fusion protein linker to improve enzymatic efficiency; the recombinant plasmid construction includes preparation of a linearized vector, acquisition of a target fragment and homologous recombination; the nadA-linker-nadB gene is inserted into the KpnI and ApaI restriction sites, the ftnadE gene is inserted into the SalI and HindIII restriction sites, and the nadC gene is inserted into the SamI and BamHI restriction sites.
7. The construction method according to claim 6, characterized in that: The gene sequence of the fusion protein linker is SEQ ID NO.3; Alternatively, the expression vector is any common expression vector of Escherichia coli, including any one of pCS expression vector, pET expression vector, pTrc99a expression vector or pBAD expression vector; the gene sequence of pCS expression vector is SEQ ID NO.4; Alternatively, the gene sequence of the trc promoter is SEQ ID NO.5; The gene sequence of the trc terminator is SEQ ID NO.6; Alternatively, the CRISPR / Cas9-mediated gene editing technology includes constructing a recombinant fragment and a pGRB plasmid, simultaneously transforming the pGRB plasmid and the recombinant fragment into electroporated competent cells containing pREDCas9, and performing a plasmid elimination step to obtain a recombinant genetically engineered strain.
8. A method for producing β-nicotinamide mononucleotide NMN by fermentation using the genetically engineered strain according to any one of claims 1 to 3, characterized in that: The steps include: The genetically engineered strain is contacted with a fermentation medium for fermentation culture to prepare NMN.
9. The method according to claim 8, characterized in that: The fermentation culture includes shake flask fermentation or fermentation tank fermentation; During shake flask fermentation, the inoculation amount of the genetically engineered strain is 15-20%, the fermentation conditions are 37°C, 220r / min shaking culture, the pH is maintained at 6.7-7.2 during the fermentation process, the pH is adjusted by adding ammonia water, and the fermentation is carried out for 24-26 hours; during the fermentation process, a mixed solution of glucose and glycerol can also be added to maintain the fermentation process, and the concentration of glucose and glycerol in the fermentation liquid can be maintained below 5g / L; The fermentation culture in the fermenter is as follows: taking the bacterial liquid of the genetically engineered bacteria, evenly coating it on the activated slant, and performing subculture; inoculating the strain on the activated slant into the seed culture medium, culturing at 37°C for 8-10 hours, and maintaining the pH value at 6.8-7.2 by adding ammonia water during the culturing process; inoculating the seed liquid into the fermentation culture medium at an inoculation amount of 15-20%, and starting the fermentation culture; controlling the initial pH value of the fermentation at 6.8-7.2; maintaining the pH value at 6.8-7.2 by adding ammonia water during the fermentation process; after the glucose and glycerol in the culture medium are consumed, flowing a mixed solution of glucose and glycerol with a mass volume concentration of 80%, the mass ratio of glucose to glycerol is 1:1, maintaining the mixed concentration of glucose and glycerol in the fermentation culture medium below 1g / L, and fermenting for 26-30h to obtain the product.
10. The method according to claim 9, characterized in that: The shake flask fermentation was carried out in a 500 mL triangular flask. After 24 hours of shake flask fermentation, the concentration of NMN in the fermentation broth could reach 1.8 g / L. Alternatively, the fermentation tank fermentation is carried out in a 5L fermentation tank, and after fermentation in the 5L fermentation tank for 26 hours, the yield of NMN reaches 8.2 g / L; Alternatively, the fermentation medium is an Escherichia coli fermentation medium; Alternatively, the seed culture medium for the shake flask fermentation is composed of: glucose 10-15 g / L, glycerol 10-15 g / L, KH2PO4 1.0-1.5 g / L, MgSO4·7H2O 0.4-0.8 g / L, yeast powder 4-6 g / L, peptone 2-3 g / L, methionine 0.3-0.5 g / L, FeSO4·7H2O 10-12 mg / L, MnSO4·H2O 10-12 mg / L, V B1 、V B3 、V B5 、V B12 1-1.5 mg / L each; Alternatively, the fermentation medium of the shake flask fermentation is composed of: glucose 10-15 g / L, glycerol 10-15 g / L, KH2PO4 2.0-2.5 g / L, MgSO4·7H2O 0.5-1.0 g / L, yeast powder 5-8 g / L, peptone 3-4 g / L, methionine 0.5-0.7 g / L, FeSO4·7H2O 10-12 mg / L, MnSO4·H2O 10-12 mg / L, V B1 、V B3 、V B5 、V B12 1-1.5 mg / L each; Alternatively, the culture medium used for the activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L; Alternatively, the seed culture medium during fermentation in the fermenter is: glucose 15-20 g / L, glycerol 10-15 g / L, KH2PO4 2.5-3.0 g / L, MgSO4·7H2O 0.5-1.0 g / L, citric acid 2-3 g / L, ammonium sulfate 1.0-1.5 g / L, methionine 0.5-1 g / L, yeast powder 5-8 g / L, peptone 3-4 g / L, FeSO4·7H2O 10-12 mg / L, MnSO4·H2O 10-12 mg / L, V B1 、V B3 、V B5 、V B12 1-1.5 mg / L each; Alternatively, the fermentation medium during the fermentation culture in the fermenter is: glucose 10-15 g / L, glycerol 10-15 g / L, KH2PO4 4.5-6.5 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 6-10 g / L, peptone 4-6 g / L, ammonium sulfate 2.0-2.5 g / L, methionine 0.2-0.5 g / L, K2HPO4 4.5-6.5 g / L, FeSO4·7H2O 20-25 mg / L, MnSO4·7H2O 10-15 mg / L, V B1 、V B3 、V B5 、V B12 2-4mg / L each.
Citation Information
Patent Citations
Recombinant microorganisms producing high levels of β-nicotinamide mononucleotide and methods for producing β-nicotinamide mononucleotide
CN113755411B
Recombinant bacteria producing β-nicotinamide mononucleotide and construction method thereof, method for producing β-nicotinamide mononucleotide and application thereof
CN115725481B
Recombinant strain for producing beta-nicotinamide mononucleotide and application thereof
CN116064355A
Synthesis method of beta-nicotinamide mononucleotide
CN118127101A