A method for the enzymatic synthesis of a carbonyl reductase mutant and a montelukast sodium intermediate
Through the biocatalytic reaction of carbonyl reductase mutants, the problem of low chiral carbonyl reduction efficiency of montelukast sodium intermediate was solved, and the efficient preparation of montelukast sodium intermediate was achieved, with environmentally friendly industrialization potential.
Patent Information
- Application Number
- CN202510705364.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2045-05-29
AI Technical Summary
The reduction of chiral carbonyl groups of the montelukast intermediate is difficult to achieve efficient catalysis, and the prior art has the problem of low bonding rate and low catalytic activity of the enzyme.
A carbonyl reductase mutant was used to prepare the sodium montelukast intermediate by biocatalytic reaction, and the enzyme-catalyzed reaction was carried out at 33°C using coenzyme NADP+ and isopropanol as cosolvent and buffer PB.
It improves the yield and optical purity of the montelukast sodium intermediate, reduces the harm to the environment, and has good industrialization potential.
Smart Images

Figure CN120230730B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biopharmaceutical technology, and specifically relates to an enzyme-catalyzed synthesis method of a carbonyl reductase mutant and a montelukast sodium intermediate. Background Art
[0002] Montelukast sodium (structural formula shown below), originally developed by Merck Frost & Co., Canada, is an important leukotriene receptor antagonist widely used to treat asthma and allergic rhinitis. Research progress in its synthesis has primarily focused on optimizing the synthesis route, improving reaction conditions, and selecting intermediates (e.g., patents EP737186B1 and US5565473A).
[0003]
[0004] Currently, reduction of the chiral carbonyl group in the montelukast sodium intermediate (structural formula shown below) is crucial. Due to the complex structure of the substrate, poor water solubility, low substrate binding rate in the enzyme pocket, and low catalytic activity, further mutation optimization is urgently needed.
[0005] Summary of the Invention
[0006] The first object of the present invention is to provide a carbonyl reductase mutant.
[0007] The second purpose of the present invention is to provide an enzymatic synthesis method for a montelukast sodium intermediate, which utilizes an enzymatic method to perform an asymmetric reduction reaction to prepare an R-configured chiral alcohol.
[0008] To achieve the above object, the present invention provides the following technical solutions:
[0009] A carbonyl reductase mutant, whose amino acid sequence is shown in any one of SEQ ID NOs: 6 to 8, whose nucleotide sequence is shown in any one of SEQ ID NOs: 2 to 4, whose wild-type carbonyl reductase has an amino acid sequence shown in SEQ ID NO: 5, and whose nucleotide sequence is shown in SEQ ID NO: 1.
[0010] A method for the enzymatic synthesis of a montelukast sodium intermediate comprises: using compound II as a substrate, in the presence of a crude enzyme solution of the carbonyl reductase mutant of the present invention, a coenzyme, a coenzyme cycle hydrogen donor, a cosolvent, and a buffer, a biocatalytic reaction is performed to produce a montelukast sodium intermediate, namely compound I. The specific synthetic route is as follows:
[0011] ;
[0012] The preparation method of the crude enzyme solution of the carbonyl reductase mutant is as follows: the sequence of the carbonyl reductase mutant is synthesized by DNA sequence and then amplified by PCR, and then introduced into an expression vector to obtain a recombinant expression vector, and then the recombinant expression vector is transformed into Escherichia coli to obtain a clone strain, and after cultivation, the strain is collected by centrifugation and ultrasonically crushed to obtain the crude enzyme solution of the carbonyl reductase mutant.
[0013] Wherein, the coenzyme is NADP+.
[0014] Wherein, the coenzyme cycle hydrogen donor is isopropanol.
[0015] Wherein, the cosolvent is isopropyl alcohol.
[0016] The mass-to-volume ratio of the compound II to the crude enzyme solution of the carbonyl reductase mutant is 0.5 g:10 mL.
[0017] Wherein, the buffer solution is PB buffer solution.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] Compared to existing methods that use purely chemical routes to synthesize the montelukast sodium intermediate (Compound I), the present method does not require extreme catalytic environments such as high temperature and high pressure. This method also reduces the use of catalysts that are harmful to humans and the environment, reduces waste generation, and is environmentally friendly. Furthermore, because the carbonyl reductase mutant of the present invention exhibits excellent stereoselectivity, it can effectively improve yield and the optical purity of the product, demonstrating excellent potential for industrialization. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is the recombinant expression plasmid map. DETAILED DESCRIPTION
[0021] Below with reference to the accompanying drawings in the embodiments of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the reagents and biomaterials involved in the present invention are commercially available products.
[0022] Example 1 Preparation of carbonyl reductase
[0023] The original carbonyl reductase sequence and the mutant sequence were synthesized by DNA sequence and then amplified by PCR (DNA sequences are shown in SEQ ID NOs: 1-4), and the primer sequences are shown in SEQ ID NOs: 9-10.
[0024] F:CCCATATGACCGACCGTCTGAAACACAAAGTTG
[0025] R: CCGCTCGAGTTACTGAGCGGTGTAACCAC
[0026] Then, the NdeI and XhoI restriction sites of the expression vector pET-30a(+) (purchased from Shanghai Sangon Biotechnology Co., Ltd.) were introduced to obtain the recombinant expression vector. Figure 1 As shown, the strain was transformed into Escherichia coli BL21 (DE3) (purchased from Shanghai Sangon Biotechnology Co., Ltd.) and cloned after antibiotic resistance plate plating screening. After successful recombination, the obtained strain was activated overnight in LB medium (purchased from Shanghai Sangon Biotechnology Co., Ltd.) at 37°C, added to 200 mL of fermentation broth (LB medium), and cultured to an OD of 600 The pH value was 0.6-0.8, IPTG was added at a final concentration of 0.5 mM and cultured for 20 h (20-25 °C), the strains were collected by centrifugation and washed with 0.2 M PBS buffer at pH 7.0. 10 mL of 0.2 M PB buffer at pH 7.0 was added per gram of wet cells and ultrasonically disrupted to obtain crude carbonyl reductase enzyme solution.
[0027] Example 2 Preparation of Montelukast Sodium Intermediate
[0028]
[0029] To a 250ml conical flask, 60ml of PB buffer (0.2mM, pH 7.5) was added, followed by 10ml of the original crude enzyme solution (KRED-WT, amino acid sequence SEQ ID NO: 5), 3ml of isopropanol, 10mg of NADP+, and 0.5g of substrate. After mixing, the mixture was stirred at 33°C overnight to yield Compound I. HPLC analysis showed a conversion of 69.1% and an ee of 99.9%.
[0030] Example 3 Preparation of Montelukast Sodium Intermediate
[0031]
[0032] To a 250ml Erlenmeyer flask, 60ml of PB buffer (0.2mM, pH 7.5) was added, followed by 10ml of the crude mutant enzyme (KRED-T16A, amino acid sequence SEQ ID NO: 6), 3ml of isopropanol, 10mg of NADP+, and 0.5g of substrate. After mixing, the mixture was stirred at 33°C overnight to yield Compound I. HPLC analysis showed a conversion of 98.7% and an ee of 99.9%.
[0033] Example 4 Preparation of Montelukast Sodium Intermediate
[0034]
[0035] To a 250-ml conical flask, 60 mL of 0.2 mM PB buffer (pH 7.5) was added, followed by 10 mL of the crude mutant enzyme (KRED-T104L, amino acid sequence shown in SEQ ID NO: 7), 3 mL of isopropanol, 10 mg of NADP+, and 0.5 g of substrate. After mixing, the mixture was stirred overnight at 33°C to yield Compound I. HPLC analysis revealed a conversion of 75.1% and an ee of 100%.
[0036] Example 5 Preparation of Montelukast Sodium Intermediate
[0037]
[0038] To a 250-ml conical flask, 60 mL of 0.2 mM PB buffer (pH 7.5) was added, followed by 10 mL of the crude mutant enzyme (KRED-T104L+T16A, amino acid sequence shown in SEQ ID NO: 8), 3 mL of isopropanol, 10 mg of NADP+, and 0.5 g of substrate. After mixing, the mixture was stirred overnight at 33°C to yield Compound I. HPLC analysis revealed a conversion of 99.2% and an ee of 100%.
[0039] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.
Claims
1. A carbonyl reductase mutant, characterized in that: The amino acid sequence of the carbonyl reductase mutant is shown in any one of SEQ ID NOs: 6-8.
2. The carbonyl reductase mutant according to claim 1, characterized in that: The nucleotide sequence of the carbonyl reductase mutant is shown in any one of SEQ ID NOs: 2-4.
3. An enzymatic synthesis method for a montelukast sodium intermediate, characterized in that: Using compound II as a substrate, a biocatalytic reaction is performed in the presence of a crude enzyme solution of a carbonyl reductase mutant, a coenzyme, a coenzyme cycle hydrogen donor, a cosolvent, and a buffer to generate a montelukast sodium intermediate, namely compound I; the coenzyme is NADP+, the coenzyme cycle hydrogen donor and cosolvent are isopropanol, and the buffer is PB buffer; The specific synthetic route is as follows: The preparation method of the crude enzyme solution of the carbonyl reductase mutant is as follows: the sequence of the carbonyl reductase mutant according to claim 1 or 2 is subjected to DNA sequence synthesis and then PCR amplification, and then introduced into an expression vector to obtain a recombinant expression vector, and then the recombinant expression vector is transformed into Escherichia coli to obtain a clone strain, and after cultivation, the strain is collected by centrifugation and ultrasonically disrupted to obtain the crude enzyme solution of the carbonyl reductase mutant.
4. The enzymatic synthesis method of the montelukast sodium intermediate according to claim 3, characterized in that: The mass volume ratio of the compound II to the crude enzyme solution of the carbonyl reductase mutant is 0.5 g:10 mL.
Citation Information
Patent Citations
Method for preparing ticagrelor intermediate through enzymatic preparation
CN109112166A
Enzyme-catalyzed preparation method of (S) -N-Boc-3-hydroxypiperidine
CN109182410A