Primer probe composition for detecting DNA methylation level of SNCA gene and application of primer probe composition

Abstract

The invention discloses a primer probe composition for detecting the DNA methylation level of an SNCA gene and application of the primer probe composition. The nucleotide sequence of a primer comprises one or more of SEQ ID NO.1-2, SEQ ID NO.4-5, SEQ ID NO.7-8 and SEQ ID NO.10-11; the nucleotide sequence of the probe comprises one or more of SEQ ID NO. 3, SEQ ID NO. 6, SEQ ID NO. 9 and SEQ ID NO. 12; the primer probe composition can be used for detecting the DNA methylation level of the SNCA gene so as to diagnose the Parkinson's disease. The primer probe composition provided by the invention has higher specificity and accuracy, is simple to operate and has higher clinical practical value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a primer-probe composition for detecting the DNA methylation level of the SNCA gene and its application. Background Art

[0002] Parkinson's disease (PD) is a common neurodegenerative disease, and its main pathological features are the loss of dopaminergic neurons in the substantia nigra and the formation of Lewy bodies. The main component of Lewy bodies is abnormally aggregated α-synuclein (SNCA), and its abnormal expression is closely related to the pathogenesis of PD. DNA methylation is an important epigenetic modification method that regulates gene expression. There is a close association between the methylation status of the SNCA gene and the abnormal expression of α-synuclein, and the methylation level of the SNCA gene shows a hypomethylation trend in PD patients, suggesting that it may be a potential biomarker for the auxiliary diagnosis of PD.

[0003] However, current studies on the methylation of the SNCA gene in PD mostly focus on small sample cohorts, lack multi-center and large sample verification, and the relationship between its dynamic changes and disease progression still needs to be further explored. Summary of the Invention

[0004] In order to make up for the deficiencies of the prior art, the purpose of the present invention is to provide a primer-probe composition for detecting the DNA methylation level of the SNCA gene and its application, so as to evaluate the application value of the DNA methylation level of the SNCA gene in PD diagnosis.

[0005] In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0006] The first aspect of the present invention provides a primer-probe composition.

[0007] Further, the nucleotide sequences of the primers include one or more pairs among SEQ ID NO.1-2, SEQ ID NO.4-5, SEQ ID NO.7-8, SEQ ID NO.10-11; the nucleotide sequences of the probes include one or more among SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, SEQ ID NO.12.

[0008] Further, the primer-probe composition includes one or more of the combinations of SEQ ID NO.1-3, SEQ ID NO.4-6, SEQ ID NO.7-9, and SEQ ID NO.10-12.

[0009] Further, the primer-probe composition also contains primers and probes for detecting reference genes.

[0010] Preferably, the internal reference genes include, but are not limited to, GAPDH, β-actin, B2M, ACTB, SDHA, HPRT1, ARBP, etc.

[0011] The "internal reference genes" in the present application can be various house-keeping genes, which are stably expressed in cells and contribute to maintaining cell functions. House-keeping genes are expressed in various types of cells in an organism, and their products are genes encoding proteins essential for maintaining basic cell life activities, such as tubulin genes, glycolytic enzyme system genes, and ribosomal protein genes.

[0012] In the present invention, the primer-probe composition is used to detect the DNA methylation level of the SNCA gene, which is located on human chromosome 4q21-23 (NC_000004.12, 89724099-89838324), spanning approximately 121198 bp, Gene ID: 6622. The research section of this study is located between the 6704th and 7147th bp of the gene, and the sequence is as follows:

[0013] GGAGCCTAAGGAAAGAGACTTGACCTGGCTTTCGTCCTGCTTCTGATATTC

[0014] CCTTCTCCACAAGGGCTGAGAGATTAGGCTGCTTCTCCGGGATCCGCTTTT

[0015] CCCCGGGAAACGCGAGGATGCTCCATGGAGCGTGAGCATCCAACTTTTCTC

[0016] TCACATAAAATCTGTCTGCCCGCTCTCTTGGTTTTTCTCTGTAAAGTAAGCA

[0017] AGCTGCGTTTGGCAAATAATGAAATGGAAGTGCAAGGAGGCCAAGTCAAC

[0018] AGGTGGTAACGGGTTAACAAGTGCTGGCGCGGGGTCCGCTAGGGTGGAGG

[0019] CTGAGAACGCCCCCTCGGGTGGCTGGCGCGGGGTTGGAGACGGCCCGCGA

[0020] GTGTGAGCGGCGCCTGCTCAGGGTAGATAGCTGAGGGCGGGGGTGGATGT

[0021] TGGATGGATTAGAACCATCACACTTGGGCCTGCTGTTTG(SEQ ID NO.13). Further, the nucleotide sequence of the primer-probe composition includes the following components:

[0022] (1) Primer-probe combination for detecting the methylation level at CpG island position 1 of the SNCA gene:

[0023] SEQ ID NO.1: 5'-GGGGGGGAGATTAGGTTGTTTTTTCG-3';

[0024] SEQ ID NO.2: 5'-GGACCTCCACCCTAACGAACCCCGCGC-3';

[0025] SEQ ID NO.3: 5'-CCCTTTCGGGAAACGCGAGGATGTTTT-3';

[0026] (2) Primer-probe combination for detecting the methylation level at CpG island position 2 of the SNCA gene:

[0027] SEQ ID NO.4: 5'-AGGTTGTTTTTTCGGGATTCGTTTTTTTTC-3';

[0028] SEQ ID NO.5: 5'-CTTTACAAAAAAAAACCAAAAAAACG-3';

[0029] SEQ ID NO.6: 5'-CGCGAGGATGTTTTATGG-3';

[0030] (3) Primer-probe combination for detecting the methylation level at CpG island position 3 of the SNCA gene:

[0031] SEQ ID NO.7: 5'-GGGGGGGAGGAGGTTAAGTTAATAGGTGGTAAC-3';

[0032] SEQ ID NO.8: 5'-CCCGCCCTCAACTATCTACCCTAAACAAACGCCGC-3';

[0033] SEQ ID NO.9: 5'-GGTGGTAACGGGTTAATAAGTGTTGGCGCGGG-3';

[0034] (4) Primer probe combination for detecting methylation level at position 4 of the CpG island of the SNCA gene:

[0035] SEQ ID NO.10: 5'-CGGGTGGTTGGCGCGGGGTTGGAGAC-3';

[0036] SEQ ID NO.11: 5'-AACTCAAACAAACAACAAACCCAAATATAATAA-3';

[0037] SEQ ID NO. 12: 5'-GCGGCGTTTGTTTAGGGTAGATAGTTGAGGG-3'.

[0038] Further, the position 1 is at 6792 bp of the SNCA gene, the position 2 is at 6809 bp of the SNCA gene, the position 3 is at 6968 bp of the SNCA gene, and the position 4 is at 7049 bp of the SNCA gene.

[0039] In various aspects of the present invention, the primers and probes used are not limited to the specific sequences described in the present invention, but include those sequences that have at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99% identity thereto, and still retain their functions. Those skilled in the art can determine sequence identity by routine procedures.

[0040] In some embodiments, the primer can be labeled with a labeling substance. The labeling substance includes but is not limited to fluorescent substances, radioactive isotopes or enzymes. Among them, fluorescent substances include but are not limited to TAMRATTM, Alexa555, Alexa647, Cy3, Cy5 of the cyanine dye series, and fluorescein. Radioactive isotopes include but are not limited to 32P, 33P, and 35S. Enzymes include but are not limited to alkaline phosphatase and horseradish peroxidase.

[0041] In some embodiments, the two ends of the probe are independently provided with a fluorescent labeling group and a fluorescent quenching group. Preferably, the labeling group and the quenching group at the two ends of the probes of different sequences may be the same or different, preferably different.

[0042] The fluorescent labeling groups are each independently selected from one of FAM, VIC, HEX, JOE, Cy3, ROX and Cy5.

[0043] The fluorescence quenching groups are each independently selected from one of BHQ1, BHQ2, BHQ3, TAMRA and MGB.

[0044] A second aspect of the present invention provides a kit.

[0045] Furthermore, the kit comprises the primer-probe combination described in the first aspect of the present invention.

[0046] Furthermore, the kit also includes a bisulfite modification reagent and a conventional PCR amplification reagent.

[0047] Furthermore, the conventional PCR amplification reagents include dNTPs, DNA polymerase, and amplification buffer.

[0048] Furthermore, the kit also includes instructions.

[0049] In the present invention, suitable amounts of one or more primers or probes are provided in one or more containers, or fixed on a substrate, and primers can be provided suspended in an aqueous solution, or, for example, as a freeze-dried or lyophilized powder. Wherein, the container provided with nucleic acid can be any conventional container capable of accommodating the provided form, such as a microcentrifuge tube, an ampoule, or a bottle.

[0050] In certain applications, one or more primers or probes (as described above) may be provided in pre-measured, single-use amounts in separate, typically disposable tubes or equivalent containers. Using such a setup, samples to be tested for the presence of SNCA gene DNA methylation may be added to separate tubes and directly amplified.

[0051] In certain embodiments, the kit may contain the necessary reagents for performing a PCR amplification reaction, including DNA sample preparation reagents, enzymes for PCR, buffers, Mg 2+ and deoxyribonucleotides (dNTPs).

[0052] The enzymes of PCR include DNA polymerase and / or RNA polymerase.

[0053] dNTP is a nucleoside source for DNA amplification by PCR, and four types of dATP, dGTP, dCTP, and dTTP are necessary. In addition, dNTP can be chemically modified for use in the hot start method, for example, CleanAmpTM dNTP manufactured by TriLink BioTechnologies, Inc. can be used.

[0054] Preferably, the kit may further include a positive quality control product and a negative quality control product. Specifically, the positive quality control product is a human methylated standard DNA, and the negative quality control product is a human unmethylated standard DNA.

[0055] In the present invention, the "bisulfite modification reagent" refers to a reagent that, in some embodiments, comprises bisulfite, disulfite, hydrogen sulfite or a combination thereof. After the DNA is treated with the bisulfite reagent, its unmethylated cytosine nucleotides will be converted into uracil, while the methylated cytosine and other bases remain unchanged, so that, for example, methylated and unmethylated cytidine in a CpG dinucleotide sequence can be distinguished.

[0056] Preferably, the kit may also include a DNA purification reagent, a DNA extraction reagent, etc. Specifically, the DNA extraction reagent may include a lysis buffer, a binding buffer, a cleaning buffer, and an elution buffer. The lysis buffer is usually composed of a protein denaturant, a detergent, a pH buffer, and a nuclease inhibitor.

[0057] More preferably, the kit may also include instructions for indicating the detection operation steps and result judgment criteria.

[0058] In some of the embodiments, the kit can be used for the following detection platforms: PCR amplification method, fluorescent quantitative PCR method, digital PCR method, liquid phase chip method, third-generation sequencing method, second-generation sequencing method, pyrophosphate sequencing method, bisulfite conversion sequencing method, methylation chip method, simplified bisulfite sequencing technology or a combination thereof.

[0059] When implementing the present invention, other necessary instruments include pipettes, pipette tips, 1.5 ml microtubes, and other instruments widely used in molecular biology experiments. Devices include PCR, clean benches, tube centrifuges, and other instruments widely used in molecular biology experiments.

[0060] A third aspect of the present invention provides a method for detecting the DNA methylation level of the SNCA gene.

[0061] Furthermore, the method comprises performing PCR amplification on the sample DNA using the primer-probe combination described in the first aspect of the present invention.

[0062] Furthermore, the sample DNA is human genomic DNA treated with sulfite.

[0063] Preferably, the human genomic DNA is obtained from a human whole blood sample.

[0064] Preferably, the PCR amplification is performed under similar amplification conditions.

[0065] Preferably, the PCR amplification system includes: based on a total volume of 25 μL, the PCR amplification system includes: 12.5 μL of 2×PCR reaction buffer, 1 μL of upstream and downstream primers, 1 μL of probe, 5 μL of sample DNA, and the balance is water.

[0066] Preferably, the reaction conditions of the PCR amplification are:

[0067] 1) Pre-denaturation at 95°C for 30 seconds;

[0068] 2) denaturation at 95°C for 20 seconds, annealing at 49-52°C for 20 seconds, and extension at 72°C for 30 seconds, for 10 cycles;

[0069] 3) Denaturation at 95°C for 5 seconds, annealing at 53°C for 30 seconds, 35 cycles.

[0070] Further, when the combination of SEQ ID NO. 1-3 was used for PCR amplification, the annealing temperature was 51°C;

[0071] Preferably, when PCR amplification is performed using the combination of SEQ ID NO. 4-6, the annealing temperature is 49°C;

[0072] Preferably, when PCR amplification is performed using the combination of SEQ ID NO. 7-9, the annealing temperature is 50°C;

[0073] Preferably, when the combination of SEQ ID NO. 4-6 is used for PCR amplification, the annealing temperature is 52°C.

[0074] The present invention embodiment part provides the exemplary embodiment of amplification condition.However, the term "amplification condition" used herein relates to the temperature and / or incubation time that are suitable for obtaining the detectable amount of target.Therefore, the term "similar amplification condition" means that if desired, each target can be assayed at a similar temperature.The term "similar amplification condition" also refers to if desired, each target can be assayed under similar incubation time.In some cases, the term "similar amplification condition" also relates to the number of amplification cycles.However, it is well known in the art that the number of cycles is not always strict.For example, some samples can be removed or left before other samples for additional amplification cycles.In other cases, the term "similar amplification condition" also relates to the properties of the buffer used and the amplification reagent (enzyme, nucleotide, salt, etc.).The term "similar amplification condition" also refers to that conditions (e.g., time, buffer, number of cycles, temperature, etc.) can be slightly changed or can be the same.

[0075] The fourth aspect of the present invention provides use of the primer-probe combination described in the first aspect of the present invention in the preparation of a product for detecting the DNA methylation level of the SNCA gene.

[0076] The fifth aspect of the present invention provides use of the primer-probe combination described in the first aspect of the present invention in the preparation of a product for diagnosing Parkinson's disease.

[0077] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows:

[0078] This study used a SNCA gene methylation detection method based on the QPCR platform. Compared with pyrosequencing, it is not only more economical in cost, but also has a simple and rapid operation process and a high degree of automation, which can significantly shorten the analysis time and is suitable for large-scale screening and clinical applications. At the same time, QPCR has high sensitivity and specificity, can accurately detect low-abundance methylated DNA, and data analysis is also simpler. In addition, the newly designed primers and probes target specific methylation sites in the promoter region of the SNCA gene that are associated with Parkinson's disease (PD), have higher specificity and accuracy, can effectively avoid nonspecific interference, and significantly improve the sensitivity and repeatability of the detection. Compared with previous results, the new primers and probes performed better in detecting hypomethylated samples, can provide more reliable biomarkers for the auxiliary diagnosis of PD, and have higher clinical application value.

[0079] The existing patent for the detection of SNCA methylation level only shows the amplification curves of methylation and non-methylation of a single site, and does not apply actual clinical samples to methylation detection of normal people and Parkinson's disease people. The discrimination and detection effect of real samples are unclear. Moreover, although it is theoretically feasible to compare the results according to the calculation formula in the patent, the calculation is only based on the amplified CT value, which has problems of poor accuracy and repeatability. For the real scene application in the later clinical end, the test results will be unstable and prone to deviation.

[0080] We amplify the internal reference and methylation site plasmids respectively, establish their respective standard curves, and then calculate their respective copy numbers through the standard curves to calculate the methylation ratio. The results obtained in this way are more accurate and more stable.

[0081] Existing literature uses pyrophosphate sequencing to detect methylation at several sites, and the diagnostic efficacy is not high when tested with clinical samples.

[0082] We used the fluorescent quantitative PCR method to design primer probes specific for each site and tested clinical samples. The results showed that it can distinguish between normal and PD patient samples very well, with high diagnostic sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] Figure 1 This is the result of the detection of the DNA methylation level of the SNCA gene at position 1 of the patient's CpG island;

[0084] Figure 2 This is the result of the detection of the DNA methylation level of the SNCA gene at position 2 of the patient's CpG island;

[0085] Figure 3 This is the result of the detection of the DNA methylation level of the SNCA gene at position 3 of the patient's CpG island;

[0086] Figure 4 This is a graph showing the detection results of the DNA methylation level of the SNCA gene at CpG island position 4 of the patient. DETAILED DESCRIPTION

[0087] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0088] Unless otherwise specified, the experimental methods used in the following examples are generally carried out under conventional conditions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0089] Example

[0090] 1. Experimental Materials

[0091] Samples: Whole blood samples were used, and the samples came from Parkinson's disease patients (PD) and healthy controls.

[0092] Reagents: Whole blood nucleic acid extraction kit, sulfite conversion reagent, QPCR related reagents (including methylation site-specific primers and probes)

[0093] Instrument: Fluorescence quantitative PCR instrument

[0094] 2. Experimental Methods

[0095] Extraction and purification of whole blood nucleic acid DNA: Use a standard nucleic acid extraction kit or a commercial automated extraction instrument to extract nucleic acid DNA from the patient's whole blood sample and purify it to ensure high-quality DNA samples.

[0096] Sulfite conversion treatment: The extracted whole blood nucleic acid DNA is subjected to sulfite conversion treatment to convert unmethylated cytosine (C) into uracil (U), while methylated cytosine remains unchanged. This treatment step is the key to methylation detection.

[0097] Detection of SNCA gene methylation status: Real-time fluorescence quantitative PCR (QPCR) technology is used to amplify DNA fragments treated with bisulfite through methylation site-specific primers and probes, and the proportion of methylated cytosine at specific sites of the SNCA gene in patient samples is detected to reflect the methylation status of the site.

[0098] The reaction system for PCR amplification is 25 μL, including 2×PCR reaction mix 12.5 μL (including reaction solution and Taq enzyme), 1 μL each of the upstream and downstream primers in the 10 μM primers, 1 μL of the methylation fluorescent probe in 10 μM, 5 μL of the product after sulfite conversion, and H2O is added to 25 μL.

[0099] The reaction conditions for PCR amplification were as follows: 1) pre-denaturation at 95°C for 30 seconds; 2) denaturation at 95°C for 20 seconds, (51°C at position 1, 49°C at position 2, 50°C at position 3, 52°C at position 4) annealing for 20 seconds, extension at 72°C for 30 seconds, step 2) for 10 cycles; 3) denaturation at 95°C for 5 seconds, annealing at 53°C for 30 seconds (collecting fluorescence signals), for 35 cycles.

[0100] The sequences of the specific primers and probes used in the present invention for detecting the methylation status of the SNCA gene are shown in Table 1.

[0101] Table 1 Primer and probe sequences

[0102]

[0103] 3. Experimental Results

[0104] Figure 1 The left figure is the amplification curve of the internal reference ACTB, showing that the amplification CT values ​​of the samples are basically the same, with a CT value of 26. Figure 1 The right figure is the amplification curve of the first methylation site. Amplification was performed using a primer probe specific for methylation at this site. The results showed that the CT value of normal samples was 22, while the CT value of Parkinson's patients was 25. There was a significant difference between normal people and Parkinson's patients.

[0105] Figure 2 The left figure is the amplification curve of the internal reference ACTB, showing that the amplification CT values ​​of the samples are basically the same, with a CT value of 26. The right figure is the amplification curve of the second methylation site, which was amplified by a primer probe specific for methylation of this site. The results show that the CT value of normal samples is 21, while the CT value of Parkinson's patients is 25, and there is a significant difference between normal people and Parkinson's patients.

[0106] Figure 3The left figure is the amplification curve of the internal reference ACTB, showing that the amplification CT values ​​of the samples are basically the same, with a CT value of 27. The right figure is the amplification curve of the third methylation site, which was amplified by a primer probe specific for methylation of this site. The results show that the CT value of normal samples is 20, while the CT value of Parkinson's patients is 24, and there is a significant difference between normal people and Parkinson's patients.

[0107] Figure 4 The left figure is the amplification curve of the internal reference ACTB, showing that the amplification CT values ​​of the samples are basically the same, with a CT value of 26. The right figure is the amplification curve of the fourth methylation site, which was amplified by a primer probe specific for methylation of this site. The results show that the CT value of normal samples is 26, while the CT value of Parkinson's patients is 29, and there is a significant difference between normal people and Parkinson's patients.

[0108] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A primer-probe composition, characterized in that: The nucleotide sequence of the primer includes one or more of SEQ ID NO.1-2, SEQ ID NO.4-5, SEQ ID NO.7-8, and SEQ ID NO.10-11; the nucleotide sequence of the probe includes one or more of SEQ ID NO.3, SEQ ID NO.6, SEQ ID NO.9, and SEQ ID NO.

12.

2. The primer-probe combination according to claim 1, characterized in that The primer-probe combination includes one or more of a combination of SEQ ID NO.1-3, a combination of SEQ ID NO.4-6, a combination of SEQ ID NO.7-9, and a combination of SEQ ID NO.10-12.

3. A kit, characterized in that: The kit comprises the primer-probe combination according to any one of claims 1 to 2.

4. The kit according to claim 3, characterized in that The kit also includes a bisulfite modification reagent and a conventional PCR amplification reagent; Preferably, the conventional PCR amplification reagents include dNTPs, DNA polymerase, and amplification buffer; Preferably, the kit further comprises instructions.

5. A method for detecting the DNA methylation level of the SNCA gene, characterized in that: The method comprises performing PCR amplification on sample DNA using the primer-probe combination described in any one of claims 1-2.

6. The method according to claim 5, characterized in that The sample DNA is human genomic DNA treated with sulfite; Preferably, the human genomic DNA is obtained from a human whole blood sample; Preferably, the PCR amplification is performed under similar amplification conditions.

7. The method according to claim 6, characterized in that Based on a total volume of 25 μL, the PCR amplification system includes: 12.5 μL of 2×PCR reaction buffer, 1 μL of upstream and downstream primers, 1 μL of probe, 5 μL of sample DNA, and the balance is water; Preferably, the reaction conditions of the PCR amplification are: 1) Pre-denaturation at 95°C for 30 seconds; 2) denaturation at 95°C for 20 seconds, annealing at 49-52°C for 20 seconds, and extension at 72°C for 30 seconds, for 10 cycles; 3) Denaturation at 95°C for 5 seconds, annealing at 53°C for 30 seconds, 35 cycles.

8. The method according to claim 7, characterized in that When PCR amplification was performed using the combination of SEQ ID NO. 1-3, the annealing temperature was 51°C; Preferably, when PCR amplification is performed using the combination of SEQ ID NO. 4-6, the annealing temperature is 49°C; Preferably, when PCR amplification is performed using the combination of SEQ ID NO. 7-9, the annealing temperature is 50°C; Preferably, when the combination of SEQ ID NO. 4-6 is used for PCR amplification, the annealing temperature is 52°C.

9. Use of the primer-probe combination according to any one of claims 1 to 2 in the preparation of a product for detecting the DNA methylation level of the SNCA gene.

10. Use of the primer-probe combination according to any one of claims 1 to 2 in the preparation of a product for assisting the diagnosis of Parkinson's disease.

Images