Copper death nano preparation based on logic gating and preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a copper death nano preparation based on logic gating as well as a preparation method and application of the copper death nano preparation. The invention provides a probe group for targeting tumor and a related nano preparation. The preparation is based on tumor biomarkers GSH and miRNA and DNA repair enzyme APE1, and has a nucleic acid cascade line of targeted silence tumor GLUT1. According to the invention, the synthesis route of [Cu (tz)] is improved, and nucleic acid line elements and copper ions are selectively released at the tumor site; through stimulation of an endogenous marker, a gene silencing function and a fluorescence signal of an activation line, inhibition of glycolysis of tumor cells and enhancement of oxidative phosphorylation are caused, copper ions can be cooperated to sensitize tumor cell copper death, and meanwhile, the killing ability of cytotoxic T cells to tumor cells is enhanced; remodeling an immunosuppressive tumor microenvironment and preventing immune escape; and finally, accurate tumor imaging recognition and efficient combined treatment based on copper death are realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a logic-gated cuproptosis nanoplatform and its preparation method and application. Background Art

[0002] Cuproptosis, as a new type of cell death, is related to the excessive accumulation of intracellular copper ions and mitochondrial metabolism. In March 2022, Tsvetkov et al. first proposed the mechanism of cuproptosis, providing a new treatment approach for cancer treatment. However, the clinical translational application of cuproptosis still poses challenges. In cancer cells, high concentrations of glutathione (GSH) and the aerobic glycolysis metabolic pattern known as the "Warburg effect" limit the role of cuproptosis. Among them, GSH can scavenge free copper ions in cells to maintain copper homeostasis, while the Warburg effect helps cancer cells avoid mitochondrial damage caused by cuproptosis by reducing mitochondrial respiration. To increase the sensitivity of cancer cells to cuproptosis, scientists have developed various GSH-responsive copper-based nanomaterials loaded with glycolysis inhibitors for tumor-targeted copper ion delivery, promoting GSH consumption and glycolysis inhibition, and synergistically enhancing the tumor treatment effect. However, while the effect of cuproptosis is sensitized, due to the complex biological environment greatly affecting the targeting ability of nanomaterials, the problems of off-target effects and side effects cannot be ignored. Due to the extremely complex physiological environment, efficient and safe cuproptosis treatment still poses challenges, and it is necessary to endow cuproptosis with tumor-specific on-demand activation function to solve the off-target problem. Summary of the Invention

[0003] An object of the first aspect of the present invention is to provide a probe set targeting tumors.

[0004] An object of the second aspect of the present invention is to provide the application of the probe set of the first aspect of the present invention in the preparation of products for detecting tumors.

[0005] An object of the third aspect of the present invention is to provide a kit for detecting tumors.

[0006] An object of the fourth aspect of the present invention is to provide a nanoplatform.

[0007] An object of the fifth aspect of the present invention is to provide a preparation method of the nanoplatform of the fourth aspect of the present invention.

[0008] An object of the sixth aspect of the present invention is to provide the application of the probe set of the first aspect of the present invention and the nanoplatform of the fourth aspect of the present invention.

[0009] An object of the seventh aspect of the present invention is to provide an anti-tumor drug set.

[0010] To achieve the above object of the present invention, the technical solution adopted by the present invention is as follows:

[0011] In a first aspect of the present invention, a probe set targeting tumors is provided, including a probe targeting an endogenous nucleic acid marker in tumors and a probe targeting a DNA repair enzyme.

[0012] In some embodiments of the present invention, the endogenous nucleic acid markers in tumors include miR-21, let-7a, miR-221, TK1 mRNA, HOTAIR, SChLAP1, etc.

[0013] In some embodiments of the present invention, the DNA repair enzyme includes one of APE1 enzyme, TDG enzyme, and UDG enzyme.

[0014] Taking miR-21 and APE1 enzyme as examples below, using the H1 probe to represent the probe targeting the endogenous nucleic acid marker in tumors and H2 to represent the probe targeting the DNA repair enzyme, an example is given to illustrate the design concept of the present invention.

[0015] Design the H1 probe according to the target nucleic acid (miR-21). Preferably, the nucleic acid includes miRNA.

[0016] The probe H1 sequentially includes: an A sequence and a B sequence from 5' to 3'.

[0017] The B sequence is complementary to the target nucleic acid.

[0018] The A sequence is complementary to the 5' end of the B sequence; preferably, the A sequence is complementary to the 1st to 15th bases at the 5' end of the B sequence.

[0019] Design the H2P probe according to the repair enzyme and the ASO of GLUT1. Preferably, the repair enzymes include APE1, TDG, and UDG, etc., and the ASO sequence includes TGACGATACCGGAGCCAATG (SEQ ID NO: 1).

[0020] The probe H2P sequentially includes: a C sequence, a D sequence, an E sequence, an F sequence, and a G sequence from 5' to 3'.

[0021] The C sequence is a partial sequence of the ASO, i.e., TGACGATACCGG (SEQ ID NO: 2).

[0022] The D sequence is completely complementary to the A sequence.

[0023] The E sequence is completely complementary to the B sequence.

[0024] A deoxynucleotide is connected between the D sequence and the E sequence.

[0025] The F sequence is the remaining sequence of the ASO, i.e., AGCCAATG.

[0026] The G sequence is complementary to the 5'-end of the D sequence. Preferably, the G sequence is complementary to the first to sixth bases at the 5'-end of the D sequence.

[0027] A site for the action of a repair enzyme is connected between the F sequence and the G sequence. Preferably, the site is an AP abasic site.

[0028] At this time, in the H2P probe, the D sequence is complementary to the 3'-end of the E sequence (preferably, the first to fifteenth bases at the 3'-end are complementary), the F sequence, and the G sequence.

[0029] Preferably, a first fluorescent group is modified on the probe H1, a second fluorescent group is modified on the probe H2, and fluorescence resonance energy transfer FRET can occur between the first fluorescent group and the second fluorescent group. After the two probes are activated by the target nucleic acid and the repair enzyme respectively and an HCR reaction occurs, the two fluorescent groups will cause fluorescence resonance energy transfer due to approaching. Preferably, the nucleotide sequence of the probe targeting miR-21 is as shown in SEQ ID NO: 4.

[0030] Preferably, the nucleotide sequence of the probe targeting the DNA repair enzyme APE1 is as shown in SEQ ID NO: 5.

[0031] Preferably, the probe targeting miR-21 and / or the probe targeting the DNA repair enzyme APE1 has a fluorescent group.

[0032] Preferably, the fluorescent group is selected from Cy3, Cy5, HEX, FAM, FITC, SYBR GREEN, VIC or other conventional fluorescent groups in the art.

[0033] In the second aspect of the present invention, there is provided the use of the probe set of the first aspect of the present invention in the preparation of a product for detecting tumors.

[0034] In the third aspect of the present invention, there is provided a kit for detecting tumors, which kit includes the probe set of the first aspect of the present invention.

[0035] Preferably, the kit includes a buffer system, a negative control standard, and a positive control standard.

[0036] In the fourth aspect of the present invention, there is provided a nanoformulation, which nanoformulation includes the probe set described in the first aspect of the present invention and a copper(I) triazole coordination polymer.

[0037] Preferably, the cuprous triazole coordination polymer is copper(I) 1,2,4-triazole coordination polymer, which has been disclosed in the previous patent CN115381944A.

[0038] In the fifth aspect of the present invention, there is provided a method for preparing the nanoformulation described in the fourth aspect of the present invention, comprising the following steps:

[0039] Mix an aqueous cuprous solution, 1,2,4-triazole, and the probe group of the first aspect of the present invention, and react to obtain.

[0040] Preferably, the molar ratio of Cu + in the aqueous cuprous solution to 1,2,4-triazole is 1:(10-30).

[0041] Preferably, the aqueous cuprous solution consists of Cu + and a reducing agent; the reducing agent includes ascorbic acid or hydrazine hydrate.

[0042] Preferably, in the probe group, the molar ratio of H1 to H2P is (1-3):1.

[0043] Preferably, the reaction is carried out in a buffer solution, and the buffer solution includes at least one of Tris-HCl, PBS, and HBSS.

[0044] Preferably, the temperature of the reaction is 16-37 °C; more preferably 20-30 °C.

[0045] In the sixth aspect of the present invention, there is provided the use of the probe group of the first aspect of the present invention and the nanoformulation of the fourth aspect of the present invention in 1)-5):

[0046] 1) Preparing a product for treating tumors;

[0047] 2) Preparing an anti-tumor synergistic product;

[0048] 3) Preparing an anti-tumor drug resistance reversal product;

[0049] 4) Preparing a product for inhibiting glycolysis;

[0050] 5) Preparing a copper death promoter.

[0051] Preferably, the anti-tumor synergistic product is a product for enhancing the efficacy of another anti-tumor drug, and the another anti-tumor drug includes at least one of immune checkpoint inhibitors, anti-tumor factors, tumor antibodies, cancer vaccines, cell therapies, and small molecule drugs.

[0052] More preferably, the immune checkpoint inhibitors include PD-1 antibody and PD-L1 antibody.

[0053] Further preferably, the small molecule drug includes at least one of doxorubicin, paclitaxel, docetaxel, cisplatin, mitoxantrone, daunorubicin, vincristine, all-trans retinoic acid, idarubicin, lutotecan, irinotecan, 2-methoxyestradiol, gemcitabine, vinorelbine, 5-fluorouracil, methotrexate, capecitabine, lomustine, etoposide.

[0054] Further preferably, the anti-tumor factor includes tumor necrosis factor-α (TNF-α).

[0055] Preferably, the anti-tumor drug resistance reversal product means that when some drugs (including but not limited to cisplatin, 5-FU) are used as anti-tumor drugs for treating tumors, there are some tumors that are not very sensitive to the drug, or these tumors are resistant to the drug. At this time, the nano-formulation described in the fourth aspect of the present invention can be used in combination with the drug to reverse the resistance of the tumor to the drug.

[0056] Preferably, the product for inhibiting glycolysis is specifically reflected in inhibiting glucose uptake, reducing ATP levels, reducing lactic acid secretion, and inhibiting the expression of the GLUT1 gene.

[0057] Preferably, the product further includes pharmaceutically acceptable excipients.

[0058] Preferably, the pharmaceutically acceptable excipients include at least one of solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, antiadhesives, chelating agents, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoaming agents, thickeners, clathrates, humectants, absorbents, diluents, flocculants and deflocculants, filter aids, release retardants.

[0059] Furthermore, for the convenience of drug administration, the nano - preparation of the fourth aspect of the present invention can be processed into a specific dosage form together with any one or several pharmaceutically acceptable excipients. These excipients can be diluents (such as starch, pre - gelatinized starch, dextrin, sucrose, lactose, mannitol, microcrystalline cellulose, etc.), absorbents (such as calcium sulfate, calcium hydrogen phosphate, light magnesium oxide, calcium carbonate, etc.), wetting agents (such as water and ethanol, etc.), binders (such as hydroxypropyl methylcellulose, povidone, starch paste, syrup, etc.), disintegrants (such as dry starch, sodium carboxymethyl starch, low - substituted hydroxypropyl cellulose, effervescent disintegrants, cross - linked povidone, etc.), lubricants (such as magnesium stearate, talc, hydrogenated vegetable oil, polyethylene glycol, colloidal silicon dioxide, etc.), coloring agents (such as titanium dioxide, sunset yellow, methylene blue, medicinal iron oxide, etc.), coating materials (such as acrylic resin, hydroxypropyl methylcellulose, povidone, etc.), solvents (such as water for injection, ethanol, propylene glycol, glycerol, etc.), acid - base regulators (such as hydrochloric acid, lactic acid, sodium hydroxide, tartaric acid, sodium tartrate, etc.), antioxidants (such as sodium sulfite, sodium metabisulfite, sodium thiosulfate, etc.), bacteriostatic agents (such as phenol, benzyl alcohol, thimerosal, etc.), or can also be isotonic regulators (such as sodium chloride, glucose, etc.).

[0060] The above - mentioned pharmaceutically acceptable excipients are generally recognized for this purpose and serve as inactive ingredients of the medicament. Compilations of pharmaceutically acceptable excipients can be found in reference books such as Handbook of Pharmaceutical Excipients (2nd edition, edited by A. Wade and P. J. Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical Press, London, 1994); Catalogue of Medicinal Excipients in Chinese Pharmacopoeia, etc.

[0061] The object of the seventh aspect of the present invention is to provide an anti - tumor drug set, which includes the nano - preparation described in the fourth aspect of the present invention and other anti - tumor drugs, and the nano - preparation and other anti - tumor drugs exist independently.

[0062] Preferably, the other anti - tumor drugs include at least one of immune checkpoint inhibitors, tumor antibodies, anti - tumor factors, cancer vaccines, cell therapies, and small - molecule drugs.

[0063] More preferably, the immune checkpoint inhibitors include PD - 1 and PD - L1.

[0064] Further preferably, the small molecule drug includes at least one of doxorubicin, paclitaxel, docetaxel, cisplatin, mitoxantrone, daunorubicin, vincristine, all-trans retinoic acid, idarubicin, lutotecan, irinotecan, 2-methoxyestradiol, gemcitabine, vinorelbine, 5-fluorouracil, methotrexate, capecitabine, lomustine, etoposide.

[0065] Further preferably, the anti-tumor factor includes tumor necrosis factor-α (TNF-α).

[0066] In the probe set according to the first aspect of the present invention, the kit according to the third aspect of the present invention, the nanoformulation according to the fourth aspect of the present invention, and the anti-tumor drug set according to the seventh aspect of the present invention, the tumor includes at least one of solid tumors and hematological tumors; further preferably solid tumors.

[0067] Preferably, the solid tumor includes liver cancer, colorectal cancer, bladder cancer, breast cancer, cervical cancer, prostate cancer, glioma, melanoma, pancreatic cancer, nasopharyngeal cancer, lung cancer, gastric cancer, adrenocortical carcinoma, pararenal cortical carcinoma, anal cancer, appendiceal cancer, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, cholangiocarcinoma, bladder cancer, bone cancer, brain tumor, bronchial tumor, Burkitt lymphoma, carcinoid tumor, cardiac tumor, cholangiocarcinoma, chordoma, colorectal cancer, craniopharyngioma, ductal carcinoma in situ of breast, germ cell tumor, endometrial cancer, ependymoma, esophageal cancer, olfactory neuroblastoma, intracranial germ cell tumor, extragonadal germ cell tumor, eye cancer, fallopian tube cancer, gallbladder cancer, head and neck cancer, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, lip cancer, oral cancer, Merkel cell carcinoma, malignant mesothelioma, multiple endocrine neoplasia syndrome, mycosis fungoides, nasal and paranasal sinus cancer, neuroblastoma, non-small cell lung cancer, ovarian cancer, pancreatic neuroendocrine tumor, islet cell tumor, papillomatosis, paraganglioma, nasal and paranasal sinus cancer, parathyroid carcinoma, penile cancer, pharyngeal cancer, pituitary tumor, pleuropulmonary blastoma, primary peritoneal cancer, retinoblastoma, salivary gland tumor, sarcoma, Sézary syndrome, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, testicular cancer, thymoma and thymic carcinoma, thyroid cancer, urethral cancer, uterine cancer, endometrial and uterine sarcoma, vaginal cancer, vascular tumor, vulvar cancer, and solitary myeloma.

[0068] Preferably, the hematologic tumors are selected from B-cell acute lymphoblastic leukemia (BALL), T-cell acute lymphoblastic leukemia (TALL), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell prolymphocytic leukemia-like, blastic plasmacytoid dendritic cell neoplasm, Burkitt lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell - follicular lymphoma, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, non-Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, and preleukemia.

[0069] In some embodiments of the present invention, the tumor includes at least one of breast cancer, lung cancer, gastric cancer, cervical cancer, and bladder cancer.

[0070] The beneficial effects of the present invention are as follows:

[0071] The present invention provides a probe set targeting tumors and related nanoformulations. Based on multiple tumor biomarkers GSH, miRNA, and DNA repair enzyme APE1, a dual-input DNA logic gate is constructed to activate a nucleic acid cascade circuit with targeted silencing of tumor GLUT1; the synthesis route of copper-based porous coordination polymer [Cu(tz)] is improved to efficiently encapsulate nucleic acid circuit elements and selectively release nucleic acid circuit elements and copper ions at the tumor site; through the stimulation of endogenous markers, the gene silencing function and fluorescence signal of the circuit are activated to achieve the inhibition of GLUT1 expression, resulting in the inhibition of tumor cell glycolysis and the enhancement of oxidative phosphorylation, which can synergistically sensitize tumor cells to cuproptosis with copper ions, while enhancing the killing ability of cytotoxic T cells against tumor cells, remodeling the immunosuppressive tumor microenvironment and preventing immune escape; ultimately achieving precise tumor imaging recognition and efficient combination therapy based on cuproptosis. The present invention has the following specific advantages:

[0072] (1) The present invention first proposes a nanomaterial with logic-gated cuproptosis function, providing a new strategy for the clinical transformation of precision nanomedicine and personalized tumor diagnosis and treatment based on cuproptosis.

[0073] (2) The present invention improves the synthesis route of copper-based porous coordination polymer [Cu(tz)], truly realizing the "one-pot method" preparation, eliminating the need for multi-step synthesis and cumbersome washing steps, reducing drug loss, enabling nucleic acid drugs to be encapsulated into [Cu(tz)] internally through a one-step method under mild conditions, quickly generating cuproptosis nano-theranostic agents, ensuring that the raw materials will not be lost due to the washing steps, and increasing the nucleic acid drug loading rate by nearly ten times compared to the "multi-step method".

[0074] (3) The copper death nano-theranostic agent has the characteristics of on-demand activation, excellent accuracy, and selectivity. Different from the logic circuit designs composed of numerous DNA modules reported previously, the DNA logic circuit in the nano-theranostic agent proposed in the present invention consists of only two DNA hairpin probes, and can perfectly implement the logic gates activated by three tumor markers, namely small molecules, nucleic acids, and proteins, providing all-round guarantee for the on-demand activation of copper death and overcoming the bottleneck of the off-target effect of copper death in practical applications.

[0075] (4) The copper death nano-theranostic agent has cancer cell specificity and broad-spectrum anti-tumor efficacy. Through the on-demand activation design, the gene inhibition rate of this agent on cancer cells is 21.4 times that of normal cells. It has high cytotoxicity to various cancer cells such as breast cancer, lung cancer, gastric cancer, cervical cancer, and even cisplatin-resistant cancer cells. At the same time, it can maintain the glycolytic function and high cell viability of normal cells, greatly improving the safety of gene therapy and copper death therapy.

[0076] (5) Combining copper death, gene therapy, and immunotherapy, it has shown high-specific tumor diagnosis recognition and anti-tumor efficacy at the cellular level and animal level, indicating that this copper death nano-theranostic agent has the potential to be used as a therapeutic drug for the synergy of copper death, gene therapy, and immunotherapy in tumor diagnosis and treatment, and has good application prospects.

[0077] (6) This simple and universal nano-agent design is conducive to personalized customization. By reprogramming and designing the hairpin probe structure, the nano-agent can be activated according to the physiological state preset by the user, generating user-specified functions such as treatment and diagnosis, and has broad expandable potential, providing a very promising platform for research in various biomedical fields such as biosensing, bioimaging, and therapy. Description of the Drawings

[0078] The following further describes the present invention in conjunction with the drawings and embodiments, where:

[0079] Figure 1 is the experimental schematic diagram of the present invention.

[0080] Figure 2 is the schematic diagram of the DNA logic circuit operation taking "AND gate" as an example.

[0081] Figure 3 is the NUPACK analysis result, (A) comparison of the H2P of this scheme and (B) the H2P-II design reported in the literature.

[0082] Figure 4 is the verification result of the correctness of the DNA logic circuit: (A) PAGE electrophoresis analysis and (B) fluorescence spectrum analysis verify the correctness of the DNA logic circuit operation.

[0083] Figure 5 For the (A) PAGE electrophoresis analysis and (B) fluorescence spectrum analysis of DNA logic circuit operation using double AP sites and asymmetric H2P-II reported in the literature.

[0084] Figure 6 Results of the detection sensitivity verification of the DNA logic circuit: (A) Fluorescence spectrum results at different concentrations of miR 21 (normalized according to the fluorescence donor FD value at 565 nm); (B) Relationship diagram of the fluorescence value (F A / F D ) at 665 nm in Figure A and different concentrations of miR 21.

[0085] Figure 7 Results of the specificity verification of the DNA logic circuit: (A) Detection specificity of miR-21 and (B) Specificity for the APE1 digestion reaction.

[0086] Figure 8 Results of the characterization of the nanoplatform: (A) SEM morphological characterization results images of [Cu(tz)] and H1H2P@[Cu(tz)]; (B) Elemental analysis of H1H2P@[Cu(tz)]; (C) Hydrated particle size distribution of [Cu(tz)] and H1H2P@[Cu(tz)] measured by DLS; (D) Zeta potential distribution of H1, [Cu(tz)] and H1H2P@[Cu(tz)]; (E) PXRD patterns of simulated [Cu(tz)], synthesized [Cu(tz)] and H1H2P@[Cu(tz)].

[0087] Figure 9 Verification of the encapsulation efficiency of DNA by the [Cu(tz)] carrier and GSH responsiveness: (A) Fluorescence recovery of Cy5-H1@[Cu(tz)] at different concentrations of GSH; (B) Standard curve of Cy5-H1; (C) Fluorescence changes of Cy5-H1@[Cu(tz)] during long-term incubation in PBS.

[0088] Figure 10 Imaging study of H1H2P@[Cu(tz)] with a fluorescent group in living cells: (A) Confocal microscope images of the H1H2P@[Cu(tz)] composite nanomaterial after incubation with different cells for 4 h, scale bar = 20 μm; (B) Statistical graph of fluorescence intensity results.

[0089] Figure 11Verification results of GLUT1 gene silencing function selective for tumor cells: (A) GLUT1 mRNA expression level and inhibition rate, and (B) GLUT1 protein expression level after [Cu(tz)], H1H2A@[Cu(tz)], H1H2P@[Cu(tz)] were incubated with 5637 cells and SV-HUC-1 cells for 48 h; (C) Results of changes in GLUT1 protein level with the incubation concentration of H1H2P@[Cu(tz)].

[0090] Figure 12 CCK8 cell viability study after [Cu(tz)], H1H2A@[Cu(tz)], H1H2P@[Cu(tz)] were incubated with 5637 cells and SV-HUC-1 cells for 48 h.

[0091] Figure 13 Results after [Cu(tz)], H1H2A@[Cu(tz)], H1H2P@[Cu(tz)] were incubated with 5637 cells for 48 h: (A) Analysis of extracellular glucose level, (B) extracellular lactate level, and (C) intracellular ATP level.

[0092] Figure 14 Results of DLAT protein oligomerization after [Cu(tz)], H1H2A@[Cu(tz)], H1H2P@[Cu(tz)] were incubated with 5637 cells for 48 h: (A) Western blot analysis and (B) immunofluorescence analysis.

[0093] Figure 15 Results of the effect of H1H2P@[Cu(tz)] on enhancing TNF-α cytotoxicity: (A) Sensitization effect of H1H2P@[Cu(tz)] on TNF-α cytotoxicity in human bladder cancer cell line 5637, (B) mouse bladder cancer cell line MB49, and (C) mouse breast cancer cells.

[0094] Figure 16 Treatment results for nude mouse models bearing 5637 tumors: (A) Changes in tumor volume over time, (B) GLUT1 immunofluorescence staining, and (C) DLAT immunofluorescence staining images in different treatment groups, scale bar = 100 μm.

[0095] Figure 17 Treatment results for Balb / c mouse models bearing 4T1 tumors: (A) Changes in tumor volume over time in different treatment groups and flow cytometry analysis of (B) mature DC cells, (C) CD3 + CD8 + T cells, (D) M1 / M2, and (E) percentage of MDSC. Detailed implementation methods

[0096] The concept of the present invention and the resulting technical effects will be clearly and completely described below in conjunction with embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of the present invention.

[0097] As a new form of programmed cell death, cuproptosis has great application prospects in cancer treatment. However, its limited therapeutic effect and adverse non-specific reactions on normal tissues have hindered its practical application. Due to the very complex physiological environment, efficient and safe cuproptosis treatment is still challenging, and it is necessary to endow cuproptosis with tumor-specific on-demand activation function to solve the off-target problem. The present invention proposes a logic-gated cuproptosis nanotheranostic agent, which is composed of two DNA logic circuit components and a porous cuprous triazole coordination polymer (code name [Cu(tz)]) carrier, for on-demand activation of cuproptosis and synergistic tumor treatment research based on cuproptosis.

[0098] The principle is as Figure 1 shown. To facilitate the delivery and controlled release of DNA logic circuits and Cu(I) ions, the present invention selects porous, GSH-responsive [Cu(tz)] to in-situ encapsulate DNA hairpin probes H1 and H2P. To achieve "one-pot" synthesis and avoid loss of reactants, the present invention uses aqueous cuprous Cu(I) solution as the metal source, replacing the Cu2O nanoparticles that require multiple washing and centrifugation steps to collect as reported recently. The aqueous cuprous solution, two DNA probes (H1 and H2P), and ligand 1,2,4-triazole (Htz) are stirred and reacted at room temperature for half an hour, and after washing and drying, the nanotheranostic agent H1H2P@[Cu(tz)] co-precipitated with the DNA probes is obtained.

[0099] After the nanomedicine is endocytosed by tumor cells, it is degraded by the endogenously overexpressed glutathione (GSH) in tumor cells, and copper ions, H1 hairpin, and H2P hairpin are released in a programmed manner. The H1 hairpin carries a miR-21 complementary fragment and a fluorophore, and the H2P hairpin carries an APE1 enzyme recognition site (i.e., an abasic site), a fluorophore, and an ASO cleavage fragment that recognizes GLUT1 mRNA. The operating principle of the DNA logic circuit is as follows: When miR-21 (Input 1) and APE1 enzyme (Input 2) are present in the environment simultaneously, miR-21 hybridizes with the H1 hairpin to form the miR-21-H1 double strand, exposing the sticky ends. The APE1 enzyme recognizes and cleaves at the abasic (AP) site of the H2P hairpin to form the active H2. The sticky ends of miR-21-H1 hybridize with the activated hairpin H2, and the exposed H2 sequence can continue to hybridize with H1, thus triggering HCR to form the polymeric nanowire miR-21-(H1-H2)N. A large number of adjacent fluorescent donor-acceptor fluorophore pairs generate a cascaded amplified fluorescence resonance energy transfer (FRET) signal (Output 1). Tumor recognition and treatment efficacy monitoring can be performed based on the strength of the FRET signal. At the same time, due to the HCR reaction, the two H2s in each polymerization unit are reassembled into a complete ASO structural unit under the connection of H1, which can recognize GLUT1 mRNA and hybridize with it to form a double-stranded structure, thereby promoting RNase H-mediated mRNA cleavage, effectively silencing the mRNAs related to cuproptosis and glycolysis (Output 2). In contrast, normal cells with low levels of GSH, miR-21, and APE1 are difficult to activate the H1H2P@[Cu(tz)] nanomedicine, unable to release a large amount of Cu(I) ions or form complete GLUT1 ASOs, thereby reducing the off-target effects of cuproptosis and ASOs and improving the safety of tumor treatment. In vitro and in vivo results both show that this nanomedicine has excellent stimulus-responsive ability, high tumor selectivity, stability, and biocompatibility, ultimately overcoming the technical challenges of potential off-target effects and poor treatment efficacy in cuproptosis, and achieving precise recognition of cancer cells and combined treatment of controllable cuproptosis, gene therapy, and immunotherapy. This work provides the first example of logic-gated, customized, on-demand cuproptosis therapy, presenting new strategies for precision medicine and personalized treatment.

[0100] The specific process is shown in the following examples. The nucleic acid sequences involved in the DNA logic circuit design are shown in Table 1.

[0101] Table 1 Nucleic acid sequences involved in the DNA logic circuit design

[0102]

[0103] Wherein: the underscore is the stem of the hairpin; / idSpacer / represents a non-base site (recognizable and cleavable by APE1 enzyme); the split ASO sequences are shown in bold.

[0104] Example 1 Construction of a DNA logic gate nucleic acid circuit activated by tumor endogenous markers

[0105] 1. Design and construction of programmable nucleic acid circuits

[0106] Taking the construction of a logic "AND" gate with two endogenous markers miR-21 and DNA repair enzyme APE1 highly expressed in tumor cells as dual input signals as an example, triggering the HCR circuit to generate amplified FRET fluorescence signals, and simultaneously integrating to form numerous complete ASOs targeting and hybridizing GLUT1 mRNA. The principle process is as Figure 2 shown.

[0107] The comparative probe selected in the present invention is the asymmetric hairpin design H2P-II containing 2 AP sites reported in a similar literature (Chem. Sci., 2021, 12, 15710–15718, DOI: 10.1039 / d1sc05214d).

[0108] Using the nucleic acid energy calculation tool NUPACK to optimize the H2P probe design, H2P in the present invention is a hairpin containing only 1 AP site and with a symmetric structure ( Figure 3 A in Figure 3 )), while the comparative probe H2P-II is an asymmetric hairpin containing 2 AP sites (

[0109] B in

[0110] Experimental method: First, perform the APE1 digestion reaction on H2P. Specifically: incubate 400 nM H2P with 5 U / mL APE1 in 1×NEBuffer 4 buffer (20 mM Tris-acetate, pH 7.9, 10 mM magnesium acetate, 50 mM potassium acetate, 1 mM dithiothreitol) at 37 °C for 5 h, then inactivate at 65 °C for 20 min to complete the digestion process. Subsequently, perform the HCR reaction. Specifically: mix 5 μL miR-21 (0.5 μM), 2.5 μL H1 (4 μM), 12.5 μL H2P (0.4 μM, with or without APE1 digestion treatment), 5 μL MgCl2 (100 mM) to 50 μL PBS buffer, incubate at 37 °C for 4 h, and perform polyacrylamide gel electrophoresis (PAGE) imaging and fluorescence spectroscopy detection.

[0111] The experimental methods for other control groups (H2P-II, H2N) are the same as above, and H2P can be replaced with other sequences accordingly.

[0112] Experimental results: The results are as Figure 4 shown. Only when miR-21 and APE1 coexist, that is, when the input logic is (miR-21, APE1) = (1, 1), can the bright ladder-like bands unique to the HCR product be obtained ( Figure 4 lane 7 in A), and a significantly amplified FRET signal ( Figure 4 lane B in B). When the logical inputs are (0, 0), (1, 0), and (0, 1) ( Figure 4 lanes 2, 3, 5 in A, and Figure 4 other spectra in B), the logical outputs are all zero, presenting an ideal "AND gate", that is, only when both inputs are 1 can a non-zero output be provided, greatly avoiding unnecessary signal leakage. In contrast, the reported double-AP-site-containing, asymmetric H2P-II in the literature cannot well open the logic gate under double-input conditions, and the HCR ladder-like electrophoresis products ( Figure 5 lane 8 in A) and the FRET fluorescence signal ( Figure 5 lane B in B) are not obvious.

[0113] To further explore the importance of APE1 cleavage, in this example, an H2N in which APE1 does not work was introduced as a control probe. H2N is obtained by replacing the AP site in H2P with an adenine (A) complementary to the stem thymine (T). This replacement makes H2N not undergo the HCR reaction even in the presence of APE1 and miR-21 and still maintains an intact metastable structure ( Figure 4 lane 6 in A), revealing that the cleavage of APE1 is crucial for the correct operation of the HCR amplification circuit.

[0114] 3. Sensitivity verification of the DNA logic circuit

[0115] A series of miR-21 with different concentrations (0, 0.5, 1, 5, 10, 20, 50, 100 nM) was mixed with 2.5 μL of H1 (4 μM), 12.5 μL of H2P (0.4 μM, treated with APE1 enzyme), and 5 μL of MgCl2 (100 mM) to 50 μL of PBS buffer, incubated at 37 °C for 4 h, and fluorescence spectroscopy was performed.

[0116] The results are as Figure 6 shown. The FRET signal increases with the increase in the concentration of miR-21, and the signal ratio of the fluorescence receptor to the fluorescence donor (FA / FD) is linearly correlated with the concentration of the target miR-21 in the range of 0.5 - 20 nM. The equation is: FA / FD = 0.012CmiR-21 + 0.084, and the correlation coefficient is R2 = 0.996. The detection limit is 0.2 nM (S / N = 3).

[0117] 4. Specificity Verification of DNA Logic Circuit

[0118] To verify the specificity of the constructed DNA logic circuit for the APE1 cleavage reaction, the APE1 enzyme and NEB4 buffer in the APE1 cleavage reaction were replaced with bovine serum albumin (BSA), exonucleases (EXO I and EXO III), T4 DNA ligase, T7 RNA polymerase, and the corresponding buffers. After reacting with H2P, the HCR reaction was carried out. The reaction conditions were as follows: 5 μL of non-target sequence (0.5 μM) was mixed with 2.5 μL of H1 (4 μM), 12.5 μL of H2P (0.4 μM, treated with APE1 enzyme digestion), and 5 μL of MgCl2 (100 mM) to 50 μL of PBS buffer, incubated at 37 °C for 4 h, and fluorescence spectroscopy was performed.

[0119] Table 2 Non-target sequences used to verify the detection specificity of DNA logic circuit for target miR-21

[0120]

[0121] Bold indicates single-base mismatch sites.

[0122] The results were as Figure 7 shown. When single-base mismatch sequences (misA and misB) were added, the F A / F D signal was lower than that generated by the target miR-21. When other non-target microRNA sequences were added or the APE1 enzyme was replaced with other proteins / enzymes for the reaction, the F A / F D value was similar to that of the blank control group, indicating that the DNA logic circuit had excellent selectivity and anti-interference ability, which could be attributed to the programmable design of the probe.

[0123] Example 2 Preparation of Multifunctional Composite Nanomaterials

[0124] 1. Preparation of H1H2P@[Cu(tz)] Composite Material by "One-Pot Method"

[0125] 32 μL of H1 (100 μM) and 16 μL of H2P (100 μM) were dissolved in 200 μL of Htz (2 M) and 1552 μL of Tris-HCl (10 mM, pH 8.0), and 200 μL of freshly prepared cuprous solution (formed by mixing 100 mM Cu(NO3)2 and 10 mg of ascorbic acid as a reducing agent) was added. After stirring and reacting at room temperature for half an hour, a milky white suspension was formed. The product was collected by centrifugation at 12,000 rpm for 3 minutes, washed three times with ultrapure water, and then vacuum dried to obtain H1H2P@[Cu(tz)] powder for standby.

[0126] 2. Preparation of [Cu(tz)] nanoparticles by the "one-pot method"

[0127] Dissolve 200 μL of Htz (2 M) in 1600 μL of Tris-HCl (10 mM, pH 8.0), and add 200 μL of freshly prepared cuprous solution (prepared by mixing 100 mM Cu(NO3)2 with 10 mg of ascorbic acid as a reducing agent). After stirring the reaction at room temperature for half an hour, a milky white suspension is formed. The product is collected by centrifugation at 12000 rpm for 3 minutes, washed three times with ultrapure water, and then dried in vacuo to obtain [Cu(tz)] powder for standby.

[0128] 3. Preparation of H1H2A@[Cu(tz)] composite material by the "one-pot method"

[0129] Dissolve 32 μL of H1 (100 μM), 16 μL of H2A (100 μM), and 200 μL of Htz (2 M) in 1552 μL of Tris-HCl (10 mM, pH 8.0), and add 200 μL of freshly prepared cuprous solution (prepared by mixing 100 mM Cu(NO3)2 with 10 mg of ascorbic acid as a reducing agent). After stirring the reaction at room temperature for half an hour, a milky white suspension is formed. The product is collected by centrifugation at 12000 rpm for 3 minutes, washed three times with ultrapure water, and then dried in vacuo to obtain H1H2A@[Cu(tz)] powder for standby.

[0130] 4. Preparation of Cy5-H1@[Cu(tz)] composite material by the "one-pot method": Dissolve 48 μL of Cy5-labeled H1 (Cy5-H1, 100 μM) and 200 μL of Htz (2 M) in 1552 μL of Tris-HCl (10 mM, pH 8.0), and add 200 μL of freshly prepared cuprous solution (prepared by mixing 100 mM Cu(NO3)2 with 10 mg of ascorbic acid as a reducing agent). After stirring the reaction at room temperature for half an hour, a suspension is formed. The product is collected by centrifugation at 12000 rpm for 3 minutes, washed three times with ultrapure water, and then dried in vacuo to obtain Cy5-H1@[Cu(tz)] powder for standby.

[0131] Example 3 Basic characterization of multifunctional composite nanomaterials

[0132] 1. Results of SEM morphological characterization

[0133] Use a scanning electron microscope (SEM), dynamic light scattering instrument (DLS), Zeta potential analyzer, X-ray powder diffractometer (PXRD), etc. to characterize the morphological structure, element distribution, particle size, and electronegativity of the [Cu(tz)] nanoparticles and H1H2P@[Cu(tz)] composite nanomaterials prepared in Example 2.

[0134] SEM images showed that the prepared [Cu(tz)] and H1H2P@[Cu(tz)] both exhibited a uniform particle shape without obvious morphological changes ( Figure 8 in A). Elemental Mapping showed that the elements C, N, Cu, and the O and P elements specific to DNA were uniformly distributed within the H1H2P@[Cu(tz)] composite material ( Figure 8 in B). DLS data showed that the average hydrodynamic diameters of [Cu(tz)] and H1H2P@[Cu(tz)] were 160.7 nm and 185.3 nm, respectively, with good dispersibility ( Figure 8 in C). Zeta potential measurements showed that after encapsulating the negatively charged DNA probe, the surface charge of [Cu(tz)] changed from +34.6 mV to -10.3 mV ( Figure 8 in D). The PXRD patterns of the prepared [Cu(tz)] and H1H2P@[Cu(tz)] matched that of the simulated [Cu(tz)], indicating that the addition of the DNA probe had no effect on the crystal structure of [Cu(tz)] ( Figure 8 in E). These results indicated that the DNA probe was successfully encapsulated by [Cu(tz)].

[0135] 2. Verification of the encapsulation efficiency and GSH responsiveness of the [Cu(tz)] carrier for DNA

[0136] The high loading capacity and GSH-responsive release function of the [Cu(tz)] carrier for DNA probes are the key to achieving efficient logical operations in cancer cells. Therefore, after synthesizing Cy5-H1@[Cu(tz)] (prepared in Example 2) using Cy5-fluorescently labeled H1 (Cy5-H1) as the model DNA, the kinetics of Cy5-H1 release from Cy5-H1@[Cu(tz)] were studied by measuring the change in Cy5 fluorescence with varying GSH concentrations. The specific steps were as follows:

[0137] Cy5-H1@[Cu(tz)] (dispensed in PBS at a concentration of 100 μg mL -1 ) was incubated with different concentrations of GSH (0, 0.2, 0.5, 2, 5, 10 mM) for 1 h, and the increase in Cy5 fluorescence (λex = 643 nm, λem = 667 nm) was recorded in real time. To calculate the encapsulation efficiency, a standard curve was obtained with varying Cy5-H1 concentrations, and the amount of Cy5-H1 released from Cy5-H1@[Cu(tz)] at 10 mM GSH was calculated based on the linear fitting equation. The encapsulation efficiency (E) was calculated as:

[0138] E = A Cy5-H1 / A Cy5-H1@[Cu(tz)] = CCy5-H1 ×M Cy5-H1 ×2 mL / A Cy5-H1@[Cu(tz)]

[0139] Where A is the mass of Cy5-H1@[Cu(tz)], and M is the molecular weight of the Cy5-H1 chain.

[0140] Compared with the negligible fluorescence change in PBS (pH 7.4), the response release rate of Cy5-H1@[Cu(tz)] nanomaterials to GSH is very fast, and it can be degraded by GSH and recover more than 90% of the fluorescence within 12 minutes, indicating that Cy5-H1 is released ( Figure 9 in A). According to the fluorescence value when Cy5-H1@[Cu(tz)] is completely released under 10 mM GSH, and the standard curve of Cy5-H1 ( Figure 9 in B), the nucleic acid loading rate of Cy5-H1@[Cu(tz)] is calculated to be 4.8 wt% (mass ratio). This in-situ encapsulated nucleic acid loading efficiency is 10 times that of the previously reported DNA adsorbed on the surface of [Cu(tz)] nanosheets (Adv. Mater. 2021, 33, 2100849 doi:10.1002 / adma.202100849), indicating that higher loading efficiency can be obtained by the coprecipitation of DNA during the in-situ biomimetic mineralization process. In particular, after incubating Cy5-H1@[Cu(tz)] in PBS (pH 7.4) for 80 hours, the DNA leakage is only about 0.5 wt%, indicating that the composite material is highly stable under normal physiological conditions ( Figure 9 in C).

[0141] Example 4 Performance Study of the Nanotheranostic Agent at the Cellular Level

[0142] 1. Imaging Study of H1H2P@[Cu(tz)] with Fluorescent Groups in Living Cells

[0143] Since GSH, miR-21, and APE1 are all abnormally highly expressed in most cancer cells, the H1H2P@[Cu(tz)] composite nanomaterial is expected to distinguish cancer cells from normal cells by the intensity of the FRET imaging signal.

[0144] Human bladder cancer cells 5637, human breast cancer cells MCF-7, human non-small cell lung cancer A549, cisplatin-resistant A549 (A549 / DDP), human normal bladder cells SV-HUC-1, human normal mammary epithelial cells MCF-10A, and human normal embryonic lung fibroblasts HLF in the logarithmic growth phase were respectively seeded in confocal dishes. After the cells adhered, a H1H2P@[Cu(tz)] composite nanomaterial with a final concentration of 50 μg / mL was added. After incubation for 4 h, the cells were washed three times with PBS, and the fluorescence intensity of the cells was observed using a confocal laser scanning microscope (CLSM) (here, the fluorescent donor Cy3, the fluorescent acceptor Cy5, and the FRET signal were used as examples).

[0145] The results were as Figure 10 shown. After 4 h of material treatment, the FRET signal of cancer cells (including 5637, MCF-7, and A549 cells) was stronger than that of the corresponding normal cell lines SV-HUC-1, MCF-10A, and HLF cells, and the FRET signal in cisplatin-resistant A549 / DDP cells was higher than that in the parental strain A549. This is because the GSH level in cisplatin-resistant cancer cells is generally higher than that in parental cells, resulting in more release of DNA logic circuit components by the nanomaterial in resistant cells and generating higher fluorescence signals. These results indicate that the H1H2P@[Cu(tz)] composite nanomaterial can distinguish cancer cells from normal cells (**p<0.01), and is expected to distinguish cisplatin-resistant cells from parental strain cells.

[0146] 2. Verification of the selective GLUT1 gene silencing function in tumor cells

[0147] Theoretically, the activation of the DNA logic circuit in tumor cells can generate recombinant active ASOs fragments, thereby specifically silencing the GLUT1 gene in tumor cells. To verify the successful recombination of ASOs in tumor cells, in this example, an H2A without an ASO cleavage fragment was introduced as a control probe, and co-precipitated with the H1 hairpin to generate an H1H2A@[Cu(tz)] composite material without gene silencing function (prepared in Example 2). This introduction makes it impossible for H1H2A@[Cu(tz)] to generate ASOs even when an HCR reaction occurs in tumor cells, thus unable to affect the expression of GLUT1.

[0148] Human normal bladder cells SV-HUC-1 and human bladder cancer cells 5637 in the logarithmic growth phase were respectively seeded in 6-well plates (5×10 5(Cells / well), and incubate overnight until the cells adhere. Add equal amounts of 8 μg / mL [Cu(tz)] nanoparticles, H1H2A@[Cu(tz)], and H1H2P@[Cu(tz)] respectively and incubate with the cells for 48 h. After incubation, wash 3 times with PBS. On the one hand, use the HiPure total RNA Kits kit (Magen, China) to extract total RNA from the cells, and analyze the expression level of GLUT1 mRNA by quantitative reverse transcription polymerase chain reaction (qRT-PCR); on the other hand, perform Western blot analysis on the expression level of GLUT1 protein after lysing the cells with RIPA cell lysate (Beyotime, China).

[0149] The results are as Figure 11 shown in A below. After incubation with H1H2P@[Cu(tz)], the expression of GLUT1 mRNA in 5637 cells was significantly down-regulated, with an inhibition rate of 66.5%. At the same concentration, there was almost no change in the [Cu(tz)] and H1H2A@[Cu(tz)] groups. The gene inhibition rate of H1H2P@[Cu(tz)] on normal SV-HUC-1 cells was only 3.1%, and the differential multiple of gene inhibition reached 21.4 (the ratio of gene inhibition of cancer cells to normal cells). By effectively down-regulating GLUT1 mRNA, H1H2P@[Cu(tz)] can significantly inhibit the expression of GLUT1 protein in 5637 cells ( Figure 11 shown in B below), and the inhibitory effect of H1H2P@[Cu(tz)] on GLUT1 protein expression was enhanced with the increase of concentration ( Figure 11 shown in C below). In contrast, in SV-HUC-1 cells treated with H1H2P@[Cu(tz)], the expression of GLUT1 protein hardly changed, which is beneficial to maintaining its normal glucose metabolism. These results indicate that the H1H2P@[Cu(tz)] composite nanomaterial has good tumor cell-selective gene regulation ability, which is due to the targeting release ability of the [Cu(tz)] carrier to cancer cells, and then activates ASO through the HCR amplifier, thus avoiding the destruction of gene expression in normal cells and improving the safety of cancer gene therapy.

[0150] 3. High-specific killing of tumor cells

[0151] Due to the tumor cell-selective gene silencing function of H1H2P@[Cu(tz)], it theoretically has tumor-specific therapeutic effects. Human normal bladder cells SV-HUC-1 and human bladder cancer cells 5637 in the logarithmic growth phase were respectively inoculated into 96-well plates (5×10 3Cells / well), cultured overnight until the cells adhered, and different concentrations of [Cu(tz)] nanoparticles (0, 2, 4, 6, 8, 10, 12, 15 μg / mL), H1H2A@[Cu(tz)] composite nanoparticles without gene silencing function (0, 2, 4, 6, 8, 10, 12, 15 μg / mL) or H1H2P@[Cu(tz)] composite nanoparticles (0, 2, 4, 6, 8, 10, 12, 15 μg / mL) were incubated with the cells for 48 h respectively. The cytotoxicity was measured by the CCK8 method to explore the cytotoxicity effects of different concentrations of the nanomaterials on normal and cancer cells.

[0152] As Figure 12 shown, after treating normal SV-HUC-1 cells with [Cu(tz)], H1H2A@[Cu(tz)] and H1H2P@[Cu(tz)] for 48 h, even at a relatively high concentration (15 μg / mL), the cell viability exceeded 80%, indicating that these nanomaterials have good biocompatibility with normal cells. On the contrary, with the increase in the concentration of H1H2P@[Cu(tz)], the viability of 5637 cells decreased significantly. When the concentration was greater than 15 μg / mL, the viability of 5637 cells was only 5.3%. The half-maximal inhibitory concentration (IC 50 ) of H1H2P@[Cu(tz)] against SV-HUC-1 cells was 38.8 ± 0.5 μg / mL, which was 7.2 times that of the IC 50 (5.4 ± 0.4 μg / mL) against 5637 cells, indicating that the cytotoxicity of H1H2P@[Cu(tz)] against normal cells was significantly reduced.

[0153] In addition, other tumor cell lines were verified by the same method, and it was found that H1H2P@[Cu(tz)] had cytotoxicity against various tumor cell lines such as breast cancer cell lines (4T1, MCF-7 and MDA-MB-231), human lung cancer cell A549, human cervical cancer cell Hela, human gastric cancer cell MGC-803, etc. The IC 50 value was 2.6 ± 0.2 - 11.1 ± 0.7 μg / mL, showing that H1H2P@[Cu(tz)] had a broad-spectrum anti-tumor effect (Table 3).

[0154] It should be noted that H1H2P@[Cu(tz)] showed strong cytotoxicity against drug-resistant A549 / DDR cells, and the IC 50It is only 3.1 ± 0.5 μg / mL, which is consistent with the significant FRET signal shown by H1H2P@[Cu(tz)] in A549 / DDR cells, showing great potential to overcome tumor chemotherapy resistance. In contrast, H1H2P@[Cu(tz)] has less cytotoxicity to the corresponding normal cell lines MCF10A, HLF, HcerEpic, GES-1 and murine normal cells, indicating that this nanoplatform has high selectivity for cancer cells and low toxic and side effects on normal cells due to tumor-specific logic gate operation, thus improving the treatment safety.

[0155] Table 3 IC of H1H2P@[Cu(tz)] against different cells 50 value

[0156]

[0157]

[0158] The bold ones are normal cell lines.

[0159] 4. Copper death treatment characteristics enhanced by inhibiting glycolysis

[0160] To verify the inhibitory effect of H1H2P@[Cu(tz)] composite nanomaterials on aerobic glycolysis of tumor cells, human bladder cancer cells 5637 in the logarithmic growth phase were seeded in 12-well plates (2×10 5 cells / well) and incubated overnight for cell attachment. [Cu(tz)] nanoparticles, H1H2A@[Cu(tz)], and H1H2P@[Cu(tz)] were added respectively and incubated with the cells for 48 h. After incubation, on the one hand, the supernatant culture medium was collected, and the glucose and lactate levels in the supernatant culture medium were detected by a glucose detection kit (Beyotime, China) and a lactate detection kit (Abbkine, China); on the other hand, the cells were washed 3 times with PBS, lysed with the lysis reagent in an ATP detection kit (Beyotime, China), and the intracellular ATP level was detected according to the instructions to evaluate the inhibitory efficiency of H1H2P@[Cu(tz)] on aerobic glycolysis of 5637 cells.

[0161] The results are as Figure 13 shown in A. Compared with the untreated group, the extracellular glucose level after treatment with H1H2P@[Cu(tz)] was 2.2 times that of the untreated group, while there was no obvious change in other groups, confirming that H1H2P@[Cu(tz)] successfully blocked the glucose uptake of cancer cells by effectively inhibiting the expression of GLUT1, shutting down the intracellular energy source of cancer cells. With the blockade of glucose uptake, after treatment with H1H2P@[Cu(tz)], the intracellular ATP level of 5637 cells ( Figure 13in B) and secreted lactic acid ( Figure 13 in C) levels decreased by 75% and 58%, respectively. These results confirmed the glycolysis inhibitory ability of H1H2P@[Cu(tz)], which is expected to sensitize cancer cells to cuproptosis.

[0162] To verify the cuproptosis-related cell death mechanism mediated by H1H2P@[Cu(tz)], after 5637 cells were incubated with [Cu(tz)] nanoparticles, H1H2A@[Cu(tz)], and H1H2P@[Cu(tz)] for 48 h, Western blot and immunofluorescence methods were used to evaluate the characteristics of cuproptosis, namely the oligomerization of DLAT. The specific steps are as follows:

[0163] 5637 cells (5×10 5 cells per well) were seeded in 6-well plates and incubated with PBS, [Cu(tz)], H1H2A@[Cu(tz)], or H1H2P@[Cu(tz)] for 48 h. Erastin-copper (ES-Cu) was used as a positive control, and 1 μM CuCl2 was added 30 min before the addition of 75 nM ES. After 2 h of ES treatment, the cells were washed 3 times with PBS and incubated in fresh medium for another 24 h. After incubation, the cells were harvested, lysed with RIPA buffer (containing 1% PMSF), and the protein concentration was quantified using the Enhanced BCA protein Assay Kit (Beyotime). Equal amounts of protein from each sample were separated by SDS-PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane (0.22 μm, Millipore). At room temperature, the membrane was blocked with 5% BSA in Tris Buffered Saline Tween (TBST) for 1 h and immunoblotted with a primary antibody against DLAT (1:2000, Proteintech) overnight at 4°C. Then, it was washed three times with TBST and incubated with an HRP-conjugated secondary antibody (1:10000, CST) at room temperature for 1 h. Finally, protein bands were imaged using an enhanced chemiluminescence (ECL) substrate kit (Thermo Fisher Scientific, USA) and an iBright CL1000 gel imaging system (Thermo Fisher Scientific, USA).

[0164] In the immunofluorescence experiment, the 5637 cells after drug treatment were fixed in 4% paraformaldehyde at room temperature for 15 minutes, and then permeabilized with 0.2% Triton X-100 for 15 minutes. After that, the cells were blocked with a blocking solution (Beyotime) at room temperature for 1 hour and incubated overnight with the DLAT antibody (1:200, Proteintech) at 4°C. After washing four times with PBST (1×PBS containing 0.05% Tween-20), the cells were treated with a secondary antibody labeled with Alexa Fluor 555 (1:1000, Beyotime) at room temperature for 1 hour. Then the cells were incubated with DAPI for 15 minutes for confocal microscopy imaging.

[0165] The results are as Figure 14 shown in A of the figure. Compared with the untreated group, the 5637 cells treated with elesclomol-copper (ES-Cu, as a positive control) and H1H2P@[Cu(tz)] both showed obvious oligomerization bands of DLAT protein. The immunofluorescence results showed that the 5637 cells treated with H1H2P@[Cu(tz)] presented obvious and aggregated green spots (green fluorescence indicates DLAT protein), which were generated by the oligomerization of DLAT, while such bright spots did not appear in other groups ( Figure 14 in B of the figure). These results indicate that the superior anti-cancer efficacy of H1H2P@[Cu(tz)] stems from its synergistic inhibition of glycolysis and GSH levels and provides sufficient copper ions for cuproptosis, thereby sensitizing the cuproptosis effect of cancer cells.

[0166] 5. H1H2P@[Cu(tz)] enhances the cytotoxicity of TNF-α

[0167] Mouse bladder cancer cells MB49, mouse breast cancer cells 4T1 and human bladder cancer cells 5637 in the logarithmic growth phase were seeded into 96-well plates (5×10 3 cells / well), and cultured overnight until the cells adhered. Different concentrations of murine TNF-α (0, 10, 20, 50 ng / mL) and a fixed concentration of the H1H2P@[Cu(tz)] composite nanomaterial (6 μg / mL) were co-incubated with murine MB49 or 4T1 cells for 48 h. Different concentrations of human TNF-α (0, 10, 50, 80 ng / mL) and a fixed concentration of the H1H2P@[Cu(tz)] composite nanomaterial (6 μg / mL) were co-incubated with human 5637 cells for 48 h. The CCK8 method was used to measure the cytotoxicity to explore the effect of the H1H2P@[Cu(tz)] nanomaterial on the cytotoxicity of TNF-α.

[0168] The results are as Figure 15As shown, in mouse cancer cells (MB49 and 4T1 cells) and human cancer cell line 5637, compared with TNF-α alone, co-treatment with H1H2P@[Cu(tz)] and TNF-α could induce a higher level of cell death, indicating that the H1H2P@[Cu(tz)] nanoreactor sensitizes the killing effect induced by TNF-α.

[0169] Example 5 Practical Application Research of Multifunctional Nanopreparations

[0170] 1. Treatment of Nude Mice Model Bearing 5637 Tumors

[0171] Female athymic nude mice (six weeks old) were subcutaneously injected with 1×10 7 5637 cell suspension in the hind legs to establish a nude mice model bearing 5637 tumors. The mice were divided into four groups: (i) PBS, (ii) [Cu(tz)], (iii) H1H2A@[Cu(tz)], and (iv) H1H2P@[Cu(tz). When the tumor volume reached 50 mm 3 , a treatment experiment was conducted. On Day 0, tail vein injection was performed with a concentration of 10 mg kg -1 (dry powder mass ratio to mouse body weight), and the injection frequency was once. Figure 16 Figure A shows the change in tumor volume over time in different treatment groups. The results showed that the inhibition rate of tumor growth by H1H2P@[Cu(tz)] treatment reached 89.2%, while [Cu(tz)] and H1H2A@[Cu(tz)] could not control tumor growth at the same dose, which was consistent with the in vitro cytotoxicity results.

[0172] To evaluate whether the logic-gated nanopreparation successfully induced gene silencing and cuproptosis in vivo, in this example, the expression of GLUT1 and DLAT in mouse tumor tissues was evaluated by immunofluorescence staining according to the method in the above example. The GLUT1 downregulation was the most significant in the H1H2P@[Cu(tz)] group ( Figure 16 Figure B), and obvious DLAT aggregation was observed ( Figure 16 Figure C), indicating that the logic-gated nanopreparation had efficient gene silencing and cuproptosis-inducing functions. It should be noted that this specific downregulation of GLUT1 and cuproptosis activated in the tumor region might be attributed to the excellent tumor-specific recognition and activation function of H1H2P@[Cu(tz)], thus also confirming the biosafety of H1H2P@[Cu(tz)] in cancer treatment. These results indicated that the logic-gated nanopreparation had more prominent therapeutic ability than [Cu(tz)] and H1H2A@[Cu(tz)], which was attributed to the synergistic effect of specific GLUT1 inhibition and enhanced cuproptosis pathway.

[0173] 2. Treatment of Balb / c Mice Model Bearing 4T1 Tumors

[0174] Inject a 1×10 6 4T1 cell suspension into the right axilla of female Balb / c mice (six weeks old) to establish a Balb / c mouse model bearing 4T1 tumors. The mice are divided into six groups: (i) PBS, (ii) aPD-1, (iii) [Cu(tz)], (iv) H1H2A@[Cu(tz)], (v) H1H2P@[Cu(tz)], and (vi) the combination treatment group of (H1H2P@[Cu(tz)] + aPD-1). When the tumor volume reaches 50 mm 3 , a treatment experiment is carried out. The concentration of the nanomaterial is 10 mg / kg -1 , and the concentration of aPD-1 is 200 μg / mouse. Figure 17 In A, it shows the change of tumor volume over time in different treatment groups. The results show that the combination treatment group has the highest tumor suppression efficiency, which is better than the single aPD-1 immunotherapy effect.

[0175] The specific steps of the flow cytometry experiment are as follows: Digest the dissected tumor tissue in an enzyme digestion solution (containing 1 mg / mL -1 type IV collagenase, 20 units / mL -1 DNase I and 0.1 mg / mL -1Hyaluronidase, all purchased from Guangzhou Huayun Biotechnology Co., Ltd.) was digested at 37 °C for 30 minutes. After filtering through a 70 μm filter, the single-cell suspension was mixed with 4 mL of red blood cell lysis buffer, incubated for 5 min, centrifuged, and the cells were resuspended in PBS. First, they were stained with Zombie-NIR Fixable Viability Kit (#423106, biolgend), then stained with anti-mouse CD16 / 32 (#101320, biolgend) to block IgG Fc receptors, and finally stained with surface markers for 30 min. The infiltration of various immune cells in the tumor was detected by flow cytometry (CytoFLEX LX, Beckman Coulter) and analyzed by FlowJo. The flow antibodies used, Anti-CD45-APC, anti-CD3-FITC, anti-CD4-Alexa Fluor 700, anti-CD8a-Brilliant Violet 510, anti-CD11b-Brilliant Violet 421, anti-F4 / 80-Brilliant Violet 605, anti-CD163-PE / Cyanine7, anti-CD11c-PE / Cyanine7, anti-CD86-FITC, anti-CD80-PE, anti-Ly-6G / Ly-6C-BrilliantViolet 605, were all purchased from BioLegend (USA). The maturation marker of DC cells is CD11c + CD80 + CD86 + , the infiltration marker of T cells is CD3 + CD4 + and CD3 + CD8 + , the marker of M2 polarization is CD11b + F4 / 80 + CD163 + , the marker of M1 polarization is CD11b + F4 / 80 + CD80 + , the marker of myeloid-derived suppressor cells MDSCs is CD45 + CD11b + Gr-1 + .

[0176] Flow cytometry analysis showed that mature dendritic cells DCs (CD11c + CD80 + CD86 +) reached 34.6%, 2.6 times higher than that of the PBS group, indicating that H1H2P@[Cu(tz)] may increase the release of more tumor-associated antigens (TAAs) and damage-associated molecular patterns (DAMPs) due to the increased copper death-mediated cell death, thus effectively promoting DC maturation ( Figure 17 in B). Since DC maturation can promote the activation of T cells at the tumor site by presenting antigens to T cells, this example further analyzed CD3 + CD8 + T cell infiltration in tumors. The results showed that after H1H2P@[Cu(tz)] and combination therapy, the infiltration of CD3 + CD8 + T cells increased to 3.6% and 5.8% respectively, while that of the PBS group was 2.3% ( Figure 17 in C). It indicates that the H1H2P@[Cu(tz)] nanoplatform has the ability to promote the infiltration of cytotoxic T lymphocytes (CTLs).

[0177] In addition to the ability to promote CTL infiltration, since H1H2P@[Cu(tz)] has the ability to inhibit glycolysis through tumor-specific GLUT1 inhibition, it is expected to have the function of remodeling the immunosuppressive TME. Since lactate contributes to the polarization of tumor-associated macrophages (TAMs) to the M2 type, which is crucial for tumor growth, H1H2P@[Cu(tz)] can induce the polarization of M2 macrophages to M1 macrophages by inhibiting lactate levels.

[0178] The results are as shown in Figure 17 in D. Compared with the PBS group, the ratio of M1 to M2 in the H1H2P@[Cu(tz)] group was 10.2, 4 times that of the PBS group, indicating that H1H2P@[Cu(tz)] stimulates the transformation of TAMs from the immunosuppressive M2 phenotype to the immunostimulatory M1 phenotype. At the same time, compared with the PBS group, the treatment with H1H2P@[Cu(tz)] also reduced the infiltration of myeloid-derived suppressor cells (MDSCs, CD45 + CD11b + Gr-1 + ) in tumor tissues ( Figure 17 in E). These results verify that H1H2P@[Cu(tz)] can effectively reprogram the immunosuppressive TME, thus efficiently promoting copper death-mediated anti-tumor immune responses. Therefore, the combination of H1H2P@[Cu(tz)] and aPD-1 showed the most obvious inhibitory effect and immune cell infiltration in 4T1 tumors, synergistically enhancing the anti-tumor effect.

Claims

1. A tumor-targeting probe set, characterized in that: The probe group includes a probe targeting a tumor endogenous nucleic acid marker and a probe targeting a DNA repair enzyme; the probe targeting a tumor endogenous nucleic acid marker includes, from 5' to 3', an A sequence and a B sequence; The B sequence is complementary to the tumor endogenous nucleic acid marker; The A sequence is complementary to the 5' end of the B sequence; The probe targeting the DNA repair enzyme targets the ASO sequence of GLUT1, and the ASO sequence includes TGACGATACCGGAGCCAATG (SEQ ID NO: 1) The probe targeting the DNA repair enzyme includes, from 5' to 3', a C sequence, a D sequence, an E sequence, an F sequence and a G sequence; The C sequence is a partial sequence of ASO, which is TGACGATACCGG (SEQ ID NO: 2); The D sequence is completely complementary to the A sequence; The E sequence is completely complementary to the B sequence; A deoxynucleotide is connected between the D sequence and the E sequence; The F sequence is the remaining sequence of ASO, which is AGCCAATG; The G sequence is complementary to the 5' end of the D sequence, and preferably, the G sequence is complementary to the 1st to 6th bases of the 5' end of the D sequence; A repair enzyme action site is connected between the F sequence and the G sequence; The D sequence is complementary to the 3' end of the E sequence, the F sequence and the G sequence.

2. The probe set according to claim 1, characterized in that: The probe targeting the tumor endogenous nucleic acid marker is modified with a first fluorescent group; and / or The probe targeting the DNA repair enzyme is modified with a second fluorescent group.

3. Use of the probe group according to claim 1 or 2 in preparing a product for detecting tumors.

4. A kit for detecting tumors, characterized in that: The kit comprises the probe set according to claim 2.

5. A nano preparation, characterized in that: The nanoformulation comprises the probe group according to claim 1 or 2, and a cuprous triazole coordination polymer.

6. The method for preparing the nanoformulation according to claim 5, characterized in that: A cuprous aqueous solution, 1,2,4-triazole, and the probe group according to claim 1 or 2 are mixed and reacted to obtain the product.

7. Use of the probe set according to claim 1 or 2, or the nanoformulation according to claim 5 in 1) to 5): 1) Preparation of products for treating tumors; 2) Preparation of anti-tumor synergistic products; 3) Preparation of anti-tumor drug resistance reversal products; 4) preparing products for inhibiting glycolysis; 5) Preparation of copper death promoter.

8. The use according to claim 7, characterized in that: The products also include other anti-tumor drugs.

9. An anti-tumor drug set, characterized in that: It includes the nano preparation according to claim 4 and other anti-tumor drugs. The other anti-tumor drugs include: at least one of immune checkpoint inhibitors, tumor antibodies, cancer vaccines, cell therapy and small molecule drugs.

10. Use of the probe set according to claim 1 or 2, or the nanoformulation according to claim 5 in in vitro cell identification, wherein the in vitro identification is used for non-disease diagnosis and treatment purposes.

Images