Application of marker detection reagent in preparation of ovarian cancer diagnosis product or prognosis evaluation product

Abstract

The invention belongs to the field of disease detection reagents, and particularly relates to application of a reagent for detecting a marker in preparation of an ovarian cancer diagnosis product or a prognosis evaluation product, the marker is piRNA as shown in SEQ ID NO: 1, an ovarian cancer diagnosis model established on the basis of the piRNA has an ROC curve lower area of 0.902, sensitivity of 0.844, specificity of 0.767 and accuracy of 0.804, and the marker is piRNA as shown in SEQ ID NO: 2. Ovarian malignant tumor patients, benign tumors and healthy individuals can be effectively distinguished, and the ovarian malignant tumor marker is remarkably superior to existing clinical common tumor markers CA-125, CEA, CA19-9, HE4, ROMA and the like. Meanwhile, the early diagnosis efficiency of the marker for ovarian tumor patients is remarkable (the area under the ROC curve is 0.854), and is superior to that of the existing clinical common tumor marker CA-125 (the area under the ROC curve is 0.815). And the expression level of the marker in ovarian cancer serum is related to the treatment state, lymph node metastasis state, clinical staging and survival prognosis time of an ovarian cancer patient, so that a reagent for detecting the marker can be used for preparing an ovarian cancer diagnosis product or a prognosis evaluation product.

Description

Technical Field

[0001] The present invention belongs to the field of disease detection reagents, and particularly relates to the application of a reagent for detecting a biomarker in the preparation of an ovarian cancer diagnosis product or a prognosis evaluation product. Background Art

[0002] The existing clinical diagnosis and treatment methods for ovarian cancer have significant deficiencies in the sensitivity of early screening and the timeliness of prognosis monitoring. It is urgent to analyze the molecular regulation mechanism of the occurrence and development of ovarian cancer and develop new biomarkers to achieve early diagnosis and accurate prognosis evaluation.

[0003] In recent years, studies have shown that PIWI-interacting RNAs (piRNAs), as a class of small non-coding RNAs of 24 - 31 nt, more and more studies have reported the clinical applications of piRNAs as biomarkers for cancer diagnosis and prognosis prediction. Research has shown that piRNAs show significant abnormal expression and regulatory effects in various gynecological tumors such as breast cancer and cervical cancer (for example, piR-36712 inhibits the progression of breast cancer through the SEPW1P / microRNA competition mechanism, and piR-14633 promotes the metastasis of cervical cancer through m6A modification regulation). However, the overall expression profile of piRNAs in ovarian cancer has not been systematically analyzed. Existing studies have only reported the regulatory effects of individual piRNAs such as piR-52207 and piR-33733 on the malignant phenotypes of cancer cells, and the biological mechanisms underlying their functions are still unclear.

[0004] As a kind of small non-coding RNA, the expression of piRNA in the human circulatory system is relatively stable and can be detected in plasma, serum or gastric juice. Therefore, as a non-invasive biomarker, piRNA has great potential in the early screening, differential diagnosis and prognosis prediction of cancer, and existing studies have confirmed its diagnostic value in the sera of tumors such as breast cancer and gastric cancer. However, there is currently a lack of exploration of the expression characteristics and clinical value of piRNA in the circulatory system (such as serum) of ovarian cancer patients, resulting in the following technical gaps in this field: ① The feasibility of piRNA as a non-invasive liquid biopsy biomarker for ovarian cancer patients has not been verified; ② A specific piRNA biomarker system for ovarian cancer has not been established; ③ The correlation with clinical characteristics (such as treatment status, tumor stage, metastasis status, survival prognosis, etc.) is completely unknown. Summary of the Invention

[0005] Based on multi - center large - scale cohort samples, the present invention discovers and verifies that piRNA (hereinafter also referred to as piR - hsa - 8111406) has significant statistical differences in serum expression among ovarian cancer patients, patients with ovarian benign lesions, and control group patients. piR - hsa - 8111406 is highly expressed in ovarian cancer, while its serum expression level is extremely low in normal people and patients with ovarian benign lesions. Compared with the serum piR - hsa - 8111406 level in ovarian cancer patients, the difference is significant and well - differentiated. Its diagnostic efficacy is superior to existing markers such as CA - 125, CEA, CA19 - 9, HE4, ROMA, etc., and it has excellent diagnostic efficacy in early - stage ovarian cancer patients. Therefore, piR - hsa - 8111406 can be used as a diagnostic marker for ovarian cancer for early diagnosis. The present invention also discovers that the level of piR - hsa - 8111406 expression in ovarian cancer serum is related to the treatment status, lymph node metastasis status, clinical stage, and survival prognosis time of ovarian cancer patients. The prognosis of ovarian cancer patients in the high - expression group of piR - hsa - 8111406 is poor. Therefore, piR - hsa - 8111406 can be used as a marker for ovarian cancer prognosis evaluation for ovarian cancer prognosis evaluation. In addition, the present invention also discovers that compared with a variety of other pelvic malignancies, piR - hsa - 8111406 has an increased expression level only in ovarian cancer, and the expression level of piR - hsa - 8111406 in ovarian cancer tissue is higher than that in adjacent tissues. Therefore, piR - hsa - 8111406 can be used as a specific marker for ovarian cancer. Finally, the present invention also discovers that the marker piR - hsa - 8111406 has excellent stability and can still show good diagnostic efficacy in serum samples stored for 5 years or more.

[0006] To achieve the above - mentioned objectives, the present invention can adopt the following technical solutions:

[0007] On the one hand, the present invention provides the application of a reagent for detecting a marker in the preparation of an ovarian cancer diagnostic product or a prognosis evaluation product, wherein the marker is piRNA, and the sequence of piRNA is shown as SEQ ID NO: 1 (GCCGCCGGTGAAATACCACTACACAT).

[0008] Preferably, in the above - mentioned application, the reagent for detecting the marker is selected from reagents based on photoelectrochemical detection, reagents based on quantum dot nanosensor detection, reagents based on electrochemiluminescence detection, reagents based on DNAzyme detection, or reagents based on qRT - PCR detection.

[0009] More preferably, in the above - mentioned application, the reagent for detecting the marker is a reagent based on qRT - PCR detection, and the reagent for detecting the marker includes one or more of piRNA primers, probes, buffers, reverse transcriptase, or Taq DNA polymerase.

[0010] Preferably, in the above application, the piRNA is derived from the serum of a subject.

[0011] Preferably, in the above application, the diagnostic product or prognostic evaluation product is a reagent or a kit.

[0012] The present invention has the following beneficial effects:

[0013] (1) The present invention discovers that there are significant statistical differences in the serum expression of piR-hsa-8111406 between ovarian cancer, ovarian benign lesions and healthy control groups. piR-hsa-8111406 is highly expressed in ovarian cancer, while the serum piR-hsa-8111406 expression level is extremely low in normal people and ovarian benign lesions, showing a significant difference and good discrimination compared with the serum piR-hsa-8111406 level of ovarian cancer patients.

[0014] (2) The area under the ROC curve (AUC) of the ovarian cancer diagnostic model established based on serum piRNA in the present invention is 0.902, the sensitivity is 0.844, the specificity is 0.767, and the accuracy is 0.804. Moreover, its diagnostic efficacy, sensitivity, and negative predictive value are all superior to the existing commonly used clinical tumor markers such as CA-125, CEA, CA19-9, HE4, ROMA, etc. Therefore, piR-hsa-8111406 can be used as a diagnostic marker for ovarian cancer for the diagnosis of ovarian cancer.

[0015] (3) The present invention discovers that there are significant statistical differences in the serum expression of piR-hsa-8111406 between early-stage ovarian cancer, ovarian benign lesions and control group patients. piR-hsa-8111406 is highly expressed in early-stage ovarian cancer, while the serum piR-hsa-8111406 expression level is extremely low in normal people and ovarian benign lesions, showing a significant difference and good discrimination compared with the serum piR-hsa-8111406 level of ovarian cancer patients. The AUC value of the early ovarian cancer diagnostic model established based on serum piRNA in the present invention is 0.854, which is superior to the commonly used clinical tumor marker CA-125 (AUC value is 0.815), and can effectively distinguish early-stage ovarian malignant tumor patients from ovarian benign lesions and healthy controls. Therefore, piR-hsa-8111406 can be used as a diagnostic marker for ovarian cancer for the early diagnosis of ovarian cancer.

[0016] (4) The present invention also found that the high or low expression level of piR-hsa-8111406 in ovarian cancer serum is related to the treatment status, lymph node metastasis status, clinical stage and survival prognosis of ovarian cancer patients. The prognosis of ovarian cancer patients in the high-expression group of piR-hsa-8111406 is poor. Therefore, piR-hsa-8111406 can be used as a marker for evaluating the prognosis of ovarian cancer for prognostic evaluation of ovarian cancer.

[0017] (5) The present invention also found that piR-hsa-8111406 is specifically highly expressed in ovarian cancer serum, but lowly expressed in the sera of many other pelvic malignant tumors. Therefore, piR-hsa-8111406 can be used as an organ-specific ovarian cancer serum marker for the diagnosis, monitoring and prognostic evaluation of ovarian cancer.

[0018] (6) The present invention also found that piR-hsa-8111406 can still exhibit good diagnostic efficacy in serum samples stored for more than 5 years. Therefore, piR-hsa-8111406 can be used as a stable marker for ovarian cancer for the diagnosis, monitoring and prognostic evaluation of ovarian cancer.

[0019] (7) The present invention also found that piR-hsa-8111406 is specifically highly expressed in ovarian cancer tissues, but lowly expressed in adjacent tissues. Therefore, piR-hsa-8111406 can be used as an organ-specific ovarian cancer marker.

[0020] (8) The present invention also found that piR-hsa-8111406 is expressed higher in the multi-center independent external validation cohort (Henan Cancer Hospital and Shanxi Cancer Hospital) compared with the control group. Therefore, the diagnostic efficacy of piR-hsa-8111406 for ovarian cancer is robust and reliable. Description of the Drawings

[0021] Figure 1 is the clinical screening cohort, training cohort, internal validation cohort, and multi-center independent external validation cohort for the ovarian cancer serum marker piR-hsa-8111406;

[0022] Figure 2 is the change multiple of piR-hsa-8111406 in ovarian cancer serum and other elevated piRNAs;

[0023] Figure 3 is the comparison of the ROC curves of the expression levels of piR-hsa-8111406 in ovarian cancer serum with the existing ovarian cancer serum tumor markers CA-125, CA19-9, CEA, HE4, PRE-ROMA, POST-ROMA;

[0024] Figure 4ROC curve comparison of serum piR-hsa-8111406 and tumor marker CA-125 expression levels in early ovarian cancer;

[0025] Figure 5 Serum piR-hsa-8111406 expression level is highly expressed in patients with lymph node metastasis in ovarian cancer;

[0026] Figure 6 Serum piR-hsa-8111406 expression in ovarian cancer is related to disease progression;

[0027] Figure 7 Serum piR-hsa-8111406 expression level significantly decreases after surgery in patients with ovarian cancer;

[0028] Figure 8 Serum piR-hsa-8111406 expression level significantly decreases during long-term follow-up after surgery in ovarian cancer;

[0029] Figure 9 Serum piR-hsa-8111406 expression level affects the survival prognosis of patients with ovarian cancer;

[0030] Figure 10 Serum piR-hsa-8111406 specificity is highly expressed in ovarian cancer among various pelvic malignancies;

[0031] Figure 11 Serum piR-hsa-8111406 expression level is verified in the internal validation cohort for ovarian cancer;

[0032] Figure 12 Serum piR-hsa-8111406 expression level is verified in the multi-center independent external validation cohort for ovarian cancer;

[0033] Figure 13 piR-hsa-8111406 in ovarian cancer is highly expressed specifically in cancer tissues. Detailed implementation manners

[0034] The examples given are for better illustration of the present invention, but the content of the present invention is not limited only to the examples given. Therefore, those skilled in the art who make non-essential improvements and adjustments to the implementation manners based on the above invention content still fall within the protection scope of the present invention.

[0035] The terms used in this document are only for describing specific embodiments and are not intended to limit the present disclosure. Unless otherwise clearly different in context, singular expressions include plural expressions. As used herein, it should be understood that terms such as "including", "having", "containing" are intended to indicate the existence of features, numbers, operations, components, parts, elements, materials or combinations. Terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations may exist or can be added. As used herein, depending on the circumstances, " / " can be interpreted as "and" or "or".

[0036] To better understand the present invention, the content of the present invention will be further clarified below with specific examples, but the content of the present invention is not limited to the following examples.

[0037] I. Biomarker screening

[0038] Download the original data of serum small RNA sequencing of ovarian cancer, ovarian benign lesions and control group patients from the Gene Expression Omnibus (GEO) database. Based on the piRNA database, re-align the sequencing data to obtain the piRNA expression profile. Through the screening cohort, perform differential analysis and fold change analysis on the expression profile to screen potential biomarkers, and select piRNAs with significantly increased expression levels in ovarian cancer, as Figure 1 (left) shown, specifically as follows:

[0039] (1) Download the sequencing piRNA of serum of ovarian cancer and control group patients from the Gene Expression Omnibus (GEO) database. Use the FASTX-Toolkit software package to perform quality review on the original data. Subsequently, align the cleaned sequences to the piRBase database (http: / / bigdata.ibp.ac.cn / piRBase), and use BWA and BLASTN software for sequence alignment. Use a custom script to calculate the expression level of piRNA after alignment for downstream differential analysis;

[0040] (2) Screen piRNAs for 179 ovarian cancer patients and 100 healthy controls. The piRNAs should be detected in more than half of the patients, and set the threshold of Transcripts Per Million (TPM) to 10. A total of 1798 piRNAs are screened for subsequent analysis;

[0041] (4) Screening of 1798 piRNAs with significantly increased expression levels in ovarian cancer by GEO data analysis. According to the statistical difference in the fold change (FC) between the ovarian cancer group and the non-ovarian cancer group (p < 0.05 and FDR < 0.05), and the fold change in expression increased by more than 1.2 times. Sorting by the FC value from large to small, the top 30 piRNAs are as follows Figure 2 As shown, the results show that piR-hsa-8111406 (the sequence is shown in SEQ ID NO: 1) has the most significant difference in expression changes between ovarian cancer and healthy control sera.

[0042] II. Verification of markers

[0043] A total of 1137 sera were retrospectively collected from the Cancer Hospital of the Chinese Academy of Medical Sciences, Henan Cancer Hospital, and Shanxi Cancer Hospital. Malignant ovarian cancer patients (including stage I / II invasive serous adenocarcinoma, stage III / IV invasive serous adenocarcinoma, stage I / II invasive clear cell or endometrioid adenocarcinoma, or stage III / IV invasive clear cell or endometrioid adenocarcinoma, stage I / II invasive mucinous adenocarcinoma, stage III / IV invasive mucinous adenocarcinoma) and benign tumor patients (including serous cystadenoma, mucinous cystadenoma, endometriosis cyst, ovarian fibroma) and healthy controls were included according to the gold standard of intraoperative pathological results. Among them, 467 fresh preoperative sera collected from the Cancer Hospital of the Chinese Academy of Medical Sciences in 2024 were used as the training set, 235 sera samples collected from 2018 to 2019 and stored in a -80 °C refrigerator for 5 years or more were used as the internal validation set, and 191 sera of other pelvic malignancies (including fallopian tube cancer, vaginal cancer, endometrial cancer, cervical cancer). In addition, 244 preoperative sera collected from Henan Cancer Hospital and Shanxi Cancer Hospital in 2024 were used as an independent external multi-center validation cohort. All subjects gave informed consent and strictly followed medical ethical norms. The cohort information is as Figure 1 (middle, right) shown.

[0044] Extract 250 uL of total serum RNA. After adding 750 uL of lysis reagent (Thermo Fisher TRIzol LS reagent, 10296028CN) and chloroform extraction and centrifugation, total serum RNA was obtained by precipitation and washing. The concentration was measured and 1 ug of RNA was reverse transcribed by the poly(A) tailing method (Sangon miRNAFirst Strand cDNA Synthesis kit, B532451-0050) into cDNA, and the piRNA expression was detected using an RT-PCR detection kit (Vazyme Taq Pro Universal SYBR qPCR Master Mix, Q712-02) (the detection method refers to the kit instructions). The results are as follows:

[0045] (1) Comparison of the ovarian cancer serum marker piR-hsa-8111406 with existing ovarian cancer serum tumor markers

[0046] First, the comparison of the ROC curves of the expression levels of ovarian cancer serum piR-hsa-8111406 with the existing ovarian cancer serum tumor markers CA-125, CA19-9, CEA, HE4, PRE-ROMA, and POST-ROMA is as follows Figure 3 as shown. The specific diagnostic efficacy parameters are shown in Table 1 below

[0047] Table 1 Diagnostic efficacy parameters

[0048]

[0049]

[0050] Second, the comparison of the ROC curves of the expression levels of early ovarian cancer serum piR-hsa-8111406 and the tumor marker CA-125 is as follows Figure 4 as shown

[0051] (2) High expression of the ovarian cancer serum piR-hsa-8111406 expression level in patients with lymph node metastasis

[0052] The expression of the ovarian cancer serum piR-hsa-8111406 expression level in patients with lymph node metastasis is as follows Figure 5 as shown, and the results show that the ovarian cancer serum piR-hsa-8111406 expression level is highly expressed in patients with lymph node metastasis

[0053] (3) High expression of the ovarian cancer serum piR-hsa-8111406 expression level in patients with lymph node metastasis

[0054] The expression of the ovarian cancer serum piR-hsa-8111406 and the disease progression is as follows Figure 6 as shown, and the results show that the ovarian cancer serum piR-hsa-8111406 has a higher expression level in advanced patients (clinical staging according to the FIGO gynecological cancer guidelines of the International Federation of Gynecology and Obstetrics) compared with early patients

[0055] (4) The expression level of the ovarian cancer serum piR-hsa-8111406 decreases significantly after surgery

[0056] The expression level of the ovarian cancer serum piR-hsa-8111406 decreases significantly after surgery, and the results are as follows Figure 7 .

[0057] (5) The expression level of serum piR-hsa-8111406 in ovarian cancer decreased significantly during long-term postoperative follow-up

[0058] After the operation, during long-term follow-up review, it was found that the expression level of serum piR-hsa-8111406 in ovarian cancer decreased significantly (see Figure 8 ).

[0059] (6) The expression level of serum piR-hsa-8111406 in ovarian cancer affects the survival prognosis of ovarian cancer patients

[0060] The expression level of serum piR-hsa-8111406 in ovarian cancer affects the survival prognosis of ovarian cancer patients. The results are shown in Figure 9 .

[0061] (7) Serum piR-hsa-8111406 is highly specifically expressed in ovarian cancer among multiple pelvic malignancies

[0062] Among multiple pelvic malignancies such as fallopian tube cancer, cervical cancer, vaginal cancer, endometrial cancer, and ovarian cancer, serum piR-hsa-8111406 is highly specifically expressed only in ovarian cancer. The results are shown in Figure 10 .

[0063] (8) Verification of the expression level of serum piR-hsa-8111406 in ovarian cancer in the internal validation cohort

[0064] The expression level of serum piR-hsa-8111406 in ovarian cancer was higher in the ovarian cancer serum compared to the control group in the internal validation cohort (serum samples frozen at -80 °C for more than 5 years). The results showed that piR-hsa-8111406 had excellent stability and could still exhibit good diagnostic efficacy in serum samples stored for 5 years or more. The results are shown in Figure 11 .

[0065] (9) Verification of the expression level of serum piR-hsa-8111406 in ovarian cancer in the multi-center independent external validation cohort

[0066] The expression level of serum piR-hsa-8111406 in ovarian cancer was higher in the multi-center independent external validation cohort (Henan Cancer Hospital and Shanxi Cancer Hospital) compared to the control group. The results showed that the diagnostic efficacy of piR-hsa-8111406 for ovarian cancer was robust and reliable. The results are shown in Figure 12 .

[0067] (10) piR-hsa-8111406 in ovarian cancer is highly specifically expressed in cancer tissues

[0068] In the cancer tissue samples obtained by surgical resection from ovarian cancer patients, piR-hsa-8111406 was specifically highly expressed compared with adjacent tissues. The results are shown in Figure 13 .

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.

Claims

1. Use of a reagent for detecting a marker in the preparation of an ovarian cancer diagnosis product or a prognosis evaluation product, wherein the marker is piRNA, and the sequence of pi RNA is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The reagent for detecting the marker is selected from a reagent based on photoelectrochemical detection, a reagent based on quantum dot nanosensor detection, a reagent based on electrochemiluminescence detection, a reagent based on DNAzyme detection or a reagent based on qRT-PCR detection.

3. The use according to claim 2, characterized in that: The reagent for detecting the marker is a reagent based on qRT-PCR detection, and the reagent for detecting the marker includes one or more of piRNA primers, probes, buffer, reverse transcriptase or Taq DNA polymerase.

4. The use according to any one of claims 1 to 3, characterized in that: piRNAs are derived from serum or peripheral blood of subjects.

5. The use according to any one of claims 1 to 3, characterized in that: The diagnostic product or prognostic evaluation product is a reagent or a kit.

6. The use according to claim 4, characterized in that: The diagnostic product or prognostic evaluation product is a reagent or a kit.

Images