Compositions and methods for inhibiting expression of Patatin-like phospholipase domain-containing protein 3 (PNPLA3)
By using specific dsRNA reagents to inhibit the expression of the PNPLA3 gene, the problem of difficulty in reducing the expression of the PNPLA3 gene in the liver in the prior art is solved, and effective treatment of diseases such as NAFLD is achieved.
Patent Information
- Application Number
- CN202380080495.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-12-07
- Filing Date
- 2023-12-06
- Publication Date
- 2025-07-01
AI Technical Summary
The prior art is difficult to effectively reduce the expression of Patatin-like phospholipase domain protein 3 (PNPLA3) gene in the liver, resulting in liver fat accumulation and related metabolic problems.
The expression of the PNPLA3 gene is specifically inhibited by the complementary action of the sense strand and the antisense strand using double-stranded ribonucleic acid (dsRNA) reagent. The dsRNA agent includes specific nucleotide sequences that are completely or substantially complementary to PNPLA3 mRNA and induce RNA interference mechanisms in cells, reducing the expression of PNPLA3 protein.
By inhibiting the expression of the PNPLA3 gene and reducing the accumulation of triglycerides in the liver, it is effective in treating non-alcoholic steatohepatitis (NAFLD) and related liver diseases.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure QLYQS_3
Abstract
Description
Technical Field
[0001] The present invention relates in part to compositions and methods useful for inhibiting the expression of the Patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene. Background of the Invention
[0002] Patatin-like phospholipase domain-containing protein 3 (PNPLA3) is a type II transmembrane protein that is expressed in a variety of cells including the liver. In hepatocytes, PNPLA3 is expressed on the endoplasmic reticulum and lipid membranes and predominantly exhibits triacylglycerol hydrolase activity.
[0003] Accumulation of excessive triglycerides in the liver is referred to as hepatic steatosis (or fatty liver) and is associated with adverse metabolic consequences including insulin resistance and dyslipidemia. NAFLD refers to a spectrum of liver diseases that can progress from simple steatosis (fatty change) to non-alcoholic steatohepatitis (NASH) and then to cirrhosis (irreversible end-stage liver scarring). All stages of NAFLD share a common feature: fat accumulation (fat infiltration) in hepatocytes (liver cells).
[0004] Numerous studies have identified a significant association between hepatic fat content and the Patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene (see, e.g., Romeo et al. (2008) Nat. Genet., 40(12):1461-1465). Studies in knock-in mice have shown that expression of the sequence polymorphism (rs738409, I148M) in PNPLA3 results in NAFLD, and that the accumulation of catalytically inactive PNPLA3 on the surface of lipid droplets is associated with the accumulation of triglycerides in the liver (Smagris et al. (2015) Hepatology, 61:108-118). Specifically, the PNPLA3 I148M variant promotes the development of fibrogenesis by activating the hedgehog (Hh) signaling pathway, leading to the activation and proliferation of hepatic stellate cells and the excessive production and deposition of extracellular matrix (Chen et al. (2015) World J. Gastroenterol., 21(3):794-802).
[0005] Currently, there is a need for treatment of patients with NAFLD. The present invention provides a novel method for reducing PNPLA3 levels and treating liver diseases such as NAFLD. Summary of the Invention
[0006] According to one aspect of the present invention, there is provided a double-stranded ribonucleic acid (dsRNA) reagent for inhibiting the expression of patatin-like phospholipase domain-containing protein 3 (PNPLA3), wherein the dsRNA reagent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:2 by no more than 3 nucleotides. In some embodiments, the dsRNA reagent comprises a sense strand and an antisense strand, and comprises a region complementary to the PNPLA3 RNA transcript at nucleotide positions 2 to 18 in the antisense strand, wherein the complementary region comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in Tables 1-3, and optionally comprises a targeting ligand. In some embodiments, the region complementary to the PNPLA3 RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In certain embodiments, the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO:1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA is fully complementary to any target region of SEQ ID NO:1 and is provided in any one of Tables 1-3. In some embodiments, the dsRNA reagent comprises a sense strand sequence listed in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA reagent. In certain embodiments, the dsRNA reagent comprises a sense strand sequence listed in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA reagent. In some embodiments, the dsRNA reagent comprises an antisense strand sequence listed in any one of Tables 1-3. In some embodiments, the dsRNA reagent comprises a sequence listed as a duplex sequence in any one of Tables 1-3. In some embodiments, the dsRNA reagent comprises at least one modified nucleotide. In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides. In certain embodiments, all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides.In some embodiments, at least one modified nucleotide comprises: 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2'3'-seco nucleotide mimetic, locked nucleic acid nucleotide, unlocked nucleic acid nucleotide (UNA), glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2'-OMe nucleotide, inverted 2'-deoxy nucleotide, mannosyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide and 3'-OMe nucleotide, nucleotide comprising a 5'-thiophosphate group, 5'-phosphonate-modified nucleotide, nucleotide comprising a vinyl phosphonate, or a terminal nucleotide linked to a cholesteryl derivative or a didodecylamide group, 2'-amino-modified nucleotide, aminophosphate, or nucleotide comprising a non-natural base. In some embodiments, the dsRNA reagent comprises an E-vinyl phosphonate nucleotide at the 5'-end of the guide strand. In certain embodiments, the dsRNA reagent comprises at least one phosphorothioate internucleoside linkage. In certain embodiments, the sense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages. In certain embodiments, all or substantially all nucleotides of the sense strand and the antisense strand are modified nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, wherein fewer than 6 modified nucleotides are 2'-fluoro nucleotides. In certain embodiments, the antisense strand comprises 3 or 5 2'-fluoro nucleotides, preferably, the antisense strand comprises 5 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises 5 2'-fluoro nucleotides and 1 5'-phosphonate-modified nucleotide, preferably, wherein the 5'-phosphonate-modified nucleotide is a nucleotide comprising a vinyl phosphonate. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, wherein fewer than 4 modified nucleotides are 2'-fluoro nucleotides. In certain embodiments, the sense strand comprises 3 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, wherein at least 16 modified nucleotides are 2'-O-methyl nucleotides and the nucleotides at positions 2, 5, 7, 12, 14, 16 and / or 18 from the 5'-end of the antisense strand are 2'-fluoro nucleotides.In certain embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 starting from the 5'-end of the antisense strand are 2'-fluoro nucleotides. In certain embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 starting from the 5'-end of the antisense strand are 2'-fluoro nucleotides. In some embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 starting from the 5'-end of the antisense strand are 2'-fluoro nucleotides, and the 5'-terminal nucleotide of the antisense strand is a nucleotide containing vinyl phosphonate, preferably, wherein the nucleotide containing vinyl phosphonate is VPu* as defined in the present invention. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, wherein at least 18 modified nucleotides are 2'-O-methyl nucleotides and the nucleotides at positions 9, 11, 13, and / or 14 starting from the 5'-end of the sense strand are 2'-fluoro nucleotides. In certain embodiments, the nucleotides at positions 9, 11, and 13 starting from the first paired position at the 3'-end of the sense strand are 2'-fluoro nucleotides. In certain embodiments, the nucleotides at positions 8, 11, and 13 starting from the first paired position at the 3'-end of the sense strand are 2'-fluoro nucleotides.
[0007] In some embodiments, the sense strand sequence can be represented by formula (I): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ N8 N′ L N′ L (N′ L ) m′ -3′(I)
[0008] Wherein:
[0009] Each N′ F represents a 2'-fluoro modified nucleotide, N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 ,N′ N6 ,N′ N7 and N′ N8 each independently represents a modified or unmodified nucleotide; each N′L Independently represent a modified or unmodified nucleotide, but do not represent a 2'-fluoro-modified nucleotide, and m' and n' are each independently an integer from 0 to 7.
[0010] In some embodiments, the antisense strand sequence can be represented by formula (II): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′(II)
[0011] Wherein:
[0012] Each N F represents a 2'-fluoro-modified nucleotide; N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 and N M8 each independently represent a modified or unmodified nucleotide, preferably, N M1 ,N M2 ,N M3 ,N M6 and N M7 each independently represent a 2'-fluoro-modified nucleotide; each N L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide, and n is an integer from 0 to 7.
[0013] In certain embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.
[0014] In certain embodiments, n is 1, or n is 2, or n is 3.
[0015] In certain embodiments, the modified nucleotide is the modified nucleotide as defined above.
[0016] In certain embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.
[0017] In certain embodiments, N M6 ,N M3 and N M2 each independently represents a 2'-fluoro modified nucleotide, optionally, N M6 ,N M3 and N M2 are all 2'-fluoro modified nucleotides.
[0018] In certain embodiments, N M7 ,N M3 and N M1 each independently represents a 2'-fluoro modified nucleotide, optionally, N M7 ,N M3 and N M1 are all 2'-fluoro modified nucleotides.
[0019] In some embodiments, the antisense strand sequence can be represented by formula (II’): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′(II’)
[0020] wherein,
[0021] each N F represents a 2'-fluoro modified nucleotide, each N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 and N M8Each independently represents a modified or unmodified nucleotide, preferably, each N M1 ,N M2 ,N M3 ,N M6 and N M7 independently represents a 2'-fluoro modified nucleotide, and each N L independently represents a modified or unmodified nucleotide but not a 2'-fluoro modified nucleotide; N Z represents a nucleotide containing a phosphonate mimic, preferably, N Z represents a nucleotide containing vinyl phosphonate; and n is an integer from 0 to 7.
[0022] In certain embodiments, n is 1, or n is 2, or n is 3.
[0023] In certain embodiments, the modified nucleotide is the modified nucleotide as defined above.
[0024] In certain embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.
[0025] In certain embodiments, each N M6 ,N M3 and N M2 independently represents a 2'-fluoro modified nucleotide, preferably, MN M6 ,N M3 and N M2 are all 2'-fluoro modified nucleotides.
[0026] In certain embodiments, each N M7 ,N M3 and N M1 independently represents a 2'-fluoro modified nucleotide, preferably,
[0027] N M7 ,N M3 and N M1 are all 2'-fluoro modified nucleotides.
[0028] In certain embodiments, N Z is a vinyl phosphonate modified nucleotide.
[0029] In certain embodiments,,N Z is VPu*, and its structure is: In some embodiments, the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to the mRNA encoding PNPLA3, wherein the complementary region contains at least 15 consecutive nucleotides, and the dsRNA duplex is represented by formula (III):
[0030] Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ N8 N′ L N′ L (N′ L ) m′ -3′ Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′
[0031] (III)
[0032] Wherein:
[0033] Each N F and N′ F independently represents a 2'-fluoro-modified nucleotide, N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 ,N M8 ,N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 ,N′ N6 ,N′N7 and N' N8 each independently represents a modified or unmodified nucleotide; each N L and N' L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide, and m', n' and n are each independently an integer from 0 to 7.
[0034] In certain embodiments, n' is 1 and m' is 1, or n' is 1 and m' is 2, or n' is 1 and m' is 3, or n' is 1 and m' is 4, or n' is 1 and m' is 5, or n' is 3 and m' is 1, or n' is 3 and m' is 2, or n' is 3 and m' is 3, or n' is 5 and m' is 1.
[0035] In certain embodiments, n is 1, or n is 2, or n is 3.
[0036] In certain embodiments, M6, M3 and M2 each independently represent a 2'-fluoro-modified nucleotide, optionally,
[0037] M6, M3 and M2 are all 2'-fluoro-modified nucleotides.
[0038] In certain embodiments, M7, M3 and M1 each independently represent a 2'-fluoro-modified nucleotide, optionally,
[0039] M7, M3 and M1 are all 2'-fluoro-modified nucleotides.
[0040] In some embodiments, the sense strand and the antisense strand in the dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to the mRNA encoding PNPLA3, wherein the complementary region comprises at least 15 consecutive nucleotides, and the dsRNA duplex is represented by formula (III'):
[0041] Sense strand: 5′-(N' L ) n′ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' N7 N' N8 N' L N' L (N' L )m′ -3′
[0042] Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′
[0043] (III’)
[0044] Wherein:
[0045] Each N F and N′ F independently represents a 2'-fluoro-modified nucleotide; each N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 , N′ N7 and N′ N8 independently represents a modified or unmodified nucleotide; each N L and N′ L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide; N Z represents a nucleotide containing a phosphonate mimic or a nucleotide containing a vinyl phosphonate; and each m′, n′ and n independently is an integer from 0 to 7.
[0046] In certain embodiments, n′ is 1 and m′ is 1, or n′ is 1 and m′ is 2, or n′ is 1 and m′ is 3, or n′ is 1 and m′ is 4, or n′ is 1 and m′ is 5, or n′ is 3 and m′ is 1, or n′ is 3 and m′ is 2, or n′ is 3 and m′ is 3, or n′ is 5 and m′ is 1.
[0047] In certain embodiments, n is 1, or n is 2, or n is 3.
[0048] In certain embodiments, each N M6 , N M3 and N M2 independently represents a 2′-fluoro-modified nucleotide, and preferably, N M6 , N M3 and N M2 are all 2′-fluoro-modified nucleotides.
[0049] In certain embodiments, each N M7 , N M3 and N M1 independently represents a 2′-fluoro-modified nucleotide, and preferably, N M7 , N M3 and N M1 are all 2′-fluoro-modified nucleotides.
[0050] In certain embodiments, N Z is a vinyl phosphate-modified nucleotide.
[0051] In certain embodiments, N Z is VPu*, and its structure is: In certain embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides. In some embodiments, the length of the complementary region is 19 - 21 nucleotides. In certain embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of each strand does not exceed 40 nucleotides. In some embodiments, the length of each strand does not exceed 30 nucleotides. In some embodiments, the length of each strand does not exceed 25 nucleotides. In some embodiments, the length of each strand does not exceed 23 nucleotides. In some embodiments, the length of each strand does not exceed 21 nucleotides. In certain embodiments, the dsRNA reagent includes at least one modified nucleotide and further includes one or more targeting groups or linking groups. In some embodiments, one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc).
[0052] In some embodiments, the targeting group has the structure of formula (X):
[0053]
[0054] Each "n" is independently selected from 1 or 2.
[0055] In some embodiments, the targeting group has the following structure:
[0056]
[0057]
[0058]
[0059]
[0060] In certain embodiments, the dsRNA reagent comprises a targeting group conjugated to the 5'-end of the sense strand. In some embodiments, the dsRNA reagent comprises a targeting group conjugated to the 3'-end of the sense strand. In some embodiments, the antisense strand comprises a reverse abasic residue at the 3'-end. In certain embodiments, the sense strand comprises one or two reverse abasic residues at the 3' and / or 5'-ends. In certain embodiments, the 3’ and / or 5’ ends of the sense strand comprise one or two imann residues. In certain embodiments, each end of the sense strand comprises 1 reverse abasic residue, respectively. In certain embodiments, each end of the sense strand comprises 1 imann residue, respectively. In some embodiments, the dsRNA reagent has two blunt ends. In some embodiments, at least one strand comprises a 3'-overhang of at least 1 nucleotide. In some embodiments, at least one strand comprises a 3'-overhang of at least 2 nucleotides. In certain embodiments, at least one internucleotide bond of the sense strand and / or the antisense strand is a phosphodiester internucleotide bond. In certain embodiments, at least one internucleotide bond of the sense strand and / or the antisense strand is a modified internucleotide bond. In certain embodiments, at least one internucleotide bond of the sense strand and / or the antisense strand is a phosphorothioate internucleotide bond. In certain embodiments, at least one of the 5’-end, 3’-end or both ends of the sense strand and / or the antisense strand has a phosphorothioate internucleotide bond. In certain embodiments, the 5’-end, 3’-end or both ends of the sense strand and / or the antisense strand have 1, 2, 3, 4, 5, or 6 phosphorothioate internucleotide bonds. In certain embodiments, at least two modified or unmodified nucleotides at one or both ends of the antisense strand are linked by a phosphorothioate bond. In some embodiments, the three modified or unmodified nucleotides at one or both ends of the antisense strand are linked by a phosphorothioate bond. In certain embodiments, at least two modified or unmodified nucleotides at one or both ends of the sense strand are linked by a phosphorothioate bond. In certain embodiments, the three modified or unmodified nucleotides at one or both ends of the sense strand are linked by a phosphorothioate bond. In certain embodiments, the three modified or unmodified nucleotides at the 5’-end of the sense strand are linked by a phosphorothioate bond, and the two modified or unmodified nucleotides at the 3’-end of the sense strand are linked by a phosphorothioate bond. In certain embodiments, the sense strand comprises a phosphorothioate internucleotide bond between the targeting group and the reverse abasic residue or imann residue, and a phosphorothioate internucleotide bond between the reverse abasic residue or imann residue and the modified or unmodified nucleotide at the 5’-end of the sense strand. In certain embodiments, the modified sense strand has a modification pattern listed in any one of Tables 2-3. In certain embodiments, the modified antisense strand has a modification pattern listed in any one of Tables 2-3. In certain embodiments, the modified sense strand is the modified sense strand sequence listed in one of Tables 2-3.In certain embodiments, the modified antisense strand is the modified antisense strand sequence listed in one of Tables 2-3. In certain embodiments, the dsRNA comprises a duplex selected from the group consisting of: AD00652, AD00653, AD00654, AD00655, AD00656, AD00657, AD00658, AD00659, AD00660, AD00661, AD00662, AD00663, AD00664, AD00663-1, AD00664-1, AD00815-1, AD00816-1, AD00819-1, AD00444-1, AD00663-2, AD00664-2, AD00815-2, AD00745, AD00746, AD00747, AD00748, AD00749, AD00750, AD00815, AD00816, AD00817, AD00818, AD00819, and AD00820.
[0061] In some embodiments, any of the sense strands in Table 1 can also be modified according to the pattern shown in Formula (I) or (III) above.
[0062] In some embodiments, any of the antisense strands in Table 1 can also be modified according to the pattern shown in Formula (II) or (III) above.
[0063] In some embodiments, any of the duplexes in Table 1 can be further modified according to the pattern shown in Formula (III) above.
[0064] According to one aspect of the present invention, there is provided a composition comprising any of the embodiments of the foregoing dsRNA reagent aspect of the present invention. In certain embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In certain embodiments, the composition is packaged in a cartridge, container, wrapper, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.
[0065] According to another aspect of the present invention, there is provided a cell comprising any of the embodiments of the foregoing dsRNA reagent aspect of the present invention. In some embodiments, the cell is a mammalian cell, optionally a human cell.
[0066] According to another aspect of the present invention, there is provided a method for inhibiting the expression of the PNPLA3 gene in cells, the method comprising: (i) preparing cells comprising an effective amount of any embodiment of the foregoing dsRNA reagent aspect of the present invention or any embodiment of the foregoing composition. In certain embodiments, the method further comprises: (ii) maintaining the prepared cells for a time sufficient to obtain degradation of the mRNA transcript of the PNPLA3 gene, thereby inhibiting the expression of the PNPLA3 gene in the cells. In some embodiments, the cells are located in a subject and the dsRNA reagent is administered subcutaneously to the subject. In some embodiments, the cells are located in a subject and the dsRNA reagent is administered to the subject by IV administration. In certain embodiments, the method further comprises evaluating the inhibition of the PNPLA3 gene after administering the dsRNA reagent to the subject, wherein the means for evaluation comprises: (i) determining one or more physiological characteristics of a PNPLA3-related disease or disorder in the subject, and (ii) comparing the determined physiological characteristics with a pre-treatment physiological characteristic baseline of the PNPLA3-related disease or disorder and / or with a physiological characteristic control of the PNPLA3-related disease or disorder, wherein the comparison indicates the presence or absence of one or more of the inhibition of the expression of the PNPLA3 gene in the subject. In some embodiments, the expression of the PNPLA3 gene can be evaluated based on the level or change in level of any variable associated with the expression of the PNPLA3 gene, such as the PNPLA3 mRNA level, the PNPLA3 protein level, the fat level and / or lipid droplet level in the liver, or the number or degree of amyloid deposits.
[0067] According to another aspect of the present invention, there is provided a method of inhibiting the expression of the PNPLA3 gene in a subject, the method comprising administering to the subject an effective amount of an embodiment of the foregoing dsRNA reagent of the present invention or an embodiment of the foregoing composition of the present invention. In some embodiments, the dsRNA reagent is administered subcutaneously to the subject. In certain embodiments, the dsRNA reagent is administered to the subject by IV administration. In some embodiments, the method further comprises: assessing the inhibition of the PNPLA3 gene after administering the dsRNA reagent, wherein the means for assessment comprises: (i) determining one or more physiological characteristics of a PNPLA3-related disease or disorder in the subject. (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of the PNPLA3-related disease or disorder and / or with control physiological characteristics of the PNPLA3-related disease or disorder, wherein the comparison indicates the presence or absence of inhibition of PNPLA3 gene expression in the subject. In some embodiments, the expression of the PNPLA3 gene can be assessed based on the level or change in level of any variable associated with the expression of the PNPLA3 gene, such as PNPLA3 mRNA level, PNPLA3 protein level, fat level and / or lipid droplet level in the liver, or the number or extent of amyloid deposits.
[0068] According to another aspect of the present invention, there is provided a method for treating a disease or disorder associated with the presence of PNPLA3 protein, the method comprising: administering to a subject an effective amount of any of the foregoing dsRNA reagent embodiments of the present invention, or an embodiment of any of the foregoing compositions of the present invention, for inhibiting PNPLA3 gene expression. In some embodiments, the disease or disorder is one or more of the following: liver disease, fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), cirrhosis, fat accumulation in the liver, liver inflammation, hepatocyte necrosis, hepatocellular carcinoma, liver fibrosis, obesity, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, or non-alcoholic fatty liver disease (NAFLD). In some embodiments, the method further comprises: administering to the subject an additional treatment regimen. In some embodiments, the additional treatment regimen comprises treatment of a PNPLA3-related disease or disorder. In certain embodiments, the additional treatment regimen comprises: administering to the subject one or more of the PNPLA3 antisense polynucleotides of the present invention, administering to the subject a non-PNPLA3 dsRNA therapeutic agent, and behavior modification of the subject. In some embodiments, the non-PNPLA3 dsRNA therapeutic agent is one or more of the following: HMG-CoA reductase inhibitor, fibrate, bile acid sequestrant, niacin, antiplatelet agent, angiotensin converting enzyme inhibitor, angiotensin II receptor antagonist, acyl-CoA cholesterol acyltransferase (ACAT) inhibitor, cholesterol absorption inhibitor, cholesteryl ester transfer protein (CETP) inhibitor, microsomal triglyceride transfer protein (MTTP) inhibitor, cholesterol regulator, bile acid regulator, peroxisome proliferator-activated receptor (PPAR) agonist, gene-based therapy, compound vascular protectant, glycoprotein IIb / IIIa inhibitor, aspirin or aspirin-like compound, IBAT inhibitor, squalene synthase inhibitor, monocyte chemoattractant protein (MCP)-I inhibitor, or fish oil. In some embodiments, the dsRNA reagent is administered subcutaneously to the subject. In certain embodiments, the dsRNA reagent is administered to the subject by IV administration. In some embodiments, the method further comprises determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject. In some embodiments, the method for determining the therapeutic efficacy of a subject comprises: (i) determining one or more physiological characteristics of a PNPLA3-related disease or disorder in the subject, and (ii) comparing the determined physiological characteristics with a baseline of pre-treatment physiological characteristics of the PNPLA3-related disease or disorder, wherein the comparison indicates the presence, absence, and level of therapeutic efficacy of administering the double-stranded ribonucleic acid (dsRNA) agent to the subject.In some embodiments, expression of the PNPLA3 gene can be evaluated based on the level or change in level of any variable associated with PNPLA3 gene expression, such as PNPLA3 mRNA level, PNPLA3 protein level, level of fat and / or level of lipid droplets in the liver, or the number or extent of amyloid deposits.
[0069] According to another aspect of the invention, there is provided a method of reducing the level of PNPLA3 protein in a subject as compared to a pre-treatment baseline level of PNPLA3 protein in the subject, the method comprising administering to the subject an effective amount of any of the foregoing dsRNA reagent embodiments of the invention or any of the foregoing composition embodiments of the invention to reduce the PNPLA3 gene expression level. In some embodiments, the dsRNA reagent is administered subcutaneously to the subject or by IV administration to the subject.
[0070] According to another aspect of the invention, there is provided a method of altering the physiological characteristics of a PNPLA3-related disease or disorder in a subject as compared to a pre-treatment physiological characteristic baseline of the PNPLA3-related disease or disorder in the subject, the method comprising administering to the subject an effective amount of any of the foregoing dsRNA reagent embodiments of the invention or any of the foregoing composition embodiments of the invention to alter the physiological characteristics of the PNPLA3-related disease or disorder in the subject. In some embodiments, the dsRNA reagent is administered subcutaneously to the subject or by IV administration to the subject. In certain embodiments, the physiological characteristic is one or more of the following: the level of PNPLA3 mRNA or PNPLA3 protein in a fluid or tissue sample from a particular site in the subject (such as the liver or blood).
[0071] According to another aspect of the invention, there is provided the foregoing dsRNA reagent for use in a method of treating a disease or disorder associated with the presence of PNPLA3 protein. In some embodiments, the disease or disorder is one or more of the following: fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis, fat accumulation in the liver, liver inflammation, hepatocyte necrosis, liver fibrosis, obesity, or non-alcoholic fatty liver (NAFLD) disease, fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), cirrhosis, liver fat accumulation, liver inflammation, hepatocyte necrosis, hepatocellular carcinoma, liver fibrosis, obesity, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis or non-alcoholic fatty liver (NAFLD).
[0072] According to another aspect of the present invention, there is provided an antisense polynucleotide reagent for inhibiting the expression of PNPLA3 protein, said reagent comprising 10 to 30 consecutive nucleotides, wherein at least one of said consecutive nucleotides is a modified nucleotide, and wherein the nucleotide sequence of said reagent is approximately 80% complementary to the same region of the nucleotide sequence of SEQ ID NO:1 over its entire length. In some embodiments, the same region is any target region of SEQ ID NO:1 and any one of the complementary sequences is provided in one of Tables 1-3. In certain embodiments, the antisense polynucleotide reagent comprises one of the antisense sequences provided in one of Tables 1-3.
[0073] According to another aspect of the present invention, there is provided a composition comprising any of the foregoing embodiments of the antisense polynucleotide reagent. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating PNPLA3-related diseases or disorders. In certain embodiments, the composition is packaged in a cartridge, container, wrapper, dispenser, pre-filled syringe or vial. In certain embodiments, the composition is formulated for subcutaneous or IV administration.
[0074] According to another aspect of the present invention, there is provided a cell comprising any of the foregoing embodiments of the antisense polynucleotide reagent. In some embodiments, the cell is a mammalian cell, optionally a human cell.
[0075] According to another aspect of the present invention, there is provided a method for inhibiting the expression of the PNPLA3 gene in a cell, the method comprising: (i) preparing a cell comprising an effective amount of any of the foregoing embodiments of the antisense polynucleotide reagent. In some embodiments, the method further comprises (ii) maintaining the cell prepared in (i) for a time sufficient to obtain degradation of the mRNA transcript of the PNPLA3 gene, thereby inhibiting the expression of the PNPLA3 gene in the cell.
[0076] According to another aspect of the present invention, there is provided a method for inhibiting the expression of the PNPLA3 gene in a subject, the method comprising administering to the subject an effective amount of any of the foregoing embodiments of the antisense polynucleotide reagent.
[0077] According to another aspect of the present invention, there is provided a method of treating a disease or disorder associated with the presence of PNPLA3 protein, the method comprising administering to a subject an effective amount of any of the foregoing antisense polynucleotide reagent embodiments of the present invention or any of the foregoing composition embodiments to inhibit the expression of the PNPLA3 gene. In certain embodiments, the disease or disorder is one or more of the following: liver disease, fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), cirrhosis, fat accumulation in the liver, liver inflammation, liver, hepatocyte necrosis, hepatocellular carcinoma, liver fibrosis, obesity, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, or non-alcoholic fatty liver disease (NAFLD).
[0078] According to another aspect of the present invention, there is provided a method of reducing the level of PNPLA3 protein in a subject as compared to a pre-treatment baseline level of PNPLA3 protein in the subject, the method comprising administering to the subject an effective amount of any of the foregoing antisense polynucleotide reagent embodiments of the present invention or any of the foregoing composition embodiments to reduce the PNPLA3 gene expression level. In certain embodiments, the antisense polynucleotide reagent is administered subcutaneously or by IV to the subject.
[0079] According to another aspect of the present invention, there is provided an antisense polynucleotide reagent for inhibiting the expression of the PNPLA3 gene, the reagent comprising 10 to 30 consecutive nucleotides, wherein at least one of the consecutive nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the reagent has about 80% or about 85% complementarity with an equivalent region of the nucleotide sequence of SEQ ID NO:1 over its entire length.
[0080] According to another aspect of the present invention, there is provided a method of altering the physiological characteristics of a PNPLA3-related disease or disorder in a subject as compared to a pre-treatment physiological characteristic baseline of the PNPLA3-related disease or disorder in the subject, the method comprising administering to the subject an effective amount of any of the foregoing antisense polynucleotide reagent embodiments of the present invention or any of the foregoing composition embodiments to alter the physiological characteristics of the PNPLA3 disease or disorder in the subject. In some embodiments, the antisense polynucleotide reagent is administered subcutaneously or by IV to the subject. In some embodiments, the physiological characteristic is one or more of the following: the level of PNPLA3 mRNA or PNPLA3 protein in a sample of a fluid or tissue produced from a specific site in the subject's body (e.g., the liver or blood).
[0081] Sequence description
[0082] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complement) are Homo sapiens Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [NCBI Reference Sequence: NM_025225.3].
[0083] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complement) are Homo sapiens Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [Source: HGNC Symbol; Acc: HGNC:18590; Transcript: ENST00000423180.2].
[0084] SEQ ID NO: 5 and SEQ ID NO: 6 (reverse complement) are predicted Macaca fascicularis Patatin-like phospholipase domain-containing protein 3, mRNA [NCBI Reference Sequence: XM_005567051.2].
[0085] SEQ ID NO: 7 and SEQ ID NO: 8 (reverse complement) are predicted Macaca fascicularis Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [NCBI Reference Sequence: XM_015457081.1]. SEQ ID NO: 9 and SEQ ID NO: 10 (reverse complement) are predicted Macaca fascicularis Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [Source: HGNC Symbol; Acc: HGNC:18590; Transcript: ENSMFAT00000025830.2].
[0086] SEQ ID NO: 11 and SEQ ID NO: 12 (reverse complement) are predicted Macaca mulatta Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [NCBI Reference Sequence: XM_001109144.4].
[0087] SEQ ID NO: 13 and SEQ ID NO: 14 (reverse complement) are predicted Macaca mulatta Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [NCBI Reference Sequence: XM_015150532.2].
[0088] SEQ ID NO:15 and SEQ ID NO:16 (reverse complement) are the predicted Macaca mulatta Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [Source: VGNC Symbol; Acc: VGNC:76061; Transcript: ENSMMUT00000023461.4].
[0089] SEQ ID NO:17 and SEQ ID NO:18 (reverse complement) are the Mus musculus Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [NCBI Reference Sequence: NM_054088.3].
[0090] SEQ ID NO:19 and SEQ ID NO:20 (reverse complement) are the Mus musculus Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [Source: MGI Symbol; Acc: MGI:2151796; Transcript: ENSMUST00000045289.6].
[0091] SEQ ID NO:21 and SEQ ID NO:22 (reverse complement) are the Rattus norvegicus Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [NCBI Reference Sequence: NM_001282324.1].
[0092] SEQ ID NO:23 and SEQ ID NO:24 (reverse complement) are the Rattus norvegicus Patatin-like phospholipase domain-containing protein 3 (PNPLA3), mRNA [Source: RGD Symbol; Acc: 1595843; Transcript: ENSRNOT00000015767.8].
[0093] SEQ ID NO: 25 - 252 are shown in Table 1 and are the sense strand sequences.
[0094] SEQ ID NO: 253 - 480 are shown in Table 1 and are the antisense strand sequences.
[0095] SEQ ID NOs: 481 - 648 are shown in Table 2, where chemical modifications are represented as follows: uppercase: 2'-fluoro; lowercase: 2'-OMe; phosphorothioate: *, and those skilled in the art can understand that "*" is a symbol representing the linkage relationship, where the presence of "*" indicates that the monomers are linked to each other by phosphorothioate diester bonds, and the absence of "*" indicates that the monomers are linked to each other by phosphodiester bonds; and invab = inverted abasic.
[0096] SEQ ID NOs: 649 - 742 are shown in Table 3. The delivery molecule is represented as "GLX - __" at the 3'-end or 5'-end of each sense strand. Chemical modifications are represented as: uppercase: 2'-Fluoro; lowercase: 2'-OMe; phosphorothioate: *, and those skilled in the art can understand that "*" is a symbol representing the linkage relationship, where the presence of "*" indicates that the monomers are linked to each other by phosphorothioate diester bonds, and the absence of "*" indicates that the monomers are linked to each other by phosphodiester bonds; invab = inverted abasic; imann: when located at the end of each strand or when further conjugated to the delivery molecule VPu*: Detailed Description
[0097] The present invention partly includes RNAi agents, such as but not limited to double-stranded (ds) RNAi agents, which are capable of inhibiting the expression of the patatin-like phospholipase domain-containing protein 3 (PNPLA3) gene. The present invention also partly includes a composition comprising a PNPLA3 RNAi agent and a method of using the composition. The PNPLA3 RNAi agent disclosed herein can be attached to a delivery compound for delivery to cells, including hepatocytes. The pharmaceutical composition of the present invention may comprise at least one double-stranded PNPLA3 agent and a delivery compound. In some embodiments of the compositions and methods of the present invention, the delivery compound is a GalNAc-containing delivery compound. The PNPLA3 RNAi agent delivered to cells is capable of inhibiting the expression of the PNPLA3 gene, thereby reducing the activity of the PNPLA3 protein product of this gene in the cells. The dsRNAi agent of the present invention can be used to treat PNPLA3-related diseases and disorders.
[0098] In some embodiments of the present invention, reducing PNPLA3 expression in a cell or a subject treats a disease or disorder associated with PNPLA3 expression in the cell or the subject, respectively. Non-limiting examples of diseases and disorders that can be treated by reducing PNPLA3 activity are: liver diseases, fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), cirrhosis, fat accumulation in the liver, liver inflammation, hepatocyte necrosis, hepatocellular carcinoma, liver fibrosis, obesity, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, or non-alcoholic fatty liver disease (NAFLD), or other diseases in which reducing the level and activity of PNPLA3 protein would be medically beneficial.
[0099] As used herein, "G," "C," "A," and "U" generally represent nucleotides that contain guanine, cytosine, adenine, and uracil as bases, respectively. However, it is understood that the term "ribonucleotide" or "nucleotide" may also refer to a modified nucleotide, as described below, or a nucleotide analogue. Those skilled in the art will understand that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the basic pairing properties of the oligonucleotide of the nucleotide containing such a substituted moiety. For example, without limitation, a nucleotide containing inosine as a base may pair with a nucleobase containing adenine, cytosine, or uracil. Thus, a nucleotide containing inosine, for example, may be used to replace a nucleotide containing uracil, guanine, or adenine in the nucleotide sequences of the present invention. Sequences containing such substituted moieties are examples of embodiments of the present invention.
[0100] As used herein, "Patatin-like phospholipase domain-containing protein 3" is used interchangeably with the term "PNPLA3" and refers to the native gene encoding a triacylglycerol lipase that mediates triacylglycerol hydrolysis in adipocytes. The amino acid and full coding sequences of the human PNPLA3 gene reference sequence can be found in the following sequences, for example, GenBank RefSeq accession number NM_025225.3 (SEQ ID NO: 1 and SEQ ID NO: 2); HGNC transcript: ENST00000423180.2 (SEQ ID NO: 3 and SEQ ID NO: 4). Mammalian orthologs of the human PNPLA3 gene can be found in the following sequences, for example, GenBank RefSeq accession number
[0101] XM_005567051.2, Cynomolgus monkey (SEQ ID NO:5 and SEQ ID NO:6); RefSeq accession number XM_015457081.1, Cynomolgus monkey (SEQ ID NO:7 and SEQ ID NO:8); HGNC transcript: ENSMFAT00000025830.2, Cynomolgus monkey (SEQ ID NO:9 and SEQ ID NO:10); GenBank RefSeq accession number XM_001109144.4, Rhesus monkey (SEQ ID NO:11 and SEQ ID NO:12); GenBank RefSeq accession number XM_015150532.2, Rhesus monkey (SEQ ID NO:13 and SEQ ID NO:14); HGNC transcript: ENSMMUT00000023461.4, Rhesus monkey (SEQ ID NO:15 and SEQ ID NO:16); GenBank RefSeq accession number NM_054088.3, Mouse, (SEQ ID NO:17 and SEQ ID NO:18); HGNC transcript: ENSMUST00000045289.6, Mouse, (SEQ ID NO:19 and SEQ ID NO:20); GenBank RefSeq accession number NM_001282324.1, Rat (SEQ ID NO:21 and SEQ ID NO:22); HGNC transcript: ENSRNOT00000015767.7, Rat (SEQ ID NO:23 and SEQ ID NO:24). Other examples of PNPLA3 mRNA sequences can be readily obtained using publicly available databases such as GenBank, UniProt, Ensembl, and OMIM.
[0102] Described below are methods for preparing and using compositions comprising PNPLA3 single-stranded (ssRNA) and dsRNA reagents to inhibit PNPLA3 gene expression, as well as compositions and methods for treating diseases and disorders caused or modulated by PNPLA3 gene expression. The term "RNAi" is also known in the art and may be referred to as "siRNA".
[0103] As used herein, the term "RNAi" refers to an agent that comprises RNA and mediates targeted cleavage of an RNA transcript through the RNA-induced silencing complex (RISC) pathway. As is known in the art, an "RNAi target region", which is also defined as a "target region" or "targeting moiety", refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA) that is a product of RNA processing of a primary transcript. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion. The target sequence can be 8 to 30 nucleotides in length (including the endpoints), 10 to 30 nucleotides in length (including the endpoints), 12 to 25 nucleotides in length (including the endpoints), 15 to 23 nucleotides in length (including the endpoints), 16 to 23 nucleotides in length (including the endpoints), or 18 to 23 nucleotides in length (including the endpoints), including all shorter lengths within each stated range. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In certain embodiments, the target sequence is 9 to 26 nucleotides in length (including the endpoints), including all sub-ranges and integers therebetween. For example, although not intended to be limiting, in certain embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length and its sequence is fully or at least substantially complementary to at least a portion of the RNA transcript of the PNPLA3 gene. Some aspects of the invention include pharmaceutical compositions comprising one or more PNPLA3 dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the invention, the PNPLA3 RNAi described herein inhibits the expression of the PNPLA3 protein.
[0104] As used herein, "dsRNA agent" means a composition of RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that includes messenger RNA (mRNA) transcripts capable of degrading or inhibiting the translation of a target mRNA in a sequence-specific manner. Without wishing to be bound by a particular theory, the dsRNA agents of the invention may act through the RNA interference mechanism (i.e., by interacting with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells to induce RNA interference), or through any alternative mechanism or pathway. Methods for gene silencing in plant, invertebrate, and vertebrate cells are well known in the art [see, e.g., (Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363;
[0105] Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188)], the disclosures of which are incorporated herein by reference in their entireties. Gene silencing procedures known in the art can be used in combination with the disclosures provided herein to inhibit the expression of PNPLA3.
[0106] The dsRNA reagents disclosed herein consist of a sense strand and an antisense strand, and include but are not limited to: short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrate. The antisense strand of the dsRNA reagent described herein is at least partially complementary to the targeted mRNA. Those skilled in the art should understand that dsRNA duplex structures of different lengths can be used to inhibit target gene expression. For example, it is known that dsRNAs with duplex structures of 19, 20, 21, 22, and 23 base pairs can effectively induce RNA interference (Elbashir et al., EMBO 2001, 20: 6877-6888). It is also known in the art that shorter or longer RNA duplex structures can also effectively induce RNA interference. As used herein, the terms "double-stranded region", "duplex region", and "complementary region" are used interchangeably and refer to a region where the sense strand is completely or substantially completely complementary to the antisense strand as is well known in the art. The PNPLA3 dsRNA in certain embodiments of the present invention may include at least one strand with a minimum length of 21 nt, or may have a sequence based on one of the sequences listed in Tables 1-3, but shorter duplexes with 1, 2, 3, or 4 nucleotides subtracted from one or both of their ends may also be effective. In some embodiments of the present invention, the PNPLA3 dsRNA reagent may have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more consecutive nucleotides from one or more sequences in Tables 1-3, and their ability to inhibit the expression of the PNPLA3 gene does not differ by more than 5, 10, 15, 20, 25, or 30% from the inhibition level produced by the dsRNA containing the complete sequence. The sense sequences, antisense sequences, and duplexes disclosed in Tables 1-3 may be referred to herein as "parental" sequences, meaning that the sequences disclosed in Tables 1-3 can be modified, shortened, extended, including substitutions, etc. As described herein, the resulting sequences retain all or at least part of the efficacy of their parental sequences in the methods and compositions of the present invention. The sense strand and the antisense strand included in the dsRNA of the present invention are independently selected. As used herein, the term "independently selected" means that each of two or more similar elements can be selected independently of the selection of other elements. For example, although not intended to be limiting, when preparing the dsRNA of the present invention, the "elements" of the two strands can be selected to be included in the duplex.One selected element, the sense sequence can be SEQ ID NO: 650 (shown in Table 3), while for another selected element, the antisense sequence can be SEQ ID NO: 687, or it can be a modified SEQ ID NO: 687 which is shortened, extended and / or includes 1, 2 or 3 substitutions compared to its parental sequence SEQ ID NO: 687. It should be understood that the double-stranded bodies of the present invention do not need to include both the sense sequence and the antisense sequence as paired in the double-stranded body. In Tables 1-3, each sense strand and antisense strand sequence in the table is followed immediately by its SEQ ID NO.
[0107] Certain embodiments of the compositions and methods of the present invention comprise single-stranded RNA in the composition and / or administered to a subject. For example, an antisense strand such as any of the antisense strands listed in Tables 1-3 can be in the composition or administered in the composition to a subject to reduce the activity of the PNPLA3 polypeptide and / or the expression of the PNPLA3 gene in the subject. Tables 1-3 show the antisense strand and sense strand core extended base sequences of certain PNPLA3 dsRNA reagents. The single-stranded antisense molecules that can be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as "single-stranded antisense agents" or "antisense polynucleotide agents". The single-stranded sense molecules that can be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as "single-stranded sense reagents" or "sense polynucleotide reagents". The term "base sequence" is used herein to refer to a polynucleotide sequence without chemical modification or delivery compounds. For example, the sense strand GAGGUCCUUCAGAUCUUGUA (SEQ ID NO: 25) shown in Table 1 is the base sequence of SEQ ID NO: 481 in Table 2 and SEQ ID NO: 674 in Table 3, where SEQ ID NO: 481 and SEQ ID NO: 674 are shown together with their chemical modifications and / or delivery compounds. The sequences disclosed herein can be assigned identifiers. For example, a single-stranded sense sequence can be identified with "sense strand SS#"; a single-stranded antisense sequence can be identified with "antisense strand AS#", and a double-stranded body including a sense strand and an antisense strand can be identified with "double-stranded body AD# / AV#".
[0108] Table 1 includes a sense strand and an antisense strand, and provides an identification number for the duplex formed by the sense strand and the antisense strand on the same line in Table 1. The sense strand SEQ ID No: 177-252 includes random nucleobases (n) at positions 1, 2, 3, and 21 counted from the 5' end. The antisense strand SEQ ID No: 405-480 includes random nucleobases (n) at positions 1, 19, 20, and 21 counted from the 5' end. In certain embodiments of the present invention, the antisense sequence includes the nucleobase u or the nucleobase a at position 1 of the antisense sequence. In certain embodiments of the present invention, the antisense sequence includes the nucleobase u at position 1 of the antisense sequence. In the sequences shown in Table 1, "n" can be any one of the nucleobases a, u, c, g, and t, and can be independently selected for the sense strand and the antisense strand, and each "n" strand in the sense strand or the antisense strand can be the same or different. As used in the context of "n" in the sense strand and the antisense strand, it should be understood that the nucleobase "n" selected and included in the position in the sense strand is a different nucleobase from the "n" in the antisense strand paired with that sense strand, but is generally complementary to the nucleobase "n" at the matching position in the opposite strand. The term "matching position" in the sense strand and the antisense strand used herein is the position "paired" in each strand when the two strands are the strands of a duplex. For example, in a 21-nucleobase sense strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 21 of the antisense strand are in a "matching position". In another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, the nucleobase 2 of the sense strand and the nucleobase 22 of the antisense strand are in a matching position. In another non-limiting example, in an 18-nucleobase sense strand and an 18-nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase 18 of the antisense strand are in a matching position, and the nucleobase 4 of the sense strand and the nucleobase 15 of the antisense strand are in a matching position. Those skilled in the art will understand how to identify the matching positions in the sense strand and the antisense strand of the strands that are or will be a duplex and the paired strands.
[0109] Although (n) can be any one of a, u, c, g, or t, the "n" at the 1st position of the sense strand is usually complementary to the (n) at the 21st position of the antisense strand. In two non-limiting examples, (1) if the 1st position of the sense strand is "g", then the 21st position of the antisense strand is "c"; and (2) if the 1st position of the sense strand is "a", then the 21st position of the antisense strand is "u" or "t". This type of complementary matching pairing applies to the (n) at the 2nd position of the sense strand and the 20th position of the antisense strand; the (n) at the 21st position of the sense strand and the 1st position of the antisense strand. It should be understood that although n can be any nucleotide at these positions, the nucleotides of the sense strand and the antisense strand are usually still complementary (matched), however, in some embodiments, they may have mismatches. For example, although not intended to be limiting, in some embodiments, "n" can be "random", meaning that it can but does not have to be complementary. In certain embodiments, "n" is complementary. As a non-limiting example, the "n" at the 1st position of the antisense strand is "u", and the "n" at the 21st position of the sense strand is "a". Those skilled in the art will understand how to determine the matching positions in the sense strand and the antisense strand that are or will be the duplex and the paired strands.
[0110] The last column in Table 1 represents the duplex AD# of the duplex, which includes the sense sequence and the antisense sequence in the same row of the table. For example, Table 1 discloses a duplex designated as duplex AD#AD00448.um, which includes the sense strand SEQ ID NO:25 and the antisense strand SEQ ID NO:253. Thus, each row in Table 1 identifies the duplex of the present invention, each row contains the sense and antisense sequences shown in the same row, and the designated identifier of each duplex is shown in the last column of that row.
[0111] In some embodiments of the method of the present invention, an RNAi agent comprising the polynucleotide sequences shown in Table 1 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex, which comprises at least one base sequence listed in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the method of the present invention, the RNAi agent comprising the polynucleotide sequences shown in Table 1 is attached to a delivery molecule, non-limiting examples of which are delivery compounds comprising a GalNAc compound or a GLS-15 compound.
[0112] Table 1: Antisense and sense strand sequences of unmodified PNPLA3 RNAi agents. All sequences are shown in the 5' to 3' direction. The duplex AD# is the number assigned to the duplex of the two strands in the same row of the table.
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119] Table 2 shows the antisense and sense strand sequences of certain chemically modified PNPLA3 RNAi agents of the present invention. In some embodiments of the methods of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to a cell and / or a subject. In some embodiments of the methods of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex in a row identified in the first column of Table 2 and comprises sequence modifications shown in the sense strand sequence and the antisense strand sequence in the third column and the sixth column, respectively, of the same row in Table 2. In some embodiments of the methods of the present invention, the sequences shown in Table 2 may be attached to (also referred to herein as “conjugated to”) a compound capable of delivering the RNAi agent to cells and / or tissues in a subject. Non-limiting examples of delivery compounds useful in certain embodiments of the present invention are compounds containing GalNAc or compounds containing GLS-15. In Table 2, the first column represents the duplex AV# of the base sequence as shown in Table 1. Table 2 discloses the duplex AV# and also shows the chemical modifications contained in the sense and antisense sequences of the duplex. For example, Table 1 shows the single-stranded base sequences SEQ ID NO:25 (sense) and SEQ ID NO:253 (antisense), which together are a double-stranded duplex, identified as: Duplex AD#AD00448.um and Table 2 lists the duplex AV#AV00448, which indicates that the duplex of SEQ ID NO:481 and SEQ ID NO:565 comprises the base sequences of SEQ ID NO:25 and SEQ ID NO:253, respectively, but with the sequence modifications shown in the sense sequence and the antisense sequence shown in the third column and the sixth column, respectively. The “Sense Strand SS#” in the second column of Table 2 is an identifier assigned to the sense sequence (including modifications) shown in the third column of the same row. The “Antisense Strand AS#” in the fifth column of Table 2 is an identifier assigned to the antisense sequence (including modifications) shown in the sixth column.
[0120]
[0121]
[0122]
[0123] Table 3 shows the antisense and sense strand sequences of certain chemically modified PNPLA3 RNAi agents of the present invention. In some embodiments of the methods of the present invention, the RNAi agents shown in Table 3 are administered to cells and / or subjects. In some embodiments of the methods of the present invention, an RNAi agent having the polynucleotide sequence shown in Table 3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to a subject comprises a duplex in a row identified in the first column of Table 3 and includes sequence modifications and / or delivery compounds shown in the sense and antisense strand sequences in the third and sixth columns, respectively, of the same row in Table 3. This sequence is used in certain in vivo test studies described elsewhere herein. In some embodiments of the methods of the present invention, the sequences shown in Table 3 can be linked to (also referred to herein as "conjugated to") a compound for delivery, non-limiting examples of which are compounds containing GalNAc, where the delivery compound is identified as "GLX-n" on the sense strand in the third column of Table 3. As used herein, "GLX-n" is used to denote a "GLS-n" or "GLO-n" delivery compound ("X" can be "S" or "O") and GLX-0 can be any "GLS-n" and "GLO-n" delivery compound that can be attached to the 3' or 5' end of the oligonucleotide during synthesis. As used herein and shown in Table 3, "GLX-n" is used to denote that the conjugated GalNAc-containing compound is any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, the structures of which are provided elsewhere herein. Those skilled in the art will be able to prepare and use the dsRNA compounds of the present invention, wherein the conjugated delivery compound is one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16.The first column of Table 3 provides the duplex AD# of the duplex of the sense and antisense sequences assigned to the rows of the table. For example, duplex AD#AD00451 is the duplex of sense strand SEQ ID NO:650 and antisense strand SEQ ID NO:687. Each row in Table 3 provides a sense strand and an antisense strand, and the duplex of the sense and antisense strands is disclosed. The "sense strand SS#" in the second column of Table 3 is the identifier assigned to the sense sequence (including modifications) shown in the third column in the same row. The "antisense strand AS#" in the fifth column of Table 3 is the identifier assigned to the antisense sequence (including modifications) shown in the sixth column. The identifiers of certain linked GalNAc-containing "GLO-n" or "GLS-n" compounds are shown as GLS-5, GLS-15 or GLX-0, and it should be understood that another "GLO-n" or "GLS-n" compound can be substituted for the compound shown as GLO-0, and the resulting compounds are included in the embodiments of the methods and / or compositions of the present invention. GLO-0 refers to the compound GalNAc3 in Jayaprakash, et al., (2014) J. Am. Chem. Soc., 136, 16958-16961.
[0124]
[0125]
[0126] In certain embodiments of the present invention, the dsRNA (also referred to herein as "duplex") is the dsRNA disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a duplex comprising the sense strand sequence and the antisense strand sequence in that row of the table. In addition to the duplexes disclosed in Tables 1-3, it should be understood that in some embodiments, the duplexes of the present invention may include the sense and antisense sequences shown in Tables 1-3, sequences that differ from the sequences shown in Tables 1-3 by zero, one, two, or three nucleotides. Thus, as a non-limiting example, in some embodiments, the antisense strand in the duplexes of the present invention may be SEQ ID NO:253, 565, 609, 635, 648, 702, 709, 710, or 717, having zero, one, two, or three different nucleotides from the nucleotides in SEQ ID NO:253, 565, 609, 635, 648, 702, 709, 710, or 717, respectively.
[0127] It should be understood that the sense strand sequence and the antisense strand sequence in the double-stranded bodies of the present invention can be independently selected. Thus, the dsRNAs of the present invention can comprise the sense and antisense strands of the double-stranded bodies disclosed in one row of Tables 1-3. Alternatively, in the dsRNAs of the present invention, one or both of the selected sense and antisense strands in the dsRNA can comprise the sequences shown in Tables 1-3, provided that one or both of the sense and antisense sequences comprise 1, 2, 3 or more nucleobase substitutions from the parental sequence. In some embodiments, the selected sequences can be longer or shorter than their parental sequences. Thus, the dsRNA reagents included in the present invention can, but need not, comprise the exact sequences of the sense and antisense pairs disclosed as double-stranded bodies in Tables 1-3.
[0128] In some embodiments, the dsRNA reagent comprises a sense strand and an antisense strand, wherein nucleotides positions 2 to 18 in the antisense strand comprise a region complementary to the PNPLA3 RNA transcript, and the complementary region comprises at least 15 consecutive nucleotides that differ from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2 or 3 nucleotides, and optionally comprises a targeting ligand. In some cases, the region complementary to the PNPLA3 RNA transcript comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from one of the antisense sequences listed in one of Tables 1-3 by no more than 3 nucleotides. In some embodiments of the dsRNA reagents of the present invention, the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO:1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA reagent of the present invention is fully complementary to any target region of SEQ ID NO:1 and is provided in any one of Tables 1-3. In some embodiments, the dsRNA reagent comprises the sense strand sequence listed in any one of Tables 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA reagent. In other embodiments, the dsRNA reagent of the present invention comprises the sense strand sequence listed in any one of Tables 1-3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA reagent. In some cases, the dsRNA reagent of the present invention comprises the antisense strand sequence listed in any one of Tables 1-3. Some embodiments of the dsRNA reagents of the present invention comprise the sense and antisense sequences disclosed as double-stranded bodies in any one of Tables 1-3. As described herein, it should be understood that the sense and antisense strands in the double-stranded bodies of the present invention can be independently selected.
[0129] Mismatch
[0130] It is known to those skilled in the art that mismatches are tolerable for potency in dsRNA, especially those within the terminal regions of dsRNA. Some mismatches are more tolerable, for example, mismatches with wobble base pairs G:U and A:C are more tolerable for potency (Du et al., A systematic analysis of the silencing effects of an active siRNA at all single - nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33(5):1671 - 7. Doi:10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33(11):3698). In some embodiments of the methods and compounds of the present invention, the PNPLA3 dsRNA reagent may contain one or more mismatches with the PNPLA3 target sequence. In some embodiments, the PNPLA3 dsRNA reagent of the present invention does not contain mismatches. In certain embodiments, the PNPLA3 dsRNA reagent of the present invention includes no more than 1 mismatch. In some embodiments, the PNPLA3 dsRNA reagent of the present invention includes no more than 2 mismatches. In certain embodiments, the PNPLA3 dsRNA reagent of the present invention includes no more than 3 mismatches. In some embodiments of the present invention, the antisense strand of the PNPLA3 dsRNA reagent contains a mismatch with the PNPLA3 target sequence that is not located at the center of the complementary region. In some embodiments, the antisense strand of the PNPLA3 dsRNA reagent includes 1, 2, 3, 4 or more mismatches within the last 5, 4, 3, 2 or 1 nucleotides at one or both of the 5'-end or 3'-end of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether a PNPLA3 dsRNA reagent containing a mismatch with the PNPLA3 target sequence is effective in inhibiting the expression of the PNPLA3 gene.
[0131] Complementarity
[0132] As used herein, unless otherwise specified, the term "complementary," as used herein to describe a first nucleotide sequence (e.g., the sense strand of a PNPLA3 dsRNA agent or a single-stranded antisense polynucleotide) in relation to a second nucleotide sequence (e.g., the antisense strand of a PNPLA3 dsRNA agent or targeting PNPLA3 mRNA), means the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base pair hydrogen bonds) with an oligonucleotide or polynucleotide comprising the second nucleotide sequence and form a duplex or double helix structure under certain conditions [under mammalian physiological conditions (or similar in vitro conditions)]. Other conditions may also apply, such as physiologically relevant conditions encountered in vivo. Those skilled in the art will be able to determine a set of conditions most suitable for testing the complementarity of two sequences based on the ultimate application of the hybridizing nucleotides. To the extent that the above hybridization requirements are met at least, complementary sequences contain Watson-Crick base pairs or non-Watson-Crick base pairs and contain natural or modified nucleotides or nucleotide mimetics. Sequence identity or complementarity is independent of modifications.
[0133] For example, complementary sequences within a PNPLA3 dsRNA as described herein involve base pairing of an oligonucleotide or polynucleotide comprising the first nucleotide sequence with an oligonucleotide or polynucleotide comprising the second nucleotide sequence over the full length of one or both nucleotide sequences. Such sequences may be referred to herein as "fully complementary" to each other. It should be understood that in some embodiments, when two oligonucleotides are designed to form one or more single-stranded overhangs after hybridization, such overhangs are not considered mismatches with respect to the determined complementarity herein. For example, a PNPLA3 dsRNA agent comprises an oligonucleotide 19 nucleotides in length and another oligonucleotide 20 nucleotides in length, wherein the longer oligonucleotide comprises a 19-nucleotide sequence that is fully complementary to the shorter oligonucleotide, and for the purposes described herein, it may also be referred to as "fully complementary." Thus, "fully complementary" as used herein means that all (100%) of the bases in a continuous sequence of a first polynucleotide will hybridize with the same number of bases in a continuous sequence of a second polynucleotide. The continuous sequence may comprise all or a portion of the first or second nucleotide sequence.
[0134] As used herein, the term "substantially complementary" means that in a hybridized nucleobase sequence pair, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, but not all, of the bases in a continuous sequence of a first polynucleotide will hybridize to the same number of bases in a continuous sequence of a second polynucleotide. The term "substantially complementary" can be used to refer to a first sequence relative to a second sequence if the two sequences include one or more, such as at least 1, 2, 3, 4 or 5, mismatched base pairs when hybridized. Duplexes of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs (bp), while retaining the ability to hybridize under these conditions, is most relevant to its ultimate application, such as inhibiting PNPLA3 gene expression via the RISC pathway.
[0135] The term "partially complementary" as used herein can be used to refer to a hybridized nucleobase sequence pair in which at least 75% but not all of the bases in a continuous sequence of a first polynucleotide will hybridize to the same number of bases in a continuous sequence of a second polynucleotide. In some embodiments, "partially complementary" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the bases in a continuous sequence of a first polynucleotide will hybridize to the same number of bases in a continuous sequence of a second polynucleotide.
[0136] The terms "complementary", "fully complementary", "substantially complementary" and "partially complementary" are used herein to refer to base pairing between the sense and antisense strands of a PNPLA3 dsRNA reagent, between the antisense strand of a PNPLA3 dsRNA reagent and the sequence of a target PNPLA3 mRNA, or between a single-stranded antisense oligonucleotide and the sequence of a target PNPLA3 mRNA. It should be understood that the term "antisense strand of a PNPLA3 dsRNA reagent" can represent the same sequence as a "PNPLA3 antisense polynucleotide reagent".
[0137] As used herein, the terms "substantially identical" or "substantial identity" when referring to a nucleic acid sequence mean a nucleic acid sequence that comprises a sequence having at least about 85% sequence identity or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by: determining the number of positions at which the same nucleic acid base occurs in the two sequences to yield the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences that are substantially identical to those disclosed herein (e.g., in Tables 1 to 3). In some embodiments, the sequences disclosed herein are identical to those disclosed herein (e.g., in Tables 1 to 3), or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical.
[0138] As used herein, the term "chain containing a sequence" means an oligonucleotide containing a nucleotide chain, which is described by a sequence referred to using standard nucleotide nomenclature. As used herein, the term "double-stranded RNA" or "dsRNA" refers to an RNAi comprising an RNA molecule or molecular complex having a hybrid double-stranded region containing two anti-parallel and substantially or fully complementary nucleic acid strands, which are referred to as having "sense" and "antisense" orientations relative to the target PNPLA3 RNA. The double-stranded region can be of any length that permits specific degradation of the desired target PNPLA3 RNA via the RISC pathway, but is typically from 9 to 30 base pairs in length, such as from 15 to 30 base pairs in length. Considering double-stranded regions between 9 and 30 base pairs, the double-stranded region can be any length within that range, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, as well as any sub-range therebetween, including but not limited to 15 to 30 base pairs, 15 to 26 base pairs, 15 to 23 base pairs, 15 to 22 base pairs, 15 to 21 base pairs, 15 to 20 base pairs, 15 to 19 base pairs, 15 to 18 base pairs, 15 to 17 base pairs, 18 to 30 base pairs, 18 to 26 base pairs, 18 to 23 base pairs, 18 to 22 base pairs, 18 to 21 base pairs, 18 to 20 base pairs, 19 to 30 base pairs, 19 to 26 base pairs, 19 to 23 base pairs, 19 to 22 base pairs, 19 to 21 base pairs, 19 to 20 base pairs, 20 to 30 base pairs, 20 to 26 base pairs, 20 to 25 base pairs, 20 to 24 base pairs, 20 to 23 base pairs, 20 to 22 base pairs, 20 to 21 base pairs, 21 to 30 base pairs, 21 to 26 base pairs, 21 to 25 base pairs, 21 to 24 base pairs, 21 to 23 base pairs, or 21 to 22 base pairs. The length of the PNPLA3 dsRNA agent produced in cells by treatment with a dicing enzyme and similar enzymes is typically from 19 to 22 base pairs. One strand of the double-stranded region of the PNPLA3 dsDNA agent contains a sequence substantially complementary to a region of the target PNPLA3 RNA. The two strands forming the double-stranded structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. When the double-stranded region is formed by two strands of a single molecule, the molecule can have a double-stranded region separated by a single-stranded nucleotide chain (referred to herein as a "hairpin loop") between the 3' end of one strand forming the double-stranded structure and the 5' end of the corresponding other strand.In some embodiments of the present invention, the hairpin loop comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two substantially complementary strands of the PNPLA3 dsRNA agent are composed of separate RNA molecules, those molecules need not but may be covalently linked. When the two strands are covalently linked by a means other than a hairpin loop, the linking structure is referred to as a "linker". The term "siRNA" is also used herein to refer to a dsRNA agent as described herein.
[0139] In some embodiments of the present invention, the PNPLA3 dsRNA reagent may comprise a sense sequence and an antisense sequence having no unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. The end without unpaired nucleotides is referred to as a "blunt end" and has no nucleotide overhang. If both ends of the dsRNA agent are blunt ends, the dsRNA is referred to as "blunt-ended". In some embodiments of the present invention, the first end of the dsRNA agent is a blunt end, in some embodiments, the second end of the dsRNA agent is a blunt end, and in certain embodiments of the present invention, both ends of the PNPLA3 dsRNA reagent are blunt.
[0140] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In such cases, there is at least one unpaired nucleotide at the end of the strand of the dsRNA agent. For example, when the 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand, or vice versa, there is a nucleotide overhang. The dsRNA may comprise an overhang having at least 1, 2, 3, 4, 5, 6 or more nucleotides. The nucleotide overhang may comprise or consist of: nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. It should be understood that in some embodiments, the nucleotide overhang is on the sense strand of the dsRNA agent, on the antisense strand of the dsRNA agent, or at both ends of the dsRNA agent, and the nucleotides of the overhang may be present at the 5' end, 3' end or both ends of the antisense or sense strand of the dsRNA. In certain embodiments of the present invention, one or more nucleotides in the overhang are replaced by phosphorothioate nucleosides.
[0141] As used herein, the term "antisense strand" or "guide strand" refers to the strand of the PNPLA3 dsRNA reagent that comprises a region that is substantially complementary to the PNPLA3 target sequence. As used herein, the term "sense strand" or "passenger strand" refers to the strand of the PNPLA3 dsRNA reagent that comprises a region that is substantially complementary to the region of the antisense strand of the PNPLA3 dsRNA reagent.
[0142] Modification
[0143] In some embodiments of the invention, the RNA of the PNPLA3 RNAi agent is chemically modified to enhance stability and / or one or more other beneficial characteristics. In certain embodiments of the invention, nucleic acids can be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in Nucleic Acid Chemistry," Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, N.Y., USA, which is incorporated herein by reference. Modifications that can be present in certain embodiments of the PNPLA3 dsRNA agents of the invention include, for example, (a) terminal modifications, such as 5'-terminal modifications (phosphorylation, conjugation, inverted linkage, etc.), 3'-terminal modifications (conjugation, DNA nucleotides, inverted linkage, etc.); (b) base modifications, such as substitution of a base with a stable base, a destabilizing base, or a base with an extended repertoire of partners, removal of a base (abasic nucleotide) or a conjugated base; (c) sugar modifications (e.g., at the 2'- or 4'-position) or substitution of the sugar; and (d) backbone modifications, including modification or substitution of the phosphodiester linkage. Some specific examples of RNA compounds that can be used in certain embodiments of the PNPLA3 dsRNA agents, PNPLA3 antisense polynucleotides, and PNPLA3 sense polynucleotides of the invention include, but are not limited to, RNAs containing a modified backbone or non-natural internucleoside linkages. As a non-limiting example, an RNA having a modified backbone may not have a phosphorus atom in the backbone. An RNA that does not have a phosphorus atom in its internucleoside backbone can be referred to as an oligonucleotide. In certain embodiments of the invention, the modified RNA has a phosphorus atom in its internucleoside backbone.
[0144] It should be understood that the term "RNA molecule" or "RNA" or "ribonucleic acid molecule" encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA that contain one or more ribonucleotide / ribonucleoside analogs or derivatives as described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules can be modified in the nucleobase structure or in the ribose-phosphate backbone structure (e.g., as described below), and molecules containing ribonucleoside analogs or derivatives must retain the ability to form duplexes. As some non-limiting examples, RNA molecules can also contain at least one modified ribonucleoside, including but not limited to 2'-O-methyl modified nucleosides, nucleosides containing 5'-thiolphosphate groups, terminal nucleosides linked to cholesterol derivatives or didodecyldimethylammonium groups, locked nucleosides, abasic nucleosides, 2'-deoxy-2'-fluoro modified nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, phosphoramidates, or nucleosides containing unnatural bases, or any combination thereof. In some embodiments of the present invention, the RNA molecule contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or up to the full length of the PNPLA3 dsRNA agent molecule of ribonucleosides, which are modified ribonucleosides. For each of such multiple modified ribonucleosides in the RNA molecule, the modifications need not be the same.
[0145] In some embodiments, the dsRNA reagent, PNPLA3 antisense polynucleotide, and / or PNPLA3 sense polynucleotide of the present invention can contain one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester bonds. As used herein, the terms "nucleotide internucleoside bond", "nucleoside internucleoside bond", "internucleoside bond", and "linker" are used interchangeably and refer to the linking group between modified or unmodified nucleotides and / or between modified or unmodified nucleotides and one or more targeting groups. In certain embodiments, the internucleoside bond can independently be selected from: a phosphodiester (PO) bond, a phosphorothioate (PS) bond, and / or a dithiophosphonate (PS2) bond between two nucleotides at any position in a single-stranded or double-stranded oligonucleotide. As used herein, the term "independently selected" is used to refer to selected elements, such as modified nucleotides, non-phosphodiester bonds, etc., meaning that two or more selected elements can but need not be the same as each other.
[0146] As used herein, "nucleobase", "nucleotide" or "nuclear base" refers to a heterocyclic pyrimidine or purine compound, which is a standard component of all nucleic acids, and includes the nucleotide adenine (a), guanine (g), cytosine (c), thymine (t) and uracil (u). The nucleobase can be further modified to include, but not limited to: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases and fluorinated bases. The term "ribonucleotide" or "nucleotide" can be used herein to refer to an unmodified nucleotide, a modified nucleotide or a substitute replacement moiety. Those skilled in the art will recognize that guanine, cytosine, adenine and uracil can be replaced by other moieties, with substantially no change in the base pairing properties of the oligonucleotide containing the nucleotide with such a substituted moiety.
[0147] As used herein, "optionally" or "optionally" means that the event or circumstance described later can but does not necessarily occur, including where the event or circumstance occurs or does not occur. For example, "C1-6 alkyl is optionally substituted by halogen or cyano" means that halogen or cyano can but does not necessarily be present, including the case where the alkyl is substituted by halogen or cyano and the case where the alkyl is not substituted by halogen and cyano.
[0148] As used herein, in the chemical structure of the compounds of the present invention, the bond represents an unspecified configuration, that is, if there are chiral isomers in the chemical structure, the bond can be or both are and
[0149] both configurations. Although for simplicity, some of the above structural formulas are described as some isomeric forms, the present disclosure can include all isomers, such as tautomers, rotamers and mixtures thereof. Suitable chiral compounds include: geometric isomers, diastereomers, racemates and enantiomers.
[0150] As used herein, according to the scope of the present invention described herein, the chemical formulas used in the present invention or can be connected to any one or more groups.
[0151] In one embodiment, the modified RNA contemplated for use in the methods and compositions described herein is peptide nucleic acid (PNA), which has the ability to form the desired duplex structure and allows or mediates the specific degradation of target RNA via the RISC pathway. In certain embodiments of the invention, the PNPLA3 RNAi agents include single-stranded RNA that interacts with the target PNPLA3 RNA sequence to direct cleavage of the target PNPLA3 RNA.
[0152] Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, dithiophosphates, phosphotriesters, aminoalkyl phosphotriesters, methylphosphonates and other alkylphosphonates including 3'-alkylene phosphonates, as well as chiral phosphonates, phosphinates, aminophosphates including 3'-aminoaminophosphates and aminoalkylaminophosphates, phosphorothioamidates, thioalkylphosphonates, thioalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, their 2'-5' linked analogs, and those having opposite polarity wherein adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also included are various salts, mixed salts and free acid forms. Means for preparing phosphorus-containing linkages are conventional in the art and such methods can be used to prepare certain modified PNPLA3 dsRNA reagents, certain modified PNPLA3 antisense polynucleotides and / or certain modified PNPLA3 sense polynucleotides of the invention.
[0153] Modified RNA backbones that do not contain a phosphorus atom have a backbone formed of short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These include those having: morpholino linkages (formed in part from the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; olefin-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Means for preparing modified RNA backbones that do not contain a phosphorus atom are conventional practice in the art and such methods can be used to prepare certain modified PNPLA3 dsRNA reagents, certain modified PNPLA3 antisense polynucleotides and / or certain modified PNPLA3 sense polynucleotides of the invention.
[0154] In certain embodiments of the present invention, the RNA mimics are included in PNPLA3 dsRNA, PNPLA3 antisense polynucleotides, and / or PNPLA3 sense polynucleotides, such as but not limited to: replacing the sugar and internucleoside linkages of the nucleotide units with new groups, i.e., the backbone. In such embodiments, the base units are maintained for hybridization with the appropriate PNPLA3 nucleic acid target compounds. One such oligomeric compound, an RNA mimic that has been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with a backbone containing amides, specifically an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly bound to the azanitrogen atoms of the backbone amide moieties. Means for preparing RNA mimics are routinely practiced in the art, and such methods can be used to prepare certain modified PNPLA3 dsRNA reagents of the present invention.
[0155] Some embodiments of the present invention include RNAs having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone, and particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as methylene(methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2-- [where the natural phosphodiester backbone is represented as -O-P-O-CH2-]. Means for preparing RNAs having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone are routinely practiced in the art, and such methods can be used to prepare certain modified PNPLA3 dsRNA agents, certain PNPLA3 antisense polynucleotides, and / or certain PNPLA3 sense polynucleotides of the present invention.
[0156] The modified RNA can also contain one or more substituted sugar moieties. The PNPLA3 dsRNA, PNPLA3 antisense polynucleotide, and / or PNPLA3 sense polynucleotide of the present invention can contain at the 2'-position one of the following: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where the alkyl, alkenyl, and alkynyl can be substituted or unsubstituted C1 to C 10 alkyl or C2 to C 10 alkenyl and alkynyl. Some exemplary suitable modifications include O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2)n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In some other embodiments, the dsRNA contains at the 2'-position one of the following: C1 to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, a group for improving the pharmacokinetic properties of the PNPLA3 dsRNA reagent, or a group for improving the pharmacodynamic properties of the PNPLA3 dsRNA reagent, PNPLA3 antisense polynucleotide and / or PNPLA3 sense polynucleotide, and other substituents having similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy-alkoxy. Another exemplary modification is 2'-dimethylaminooxyethoxy as described in the examples below, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE; and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Means for preparing modified RNAs (such as those described) are routinely practiced in the art, and such methods can be used to prepare certain modified PNPLA3 dsRNA reagents of the present invention.
[0157] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2’-OCH2CH2CH2NH2), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of the PNPLA3 dsRNA reagent, PNPLA3 antisense polynucleotide, and / or PNPLA3 sense polynucleotide of the present invention, particularly at the sugar of the 3'-terminal nucleotide or the 3' position of the sugar in the 2'-5' linked PNPLA3 dsRNA, PNPLA3 antisense polynucleotide, or PNPLA3 sense polynucleotide, and at the 5' position of the 5'-terminal nucleotide. The PNPLA3 dsRNA reagent, PNPLA3 antisense polynucleotide, and / or PNPLA3 sense polynucleotide can also have sugar mimetics, such as a cyclobutyl moiety in place of ribofuranose. Methods for preparing modified RNAs, such as those described, are routine practice in the art, and such methods can be used to prepare certain modified PNPLA3 dsRNA reagents, PNPLA3 antisense polynucleotides, and / or PNPLA3 sense polynucleotides of the present invention.
[0158] In some embodiments, the PNPLA3 dsRNA reagent, PNPLA3 antisense polynucleotide, and / or PNPLA3 sense polynucleotide may include modified or substituted nucleobases (commonly referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl derivatives and other alkyl derivatives of adenine and guanine, 2-propyl derivatives and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azauracil, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, and other 8-substituted adenines and guanines, 5-halo especially 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaadenine and 8-azaguanine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Additional nucleobases that may be included in certain embodiments of the PNPLA3 dsRNA agents of the present invention are known in the art, see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993.Methods for preparing dsRNA, PNPLA3 antisense strand polynucleotides, and / or PNPLA3 sense strand polynucleotides that contain nucleobase modifications and / or substitutions (such as those described herein) are routine practices in the art, and such methods can be used to prepare certain modified PNPLA3 dsRNA reagents, PNPLA3 sense polynucleotides, and / or PNPLA3 antisense polynucleotides of the present invention. Teachings regarding the synthesis of specific modified oligonucleotides can be found in the following U.S. patents: U.S. Pat. No. 5,218,105, which describes polyamine-conjugated oligonucleotides; U.S. Pat. No. 5,541,307, which describes oligonucleotides with backbone modifications; U.S. Pat. No. 5,521,302, which describes the preparation process of oligonucleotides with chiral phosphorus bonds; U.S. Pat. No. 5,539,082, which describes peptide nucleic acids; U.S. Pat. No. 5,554,746, which describes oligonucleotides with a tri-lactam backbone; U.S. Pat. No. 5,571,902, which describes methods and materials for oligonucleotide synthesis; U.S. Pat. No. 5,578,718, which describes nucleosides with alkylthio groups, where these groups can be used as linkers for other moieties attached at any position of the nucleoside; U.S. Pat. No. 5,587,361, which describes oligonucleotides with phosphorothioate bonds of high chiral purity; U.S. Pat. No. 5,506,351, which describes the preparation process of 2'-O-alkyl guanosine and related compounds, including 2,6-diaminopurine compounds; U.S. Pat. No. 5,587,469, which describes oligonucleotides containing N-2 substituted purines; U.S. Pat. No. 5,587,470, which describes oligonucleotides containing 3-deazapurines; U.S. Pat. No. 5,608,046, which describes conjugated 4'-demethyl nucleoside analogs; U.S. Pat. No. 5,610,289, which describes oligonucleotide analogs with backbone modifications; U.S. Pat. No. 6,262,241, which describes the synthesis method of 2'-fluoro-oligonucleotides and others.
[0159] Certain embodiments of the PNPLA3 dsRNA reagents, PNPLA3 antisense polynucleotides, and / or PNPLA3 sense polynucleotides of the present invention include RNAs modified to include one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides with a modified ribose moiety that contains an additional bridging connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation. Incorporating locked nucleic acids into the PNPLA3 dsRNA reagents, PNPLA3 antisense polynucleotides, and / or PNPLA3 sense polynucleotides of the present invention can increase stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al.,
[0160] (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for preparing dsRNA reagents, PNPLA3 antisense polynucleotides, and / or PNPLA3 sense polynucleotides containing locked nucleic acids are routine practice in the art, and such methods can be used to prepare certain modified PNPLA3 dsRNA reagents of the present invention.
[0161] Certain embodiments of the PNPLA3 dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2',3'-seco nucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, and 3'-OMe nucleotide, nucleotide containing a 5'-thiophosphate group, nucleotide containing vinylphosphonate, nucleotide containing glycol nucleic acid (GNA), nucleotide containing s-isomer of thymidine glycol nucleic acid, nucleotide containing 2-hydroxymethyltetrahydrofuran-5-phosphate, nucleotide containing 2'-deoxythymidine-3'-phosphate, nucleotide containing 2'-deoxyguanosine-3'-phosphate, nucleotide containing 2'-deoxyadenosine-3'-phosphate, nucleotide containing 2'-deoxycytidine-3'-phosphate, nucleotide containing 2'-deoxyuridine-3'-phosphate, or a terminal nucleotide linked to a cholesteryl derivative or didodecylamide group, 2'-amino-modified nucleotide, aminophosphate, or nucleotide containing a non-natural base. In some embodiments, the PNPLA3 dsRNA compound contains an E-vinylphosphonate nucleotide at the 5'-end of the antisense strand (also referred to herein as the guide strand).
[0162] The 3'- and 5'-ends of the PNPLA3 dsRNA compounds, sense polynucleotides, and / or the 3'-end of the antisense polynucleotides in certain embodiments of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2'-Ome nucleotide, inverted 2'-deoxy nucleotide. As is known to those skilled in the art, inclusion of abasic or inverted abasic nucleotides at the ends of oligonucleotides enhances stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31(11): 2705-2716. doi:10.1093 / nar / gkg393). In some embodiments, the PNPLA3 dsRNA compound contains one or more inverted abasic residues (invab) at the 3'-end or 5'-end, or both the 3'-end and 5'-ends. Exemplary inverted abasic residues (invab) include, but are not limited to, the following:
[0163]
[0164] Certain embodiments of the PNPLA3 dsRNA compounds, 3' and 5' ends of the sense polynucleotides and / or 3' end of the antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: an isomannosyl nucleotide. Specific examples of isomannosyl nucleotides include, but are not limited to:
[0165]
[0166] wherein each phrase “Olig” independently represents a polynucleotide moiety. Exemplary isomannitol residues (imann) include, but are not limited to, the following structures:
[0167]
[0168] Certain embodiments of the PNPLA3 dsRNA compounds, antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide comprises unlocked nucleic acid nucleotides (UNA) or / and glycol nucleic acid nucleotides (GNA). As is known to those skilled in the art, UNA and GNA are thermally labile chemical modifications that can significantly improve the off-target profile of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723.doi:10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862–70).
[0169] The PNPLA3 dsRNA compounds, antisense polynucleotides of certain embodiments of the present invention further comprise a phosphate moiety. As used herein, a phosphate moiety refers to a phosphate group linked to the sugar moiety (e.g., ribose or deoxyribose or analogs thereof) of a nucleotide, including phosphates or phosphate mimics. Nucleotides containing phosphate mimics can also be defined as phosphonic acid-modified nucleotides.
[0170] In some embodiments, the phosphonate mimetic is a 5'-vinyl phosphonate (VP). In an exemplary embodiment, the vinyl phosphonates disclosed herein have the following structure:
[0171]
[0172] The vinyl phosphonates disclosed herein can be linked to the antisense or sense strand of the dsRNA disclosed herein. In certain preferred embodiments, the vinyl phosphonates disclosed herein are linked to the antisense strand of the dsRNA, optionally at the 5'-end of the antisense strand of the dsRNA.
[0173] In certain embodiments, the vinyl phosphonate-modified nucleotides have the structure of formula (IV):
[0174]
[0175] wherein X is O or S;
[0176] R is hydrogen, hydroxy, fluoro or C 1-20 alkoxy (such as methoxy or n-hexadecyloxy);
[0177] R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E or Z orientation (such as the E orientation); and
[0178] B is a nucleobase or a modified nucleobase, optionally wherein B is adenine, guanine, cytosine, thymine or uracil.
[0179] In certain embodiments, R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E orientation. In certain embodiments, R is methoxy and R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E orientation. In certain embodiments, X is S, R is methoxy, and R5' is =C(H)-P(O)(OH)2 and the double bond between the C5' carbon and R5' is in the E orientation.
[0180] Vinyl phosphonate modification is also contemplated for the dsRNAs, compositions and methods disclosed herein. The structure of an exemplary vinyl phosphonate is:
[0181]
[0182] In certain embodiments, the vinyl phosphonate-modified nucleotide is VPu*, which has the following structure:
[0183]
[0184] In many cases, protecting groups are used in the process of preparing the compounds of the present invention. As used herein, the term "protected" means that the designated moiety has a protecting group attached thereto. In some embodiments of the present invention, the compounds contain one or more protecting groups. A variety of protecting groups can be used in the methods of the present invention. Generally, protecting groups render chemical functional groups inert to specific reaction conditions and can be attached to or removed from such functional groups in a molecule with substantially no detriment to the remainder of the molecule. General protecting groups, especially hydroxyl protecting groups, are well known in the art (Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd Edition, John Wiley & Sons, New York, 1991).
[0185] As used herein, examples of protecting groups (such as hydroxyl protecting groups) include, but are not limited to, methyl, ethyl, benzyl (Bn), phenyl, isopropyl, tert-butyl, acetyl, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, tert-butoxymethyl, methoxymethyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, allyl, cyclohexyl, 9-fluorenylmethoxycarbonyl (Fmoc), methanesulfonate, toluenesulfonate, trifluoromethanesulfonate, benzoyl, benzoylformate, p-phenylbenzoyl, 4-methoxybenzyl, monomethoxytriphenylmethyl, dimethoxytriphenylmethyl, trimethoxytriphenylmethyl, 4-chlorobenzyl, 4-nitrobenzyl, 2,4-dinitrophenyl, 4-acyloxybenzyl, 2-methylphenyl, 2,6-dimethylphenyl, 2-chlorophenyl, 2,6-dichlorobenzyl, diphenylmethyl, triphenylmethyl, 4-methylthio-1-butyl, S-acetylthioacetate (SATA), 2-cyanoethyl, 2-cyano, 1-dimethylethyl (CDM), 4-cyano-2-butenyl, 2-(trimethylsilyl)ethyl (TSE), 2-(phenylthio)ethyl, 2-(triphenylsilyl)ethyl, 2-(benzylsulfonyl)ethyl, 2,2,2-trichloroethyl, 2,2,2-tribromoethyl, 2,3-dibromopropyl, 2,2,2-trifluoroethyl, phenylthio, 2-chloro-4-triphenylmethylphenyl, 2-bromophenyl, 2-[N-isopropyl-N-(4-methoxybenzoyl)amino]ethyl, 4-(N-trifluoroacetamido)butyl, 4-oxopentyl, 4-triphenylmethylaminophenyl, 4-benzylaminophenyl, tetrahydropyranyl, morpholino, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, pivaloyloxymethyl (POM), and 9-phenylxanthine-9-yl.
[0186] As used herein, examples of amino protecting groups include, but are not limited to, carbamate protecting groups such as 2-trimethylsilylethoxycarbonyl (Teoc), 1-methyl-1-(4-biphenylyl)ethoxycarbonyl (Bpoc), tert-butoxycarbonyl (BOC), allyloxycarbonyl (Alloc), 9-fluorenyl-methoxycarbonyl (Fmoc), benzyloxycarbonyl (Cbz); amide protecting groups such as formyl, acetyl, pivaloyl, trihaloacetyl, benzoyl, 2-nitrobenzenesulfonyl; and imine and cyclic imide protecting groups such as phthalimido and dithiosuccinyl. The compounds and methods of the present invention also encompass equivalents of these amino protecting groups.
[0187] Another modification that may be included in the RNA of certain embodiments of the PNPLA3 dsRNA agents, PNPLA3 antisense polynucleotides, and / or PNPLA3 sense polynucleotides of the present invention includes one or more ligands, moieties, or conjugates chemically linked to the RNA, which may enhance one or more characteristics of the PNPLA3 dsRNA agents, PNPLA3 antisense polynucleotides, and / or PNPLA3 sense polynucleotides, respectively. Non-limiting examples of characteristics that may be enhanced are: PNPLA3 dsRNA reagent, PNPLA3 antisense polynucleotide, and / or PNPLA3 sense polynucleotide activity, cellular distribution, delivery of the PNPLA3 dsRNA reagent, pharmacokinetic properties of the PNPLA3 dsRNA reagent, and cellular uptake of the PNPLA3 dsRNA reagent. In some embodiments of the present invention, the PNPLA3 dsRNA reagent comprises one or more targeting groups or linking groups, which are conjugated to the sense strand in certain embodiments of the PNPLA3 dsRNA reagent of the present invention. Non-limiting examples of targeting groups are compounds containing N-acetyl-galactosamine (GalNAc). The terms "targeting group", "targeting agent", "linking agent", "targeting compound", and "targeting ligand" may be used interchangeably herein. In certain embodiments of the present invention, the PNPLA3 dsRNA reagent comprises a targeting compound conjugated to the 5'-end of the sense strand. In certain embodiments of the present invention, the PNPLA3 dsRNA reagent comprises a targeting compound conjugated to the 3'-end of the sense strand. In some embodiments of the present invention, the PNPLA3 dsRNA reagent comprises a targeting group containing GalNAc. In certain embodiments of the present invention, the PNPLA3 dsRNA reagent does not include a targeting compound conjugated to one or both of the 3'-end and 5'-end of the sense strand. In certain embodiments of the present invention, the PNPLA3 dsRNA reagent does not include a targeting compound containing GalNAc conjugated to one or both of the 5'-end and 3'-end of the sense strand.
[0188] Additional targeting agents and linkers are known in the art. For example, targeting agents and linkers that can be used in certain embodiments of the present invention include, but are not limited to, lipid moieties such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556); bile acids (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060); thioethers such as beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770); thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538); aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54); phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783); polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973); or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654); palmitoyl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237); or octadecylamine or hexylamino-carbonyloxy cholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0189] Certain embodiments of a composition comprising a PNPLA3 dsRNA agent, a PNPLA3 antisense polynucleotide, and / or a PNPLA3 sense polynucleotide may comprise a ligand that modifies the distribution, targeting, etc. of the PNPLA3 dsRNA agent. In some embodiments of a composition comprising a PNPLA3 dsRNA agent of the invention, the ligand increases the affinity for a selected target (e.g., a molecule, cell or cell type, compartment such as a cellular or organ compartment, tissue, organ, or region of the body), e.g., as compared to a species without such a ligand. Ligands that can be used in the compositions and / or methods of the invention can be naturally occurring substances, e.g., proteins (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. The ligand can also be a recombinant or synthetic molecule, e.g., a synthetic polymer, e.g., a synthetic polyamino acid or polyamine. Some examples of polyamino acids are polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinylalcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendritic polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of polyamine, or α-helical peptide.
[0190] The ligand comprised in the compositions and / or methods of the invention may comprise a targeting group, some non-limiting examples of which are cell or tissue targeting agents, e.g., lectins, glycoproteins, lipids, or proteins, e.g., an antibody that binds to a specific cell type (e.g., a renal cell or a hepatocyte). The targeting group can be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acid, multivalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
[0191] Other examples of ligands include dyes, intercalators (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantylacetic acid, 1-pyrenebutanoic acid, dihydrotestosterone, 1,3-bis-O-(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl, palmitic acid, myristic acid, O3-(oleoyl) lithocholic acid, O3-(oleoyl) cholenoic acid, dimethoxytrityl or phen azine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphates / esters, amino groups, thiol groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamines, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP or AP.
[0192] The ligands included in the compositions and / or methods of the present invention can be proteins, such as glycoproteins, or peptides, such as molecules having specific affinity for co-ligands, or antibodies, such as those that bind to specific cell types, such as cancer cells, endothelial cells, cardiomyocytes, or osteocytes. Ligands that can be used in embodiments of the compositions and / or methods of the present invention can be hormones or hormone receptors. Ligands useful in embodiments of the compositions and / or methods of the present invention can be lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. Ligands useful in embodiments of the compositions and / or methods of the present invention can be substances that can increase the uptake of PNPLA3 dsRNA reagents into cells, such as by disrupting the cytoskeleton of the cell, such as by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell. Non-limiting examples of agents of this type are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.
[0193] In some embodiments, the ligand attached to the PNPLA3 dsRNA reagent of the present invention acts as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the present invention include, but are not limited to: lipophilic agents, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholanic acid, lithocholic acid, dialkyl glycerol esters, diacyl glycerol esters, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind serum proteins, etc. Oligonucleotides containing multiple phosphorothioate bonds are also known to bind to serum proteins, and thus short oligonucleotides containing multiple phosphorothioate bonds in the backbone, such as oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, can also be used in the compositions and / or methods of the present invention as ligands.
[0194] PNPLA3 dsRNA reagent composition
[0195] In some embodiments of the present invention, the PNPLA3 dsRNA reagent is in a composition. The compositions of the present invention may include one or more PNPLA3 dsRNA reagents and optionally one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc. In some embodiments of the methods according to the present invention, a non-limiting example of an available targeting agent is an agent that directs and / or delivers the "PNPLA3 dsRNA" agent of the present invention into and / or into the cells to be treated. The choice of targeting agent will depend on factors such as the nature of the PNPLA3-related disease or disorder and the cell type being targeted. In non-limiting examples, in some embodiments of the present invention, it may be desirable to target the PNPLA3 dsRNA reagent to hepatocytes and / or within hepatocytes. It should be understood that in some embodiments of the methods of the present invention, the therapeutic agent comprises a PNPLA3 dsRNA reagent having only a delivery agent, such as a delivery agent comprising N-acetylgalactosamine (GalNAc), without any additional attachment elements. For example, in some aspects of the present invention, the PNPLA3 dsRNA reagent may be attached to a delivery compound comprising GalNAc and included in a composition comprising a pharmaceutically acceptable carrier, and administered to cells or a subject without any detectable label or targeting agent, etc., attached to the PNPLA3 dsRNA reagent.
[0196] In the case where the PNPLA3 dsRNA agent of the present invention is administered together with and / or linked to one or more of the following: delivery agents, targeting agents, labeling agents, etc., those skilled in the art will recognize and be able to select and use suitable agents for the methods of the present invention. Labeling agents can be used in certain methods of the present invention to determine the location of the PNPLA3 dsRNA agent in cells and tissues, and can be used to determine the cell, tissue, or organ location of a therapeutic composition comprising the PNPLA3 dsRNA agent that has been administered in the methods of the present invention. Methods for conjugating and using labeling agents such as enzyme labels, dyes, radiolabels, etc. are well known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is linked to one or both of the sense polynucleotide and the antisense polynucleotide included in the PNPLA3 dsRNA agent.
[0197] Delivery of PNPLA3 dsRNA Reagents and PNPLA3 Antisense Polynucleotide Reagents
[0198] Certain embodiments of the methods of the present invention include delivering a PNPLA3 dsRNA reagent into cells. As used herein, the term "delivering" refers to facilitating or affecting the uptake or absorption of cells. The absorption or uptake of the PNPLA3 dsRNA reagent can occur by passive diffusion or active cellular processes, or by using delivery agents, targeting agents, etc. that can be associated with the PNPLA3 dsRNA reagent of the present invention. Delivery modes suitable for the methods of the present invention include, but are not limited to: in vivo delivery, wherein the PNPLA3 dsRNA reagent is injected into a tissue site or systemically administered. In some embodiments of the present invention, the PNPLA3 dsRNA reagent is linked to a delivery agent.
[0199] Non-limiting examples of methods that can be used to deliver a PNPLA3 dsRNA reagent to cells, tissues, and / or subjects include: PNPLA3 dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents for the treatment of various diseases and disorders, such as, but not limited to: liver diseases, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. Details of the studies on various delivery modes can be found in publications such as, for example, Nikam, R.R. & K.R. Gore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018; Springer A.D. & S.F. Dowdy (2018) Nucleic Acid Ther. Jun 1; 28(3):109–118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; and Nair, J.K. et al., (2014) J. Am. Chem. Soc.
[0200] 136:16958-16961, the contents of each of which are incorporated herein by reference.
[0201] Some embodiments of the present invention include using lipid nanoparticles (LNPs) to deliver the PNPLA3 dsRNA reagent of the present invention to cells, tissues, and / or subjects. LNPs are commonly used for in vivo delivery of PNPLA3 dsRNA agents, including therapeutic PNPLA3 dsRNA agents. One benefit of using LNPs or other delivery agents is that the stability of the PNPLA3 RNA agent is increased when it is delivered to a subject using LNPs or other delivery agents. In some embodiments of the present invention, the LNP comprises a cationic LNP loaded with one or more PNPLA3 RNAi molecules of the present invention. The LNP containing the PNPLA3 RNAi molecule is administered to a subject, and the LNP and the PNPLA3 RNAi molecule attached thereto are taken up by cells through endocytosis, and their presence results in the release of RNAi trigger molecules that mediate RNAi.
[0202] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the PNPLA3 dsRNA reagent of the present invention to cells, tissues, and / or subjects is a reagent comprising at least one GalNAc targeting ligand that is attached to the PNPLA3 dsRNA reagent of the present invention and delivers the PNPLA3 dsRNA reagent to cells, tissues, and / or subjects. Examples of certain additional delivery agents comprising GalNAc that can be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT application: WO2020191183A1 (the entire content of which is incorporated herein). Non-limiting examples of GalNAc targeting ligands that can be used in the compositions and methods of the present invention to deliver the PNPLA3 dsRNA reagent to cells are targeting ligand clusters. Examples of the targeting ligand clusters proposed herein are referred to as: GalNAc ligands with phosphodiester linkages (GLO) and GalNAc ligands with phosphorothioate linkages (GLS). The term "GLX-n" may be used herein to indicate that the attached GalNAc-containing compound is any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structures of each of which are shown below, wherein the position of attachment of the GalNAc targeting ligand to the RNAi agent of the present invention is located at the rightmost side of each (indicated by (shown). It should be understood that any RNAi and dsRNA molecules of the present invention can be attached to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The structures of GLO-1 to GLO-16 and GLS-1 to GLS-16 are shown below.
[0203]
[0204]
[0205]
[0206]
[0207] In certain embodiments, the foregoing isomannoside nucleotides may also be conjugated to one or more GalNAc targeting ligands. Specific examples of isomannose nucleotides conjugated to GalNAc targeting ligands include, but are not limited to:
[0208]
[0209] wherein each phrase "Olig" independently represents a polynucleotide moiety.
[0210] In some embodiments of the present invention, in vivo delivery can also be through a β-glucan delivery system, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781, which are hereby incorporated by reference in their entirety. PNPLA3 RNAi agents can also be introduced into cells in vitro using methods known in the art such as electroporation and lipofection. In certain embodiments of the methods of the present invention, PNPLA3 dsRNA is delivered without a targeting agent. These RNAs can be delivered as "naked" RNA molecules. As a non-limiting example, the PNPLA3 dsRNA of the present invention can be administered to a subject in a pharmaceutical composition containing an RNAi agent but not a targeting agent (such as a GalNAc targeting compound) to treat a PNPLA3-related disease or disorder in the subject, such as liver disease.
[0211] In addition to certain delivery means described herein, it is understood that RNAi delivery means (such as but not limited to those described herein and those used in the art) can be used in combination with the PNPLA3 RNAi agents and embodiments of the treatment methods described herein.
[0212] The PNPLA3 dsRNA agents of the present invention can be administered to a subject in an amount and manner effective to reduce the level and activity of PNPLA3 polypeptide in cells and / or the subject. In some embodiments of the methods of the present invention, one or more PNPLA3 dsRNA agents are administered to cells and / or the subject to treat a disease or disorder associated with PNPLA3 expression and activity. In some embodiments, the methods of the present invention include administering one or more PNPLA3 dsRNA agents to a subject in need of such treatment to reduce a disease or disorder associated with PNPLA3 expression in the subject. The PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents of the present invention can be administered to reduce PNPLA3 expression and / or activity in one or more of cells in vitro, ex vivo, and in vivo.
[0213] In some embodiments of the present invention, the level of PNPLA3 polypeptide in a cell is reduced, and thus its activity is reduced, by delivering (such as introducing) a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent into the cell. Targeting agents and methods can be used to assist in delivering a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent to a specific cell type, cell subtype, organ, spatial region in a subject, and / or subcellular region in a cell. The PNPLA3 dsRNA agents can be administered alone or in combination with one or more additional PNPLA3 dsRNA agents in certain methods of the present invention. In some embodiments, 2, 3, 4, or more independently selected PNPLA3 dsRNA agents are administered to a subject.
[0214] In certain embodiments of the present invention, a PNPLA3 dsRNA agent is administered to a subject in combination with one or more additional treatment regimens for treating a PNPLA3-related disease or disorder to treat the PNPLA3-related disease or disorder. Some non-limiting examples of additional treatment regimens are: administering one or more PNPLA3 antisense polynucleotides of the present invention, administering a non-PNPLA3 dsRNA therapeutic agent, and behavior modification. The additional treatment regimen can be administered at one or more of the following times: before, concurrently with, and after administering the PNPLA3 dsRNA agent of the present invention. It should be understood that concurrently herein means within five minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero, where "time zero" is the time at which the PNPLA3 dsRNA agent of the present invention is administered to the subject. Non-limiting examples of non-PNPLA3 dsRNA therapeutic agents are: HMG-CoA reductase inhibitors, fibrates, bile acid sequestrants, niacin, antiplatelet agents, angiotensin converting enzyme inhibitors, angiotensin II receptor antagonists, acyl-CoA cholesterol acyltransferase (ACAT) inhibitors, cholesterol absorption inhibitors, cholesteryl ester transfer protein (CETP) inhibitors, microsomal triglyceride transfer protein (MTTP) inhibitors, cholesterol regulators, bile acid regulators, peroxisome proliferator-activated receptor (PPAR) agonists, gene-based therapies, complex vasoprotective agents, glycoprotein IIb / IIIa inhibitors, aspirin or aspirin-like compounds, IBAT inhibitors, squalene synthase inhibitors, monocyte chemoattractant protein (MCP)-I inhibitors, or fish oil; therapeutic agents capable of reducing PNPLA3 levels and / or accumulation in a subject. Non-limiting examples of behavior modification are: diet regimens, counseling, and exercise regimens. These and other therapeutic agents and behavior modifications are known in the art and are used to treat PNPLA3 diseases or disorders in a subject, and can be administered to a subject in combination with the administration of one or more PNPLA3 dsRNA reagents of the present invention to treat a PNPLA3 disease or condition. The PNPLA3 dsRNA reagent of the present invention administered to a cell or subject to treat a PNPLA3-related disease or disorder can act synergistically with one or more other therapeutic agents or activities and increase the effectiveness of said one or more therapeutic agents or activities and / or increase the effectiveness of the PNPLA3 dsRNA reagent in treating a PNPLA3-related disease or disorder.
[0215] The therapeutic methods of the present invention, including administering PNPLA3 dsRNA agents, can be used before the onset of PNPLA3-related diseases or disorders and / or when PNPLA3-related diseases or disorders are present, including in the early, middle, and late stages of the disease or disorder, and at all times before and after any of these. The methods of the present invention can also be used to treat subjects who have previously been treated for PNPLA3-related diseases or disorders with one or more other therapeutic agents and / or therapeutic activities, where the other therapeutic agents and / or therapeutic activities have been unsuccessful, minimally successful, and / or are no longer successful in treating the PNPLA3-related diseases or disorders in the subjects.
[0216] vector-encoded dsRNA
[0217] In certain embodiments of the present invention, vectors can be used to deliver PNPLA3 dsRNA agents into cells. The PNPLA3 dsRNA agent transcription unit can be included in DNA or RNA vectors. The preparation and use of such vectors encoding transgenes for delivering sequences into cells and / or subjects are well known in the art. The vectors can be used in the methods of the present invention, which result in transient expression of PNPLA3 dsRNA for, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of transient expression can be determined using conventional methods based on elements such as, but not limited to, the specific vector construct selected and the target cells and / or tissues. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrating or non-integrating vectors. Transgenes can also be constructed to allow them to be inherited as episomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
[0218] Individual strands or multiple strands of the PNPLA3 dsRNA agent can be transcribed from a promoter on an expression vector. In cases where two separate strands are to be expressed to produce, for example, dsRNA, two separate expression vectors can be co-introduced into cells using means such as transfection or infection. In certain embodiments, each individual strand of the PNPLA3 dsRNA agent of the present invention can be transcribed by two promoters contained on the same expression vector. In certain embodiments of the present invention, the PNPLA3 dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence such that the PNPLA3 dsRNA agent has a stem-and-loop structure.
[0219] Some non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. Expression vectors useful in the embodiments of the present invention are compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from many commercial sources. Delivery of the PNPLA3 dsRNA expression vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells explanted from a subject followed by reintroduction into the subject, or by any other means that allows introduction into the desired target cells.
[0220] Viral vector systems that can be included in embodiments of the method include, but are not limited to: (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated viral vectors; (d) herpes simplex viral vectors; (e) SV 40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) picornavirus vectors; (i) poxvirus vectors, such as smallpox, such as vaccinia virus vectors or avipox, such as canarypox or fowlpox; and (j) helper-dependent or gutless adenoviruses. Constructs for recombinant expression of PNPLA3 dsRNA agents can contain regulatory elements, such as promoters, enhancers, etc., which can be selected to provide constitutive or regulated / inducible expression. The use of promoters and enhancers, etc., and viral vector systems are routine in the art and can be used in conjunction with the methods and compositions described herein.
[0221] Certain embodiments of the present invention include the use of viral vectors for delivering PNPLA3 dsRNA agents into cells. Many adenovirus-based delivery systems are routinely used in the art for delivery to, for example, the lung, liver, central nervous system, endothelial cells, and muscle. Some non-limiting examples of viral vectors useful in the methods of the present invention are: AAV vectors, poxviruses such as vaccinia virus, Modified Virus Ankara (MVA), NYVAC, avipox such as fowlpox or canarypox.
[0222] Certain embodiments of the invention include methods of using a vector to deliver a PNPLA3 dsRNA agent into cells, and such a vector can be in a pharmaceutically acceptable carrier, which may or may not contain a slow-release matrix in which a gene delivery vehicle is embedded. In some embodiments, the vector for delivering PNPLA3 dsRNA can be produced by recombinant cells, and the pharmaceutical compositions of the present invention can contain one or more cells that produce the PNPLA3 dsRNA delivery system.
[0223] Pharmaceutical compositions containing PNPLA3 dsRNA or ssRNA agents
[0224] Certain embodiments of the invention include the use of a pharmaceutical composition comprising a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent and a pharmaceutically acceptable carrier. A pharmaceutical composition comprising a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent can be used in the methods of the invention to reduce PNPLA3 gene expression and PNPLA3 activity in cells and can be used to treat PNPLA3-related diseases or disorders. Such pharmaceutical compositions can be formulated according to the mode of delivery. Non-limiting examples of formulations for the mode of delivery are: compositions formulated for subcutaneous delivery, compositions formulated for systemic administration by parenteral delivery, compositions formulated for intravenous (IV) delivery, compositions formulated for intrathecal delivery, compositions formulated for direct delivery to the brain, and the like. The pharmaceutical compositions of the invention can be administered using one or more means to deliver the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent into cells, such means including, for example, topically (e.g., via a transdermal patch), pulmonary, e.g., by inhalation or insufflation of a powder or an aerosol, including via a nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous injection, e.g., via an implant device; or intracranial, e.g., by intracerebral, intrathecal or intraventricular administration. The PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent can also be directly delivered to a target tissue, e.g., directly to the liver, directly to the kidney, and the like. It should be understood that "delivering a PNPLA3 dsRNA agent" or "delivering a PNPLA3" "antisense polynucleotide agent" refers to directly delivering a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent, respectively, and expressing a PNPLA3 dsRNA agent from a coding vector delivered into a cell, or by any suitable means that results in the presence of a PNPLA3 dsRNA or a PNPLA3 antisense polynucleotide agent in a cell. The preparation and use of formulations and means for delivering inhibitory RNAs are well known and commonly used in the art.
[0225] As used herein, "pharmaceutical composition" includes a pharmacologically effective amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. This term specifically excludes cell culture media. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, and lubricants are typically magnesium stearate, stearic acid, or talc if present. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The agents included in the pharmaceutical formulations are further described below.
[0226] As used herein, terms such as "pharmacologically effective amount", "therapeutically effective amount", and "effective amount" refer to the amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent of the present invention that produces the desired pharmacological, therapeutic, or prophylactic result. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or disorder is reduced by at least 10%, the therapeutically effective amount of a drug for treating that disease or disorder is the amount that must reduce that parameter by at least 10%. For example, a therapeutically effective amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent may reduce the level of PNPLA3 polypeptide by at least 10%.
[0227] Effective amount
[0228] In some aspects, the methods of the invention include contacting a cell with an effective amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent to reduce PNPLA3 gene expression in the contacted cell. Certain embodiments of the methods of the invention include administering to a subject an effective amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent to reduce PNPLA3 gene expression and treat a PNPLA3-related disease or disorder in the subject. An "effective amount" for reducing PNPLA3 expression and / or for treating a PNPLA3-related disease or disorder is an amount necessary or sufficient to achieve the desired biological effect. For example, an effective amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent for treating a PNPLA3-related disease or disorder can be an amount necessary to (i) slow or stop the progression of the disease or disorder; or (ii) reverse, mitigate, or eliminate one or more symptoms of the disease or disorder. In some aspects of the invention, an effective amount is an amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent that results in a therapeutic response for preventing and / or treating a disease or disorder when administered to a subject in need of treatment for a PNPLA3-related disease or disorder. According to some aspects of the invention, an effective amount is an amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent of the invention that results in a therapeutic response for preventing and / or treating a disease or disorder when combined or co-administered with another therapeutic treatment for a PNPLA3-related disease or disorder. In some embodiments of the invention, the biological effect of treating a subject with a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent of the invention can be to improve and / or completely eliminate symptoms caused by a PNPLA3-related disease or disorder. In some embodiments of the invention, the biological effect is to completely eliminate a PNPLA3-related disease or disorder, as evidenced, for example, by a diagnostic test indicating that the subject does not have a PNPLA3-related disease or disorder. A non-limiting example of a detectable physiological symptom includes a decrease in lipid accumulation in the liver of a subject after administration of the agent of the invention. Additional means known in the art for assessing the status of a PNPLA3-related disease or disorder can be used to determine the effect of the agent and / or method of the invention on a PNPLA3-related disease or disorder.
[0229] An effective amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent for reducing PNPLA3 polypeptide activity to a level for treating PNPLA3-related diseases or disorders will be determined in clinical trials to establish an effective dose in a test population relative to a control population in a blinded study. In some embodiments, the effective amount will be the amount that results in a desired response, e.g., the amount that reduces a PNPLA3-related disease or disorder in cells, tissues, and / or a subject having the disease or disorder. Thus, an effective amount of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent for treating a PNPLA3-related disease or disorder that can be treated by reducing PNPLA3 polypeptide activity can be an amount that, when administered, reduces the amount of PNPLA3 polypeptide activity in a subject to an amount less than the amount present in cells, tissues, and / or a subject in the absence of administration of the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent. In certain aspects of the invention, the level of PNPLA3 polypeptide activity and / or PNPLA3 gene expression present in cells, tissues, and / or a subject that has not been exposed to or administered the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent of the invention is referred to as the "control" amount. In some embodiments of the methods of the invention, the control amount for a subject is the pre-treatment amount for the subject; in other words, the level in the subject prior to administration of the PNPLA3 agent can be the control level for that subject and is compared to the level of PNPLA3 polypeptide activity and / or PNPLA3 gene expression in the subject after administration of the siRNA to the subject. In the case of treating a PNPLA3-related disease or disorder, the desired response can be the alleviation or elimination of one or more symptoms of the disease or disorder in cells, tissues, and / or a subject. The reduction or elimination can be temporary or can be permanent. It is understood that methods for determining PNPLA3 polypeptide activity, PNPLA3 gene expression, symptom assessment, clinical testing, etc. can be used to monitor the status of a PNPLA3-related disease or disorder. In some aspects of the invention, the desired response to treating a PNPLA3-related disease or disorder delays the onset of the disease or disorder or even prevents the onset of the disease or disorder.
[0230] An effective amount of a compound that reduces the activity of a PNPLA3 polypeptide can also be determined by assessing the physiological effects of the administration of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent on a cell or a subject, such as a reduction of a PNPLA3-related disease or disorder after administration. Determination and / or symptom monitoring of a subject can be used to determine the efficacy of a PNPLA3 dsRNA reagent or a PNPLA3 antisense polynucleotide agent of the present invention that can be administered in a pharmaceutical compound of the present invention and to determine whether there is a response to treatment. Non-limiting examples are one or more tests known in the art of alanine transaminase (ALT) or aspartate transaminase (AST) profiles. Another non-limiting example is that one or more liver function tests known in the art can be used to determine the status of a PNPLA3-related liver disease or disorder in a subject before and after treatment of the subject with a PNPLA3 dsRNA reagent of the present invention.
[0231] Some embodiments of the present invention include methods for determining the efficacy of a dsRNA reagent or a PNPLA3 antisense polynucleotide agent of the present invention administered to a subject for treating a PNPLA3-related disease or disorder by assessing and / or monitoring one or more "physiological characteristics" of a PNPLA3-related disease or disorder in the subject. Non-limiting examples of physiological characteristics of a PNPLA3-related disease or disorder are PNPLA3 mRNA levels, PNPLA3 protein levels, or the quantity or degree of amyloid deposition, etc. Standard methods for determining such physiological characteristics are known in the art and include, but are not limited to, blood tests, imaging tests, physical examinations, etc.
[0232] It should be understood that the amount of the PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent administered to a subject can be modified at least in part based on the subject's specific disease and / or condition status and / or the subject's specific physiological characteristics. The amount of treatment can be varied by, for example: increasing or decreasing the amount of the PNPLA3-dsRNA agent or PNPLA3 antisense polynucleotide agent, by changing the composition of the PNPLA3-dsRNA agent or PNPLA3 antisense polynucleotide agent administered separately, by changing the route of administration, changing the time of administration, etc. The effective amount of the PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent will vary with: the specific disorder being treated, the age and physical condition of the subject being treated; the severity of the disorder, the duration of treatment, the nature of concurrent treatments (if any), the specific route of administration, and other factors in the knowledge and expertise of the healthcare practitioner. For example, the effective amount can depend on the desired level of PNPLA3 polypeptide activity and / or PNPLA3 gene expression that effectively treats a PNPLA3-related disease or disorder. One of ordinary skill in the art can empirically determine the effective amount of the specific PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent of the invention for use in the methods of the invention without undue experimentation. In conjunction with the teachings provided herein, by selecting from the various PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents of the invention and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side effects, and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen for effectively treating a specific subject can be planned. As used in the embodiments of the invention, the effective amount of the PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent of the invention can be the amount that produces a desired biological effect in a cell when contacted with the cell.
[0233] It should be recognized that PNPLA3 gene silencing can be determined in any cell expressing PNPLA3 constitutively or by genomic engineering and by any suitable assay. In some embodiments of the invention, by administering the PNPLA3 dsRNA agent of the invention, PNPLA3 gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%. In some embodiments of the invention, by administering the PNPLA3 dsRNA agent of the invention, PNPLA3 gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.
[0234] Dosage
[0235] The PNPLA3 dsRNA agent and the PNPLA3 antisense polynucleotide agent are delivered in a pharmaceutical composition at a dose sufficient to inhibit PNPLA3 gene expression. In certain embodiments of the invention, the dose of the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent is from 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, typically from 1 to 50 mg / kg body weight per day, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, 4 to 15 mg / kg body weight, including the endpoints. For example, the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent can be administered in the following amounts: about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg up to 50 mg / kg.
[0236] A variety of factors can be considered in determining the dosage and delivery time of the PNPLA3 dsRNA agent of the present invention. The absolute amount of the delivered PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent will depend on a variety of factors, including concurrent therapy, number of doses, and individual subject parameters, including age, physical condition, body size, and body weight. These are factors well known to those of ordinary skill in the art and can be addressed by routine experimentation alone. In some embodiments, the maximum dose, i.e., the highest safe dose based on reasonable medical judgment, can be used.
[0237] In some embodiments, the methods of the invention can include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent. In some cases, the pharmaceutical compound (e.g., comprising a PNPLA3 dsRNA agent or comprising a PNPLA3 antisense polynucleotide agent) can be administered to the subject at least daily, every other day, weekly, every other week, monthly, etc. The dose can be administered once or more than once per day, such as 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical compositions of the invention can be administered once daily, or the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent can be administered in two, three or more divided doses at appropriate intervals throughout the day, or even by continuous infusion or delivery. Sustained release formulations. In some embodiments of the methods of the invention, the pharmaceutical compositions of the invention are administered to the subject once or more times daily, once or more times weekly, once or more times monthly, or once or more times annually.
[0238] In some aspects, the methods of the invention include administering to a subject having a PNPLA3-related disease or disorder the pharmaceutical compound alone, in combination with one or more other PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents, and / or in combination with other pharmaceutical therapies or treatment activities or regimens administered. The pharmaceutical compound can be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the methods of the invention can be sterile and contain an amount of the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent that reduces the activity of the PNPLA3 polypeptide to a level sufficient to produce a desired response in a weight or volume unit suitable for administration to the subject. The dose of the pharmaceutical composition comprising the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent that reduces the activity of the PNPLA3 protein administered to the subject can be selected according to different parameters, particularly according to the mode of administration used and the condition of the subject. Other factors include the desired duration of treatment. In the case where the response of the subject is insufficient at the initially administered dose, higher doses (or actually higher doses by a different more local delivery route) can be employed to the extent permitted by the patient's tolerance.
[0239] Treatment
[0240] The methods and PNPLA3 dsRNA agents of the present invention can be used to treat PNPLA3-related diseases and disorders to inhibit PNPLA3 expression, wherein a reduction in the level and / or activity of the PNPLA3 polypeptide is effective in treating the disease or disorder. Examples of diseases and disorders that can be treated with the PNPLA3 dsRNA reagents or PNPLA3 antisense polynucleotide agents of the present invention and the treatment methods of the present invention include, but are not limited to: liver diseases, fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), cirrhosis, hepatic fat accumulation, liver inflammation, hepatocyte necrosis, hepatocellular carcinoma, liver fibrosis, obesity, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, or non-alcoholic fatty liver disease (NAFLD). Such diseases and disorders may be referred to herein as "PNPLA3-related diseases and disorders" and "diseases and disorders caused and / or regulated by PNPLA3".
[0241] In certain aspects of the present invention, the PNPLA3 dsRNA reagents or PNPLA3 antisense polynucleotide agents of the present invention can be administered to a subject at one or more times before or after the diagnosis of a PNPLA3-related disease or disorder. In some aspects of the present invention, the subject is at risk of developing or having a PNPLA3-related disease or disorder. A subject at risk of developing a PNPLA3-related disease or disorder is a subject having an increased likelihood of developing a PNPLA3-related disease or disorder compared to a control risk of developing a PNPLA3-related disease or disorder. In some embodiments of the present invention, the risk level can be statistically significant compared to a control risk level. Subjects at risk can include, for example, subjects who are or will be: subjects with a pre-existing disease and / or genetic abnormality that makes the subject more susceptible to a PNPLA3-related disease or disorder than a control subject without the pre-existing disease or genetic abnormality; subjects with a family and / or personal history of a PNPLA3-related disease or disorder; and subjects who have previously been treated for a PNPLA3-related disease or disorder. It should be understood that the pre-existing disease and / or genetic abnormality that makes the subject more susceptible to a PNPLA3-related disease or disorder can be a disease and / or genetic abnormality that has previously been identified as being associated with a higher likelihood of developing a PNPLA3-related disease or disorder when present.
[0242] It should be understood that a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent can be administered to a subject based on the medical condition of the individual subject. For example, the healthcare provided to the subject can assess the PNPLA3 level measured in a sample obtained from the subject and determine the desirability of reducing the subject's PNPLA3 level by administering a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent of the present invention. In this example, the PNPLA3 level can be considered a physiological characteristic of a PNPLA3-related disorder, even if the subject has not been diagnosed with a PNPLA3-related disease such as the diseases disclosed herein. The healthcare provider can monitor changes in the subject's PNPLA3 level as a measure of the efficacy of the administered PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent of the present invention. In a non-limiting example, a biological sample, such as a liver or serum sample, can be obtained from the subject and the subject's PNPLA3 level can be determined in the sample. A PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent is administered to the subject, and after administration, a liver or serum sample is obtained from the subject and used to determine the lipid level, and the results are compared with the results determined in the pre-administration (previous) sample of the subject. A decrease in the subject's PNPLA3 level in the later sample compared to the pre-administration level indicates the efficacy of the administered PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent in reducing the lipid, liver fat, or liver lipid droplet level in the subject.
[0243] Certain embodiments of the methods of the invention include modulating treatment that comprises administering to a subject a dsRNA agent or a PNPLA3 antisense polynucleotide agent of the invention, at least in part based on an assessment of changes in one or more of the physiological characteristics of a PNPLA3-related disease or disorder in the subject caused by the treatment. For example, in some embodiments of the invention, the effect of the dsRNA reagent or PNPLA3 antisense polynucleotide agent of the invention administered can be determined and used to assist in modulating the amount of the dsRNA reagent or PNPLA3 antisense polynucleotide agent of the invention subsequently administered to the subject. In a non-limiting example, a dsRNA reagent or a PNPLA3 antisense polynucleotide agent of the invention is administered to a subject, the PNPLA3 level of the subject is measured after administration, and at least in part based on the determined level, a higher amount of the dsRNA agent or PNPLA3 antisense polynucleotide agent is determined to be desirable to enhance the physiological effect of the administered agent, such as reducing or further reducing the PNPLA3 level of the subject, to determine the reagent or PNPLA3 antisense polynucleotide reagent needed. In another non-limiting example, a dsRNA reagent or a PNPLA3 antisense polynucleotide agent of the invention is administered to a subject, the PNPLA3 level of the subject is measured after administration and at least in part based on the measured level, a lower amount of the dsRNA reagent or PNPLA3 antisense polynucleotide agent is desired to be administered to the subject.
[0244] Accordingly, some embodiments of the invention include assessing changes in one or more physiological characteristics caused by a subject's prior treatment to adjust the amount of the dsRNA reagent or PNPLA3 antisense polynucleotide agent of the invention subsequently administered to the subject. Some embodiments of the methods of the invention include making 1, 2, 3, 4, 5, 6 or more determinations of the physiological characteristics of a PNPLA3-related disease or disorder to evaluate and / or monitor the efficacy of the administered PNPLA3 dsRNA reagent or the PNPLA3 antisense polynucleotide reagent of the invention, and optionally using the determinations to adjust one or more of the dose, administration regimen and / or frequency of administration of the dsRNA reagent or PNPLA3 antisense polynucleotide agent of the invention to treat a PNPLA3-related disease or disorder in the subject. In some embodiments of the methods of the invention, the desired result of administering an effective amount of the dsRNA reagent or PNPLA3 antisense polynucleotide agent of the invention is a decrease in the PNPLA3 mRNA level, PNPLA3 protein level, fat level and / or lipid droplet level in the liver, or the number or degree of amyloid deposits, etc. in the subject as compared to the determined pre-treatment level or control level in the subject.
[0245] As used herein, the terms "treating", "treated", or "being treated", when used with respect to a PNPLA3-related disease or disorder, can refer to prophylactic treatment that reduces the likelihood of an individual developing a PNPLA3-related disease or disorder, and can also refer to treatment after an individual has developed a PNPLA3-related disease or disorder, such that, compared to an individual who does not receive treatment that reduces the activity of PNPLA3 polypeptide in the individual, the level of the PNPLA3-related disease or disorder is eliminated or reduced, the PNPLA3-related disease or disorder is prevented from becoming more advanced (e.g., more severe), and / or the progression of the PNPLA3-related disease or disorder in the individual is slowed down.
[0246] Certain embodiments of the agents, compositions, and methods of the present invention can be used to inhibit PNPLA3 gene expression. As used herein, the terms "inhibit", "silence", "reduce", "downregulate", and "knock down" that refer to the expression of the PNPLA3 gene mean that, compared to a control level of RNA transcribed from the PNPLA3 gene, the activity level of expressed PNPLA3, or the level of PNPLA3 translated from mRNA, when a cell, cell population, tissue, organ, or subject is contacted (e.g., treated) with a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent of the present invention, the expression of the PNPLA3 gene is reduced as measured by one or more of the following in a cell, cell population, tissue, organ, or subject that transcribes the PNPLA3 gene: the level of RNA transcribed from the gene, the activity level of expressed PNPLA3, and the level of PNPLA3 polypeptide, protein, or protein subunit translated from mRNA. In some embodiments, the control level is the level in a cell, tissue, organ, or subject that has not been contacted (e.g., treated) with a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent.
[0247] Administration method
[0248] A variety of administration routes of the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent can be used in the methods of the present invention. The specific delivery mode selected will depend at least in part on the specific condition being treated and the dose required for therapeutic efficacy. Generally, the methods of the present invention can be implemented using any medically acceptable mode of administration, meaning any mode that produces an effective therapeutic level of the PNPLA3-related disease or disorder without causing clinically unacceptable side effects. In some embodiments of the present invention, the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent can be administered via oral, enteral, mucosal, subcutaneous, and / or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., through a gastrostomy-nasal tube), transdermal, vaginal, rectal, sublingual, and inhalation. The delivery routes of the present invention can include intrathecal, intraventricular, or intracranial. In some embodiments of the present invention, the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent can be placed within a sustained-release matrix and administered by placing the matrix within the subject. In some aspects of the present invention, nanoparticles coated with a delivery agent that targets specific cells or organelles can be used to deliver the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent to subject cells. A variety of delivery modes, methods, and agents are known in the art. Non-limiting examples of delivery methods and delivery agents are also provided elsewhere herein. In some aspects of the present invention, the term "delivery" with respect to the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent can refer to the administration of one or more "naked" PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent sequences to a cell or subject, and in certain aspects of the present invention, "delivery" refers to the administration to a cell or subject by transfection, the delivery of cells containing the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent to a subject, and the delivery of a vector encoding the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent into the subject. Delivery of the PNPLA3 dsRNA agent or the PNPLA3 antisense polynucleotide agent using transfection means can include the administration of a vector to a cell and / or subject.
[0249] In some methods of the invention, one or more PNPLA3 dsRNA reagents or PNPLA3 antisense polynucleotide agents can be administered in a formulation, which can be administered in a pharmaceutically acceptable solution, which typically can contain a pharmaceutically acceptable concentration of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the invention, the PNPLA3 dsRNA reagent or PNPLA3 antisense polynucleotide agent can be formulated with another therapeutic agent for co-administration. According to the methods of the invention, the PNPLA3 dsRNA reagent or PNPLA3 antisense polynucleotide agent can be administered in a pharmaceutical composition. Generally, the pharmaceutical composition comprises the PNPLA3 dsRNA reagent or PNPLA3 antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those of ordinary skill in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient (e.g., the ability of the PNPLA3 dsRNA reagent or PNPLA3 antisense polynucleotide agent to inhibit PNPLA3 gene expression in a cell or subject). A variety of methods for administering and delivering dsRNA reagents or PNPLA3 antisense polynucleotide agents for therapeutic use are known in the art and can be used in the methods of the invention.
[0250] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and others are known to those of skill in the art. Such formulations can routinely contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare their pharmaceutically acceptable salts and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Moreover, pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, or calcium salts.
[0251] Some embodiments of the methods of the present invention include directly administering to a tissue one or more PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents. In some embodiments, the tissue to which the compound is administered is a tissue in which a PNPLA3-related disease or disorder is present or may occur, some non-limiting examples of which are the liver or kidney. Direct tissue administration can be achieved by direct injection or other means. Many orally administered compounds naturally reach and cross the liver and kidney, and some embodiments of the therapeutic methods of the present invention include orally administering to a subject one or more PNPLA3 dsRNA agents. The PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents, alone or in combination with other therapeutic agents, can be administered once, or alternatively they can be administered in multiple doses. If administered multiple times, the PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents can be administered by different routes. For example, but not intended to be limiting, the first (or first few) administrations can be by subcutaneous means, and one or more additional administrations can be oral and / or systemic.
[0252] For some embodiments of the present invention where systemic administration of a PNPLA3 dsRNA agent or a PNPLA3 antisense polynucleotide agent is desired, the PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent can be formulated for parenteral administration by injection (e.g., by bolus or continuous infusion). Preparations for injection can be in unit dosage forms, with or without added preservatives, for example in ampoules or in multi-dose containers. The PNPLA3 dsRNA agent preparation (also referred to as a pharmaceutical composition) can take the form of a suspension, solution or emulsion in an oily or aqueous carrier, and can contain formulating agents such as suspending agents, stabilizers and / or dispersing agents.
[0253] Formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Some examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oil. Intravenous vehicles include fluid and nutrient supplements, electrolyte supplements (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, among others. Lower doses will result from other administration forms, such as intravenous administration. In cases where the response of the subject is insufficient at the initially administered dose, higher doses (or actually higher doses via different, more local delivery routes) may be employed to the extent permitted by patient tolerance. As needed, multiple daily doses may be used to achieve an appropriate systemic or local level of one or more PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents and to achieve an appropriate reduction in PNPLA3 protein activity.
[0254] In other embodiments, the methods of the invention include using a delivery vehicle suitable for implantation into a recipient (such as a subject), such as a biocompatible microparticle, nanoparticle, or implant. Exemplary bioerodible implants useful according to the method are described in PCT Publication No. WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible biodegradable polymer matrix for containing biopolymers.
[0255] Both non-biodegradable and biodegradable polymer matrices can be used in the methods of the invention to deliver one or more PNPLA3 dsRNA reagents or PNPLA3 antisense polynucleotide reagents to a subject. In some embodiments, the matrix can be biodegradable. The matrix polymer can be a natural or synthetic polymer. The polymer can be selected based on the period of release desired, typically on the order of several hours to one year or longer. Generally, a release time of several hours to three to twelve months can be used. The polymer is optionally in the form of a hydrogel, which can absorb up to about 90% of its weight in water and is further optionally crosslinked with polyvalent ions or other polymers.
[0256] In some embodiments of the present invention, biodegradable implants can be used to deliver PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents in a diffusive manner or through degradation of a polymer matrix. Exemplary synthetic polymers for such uses are well known in the art. Biodegradable and non-biodegradable polymers can be used to deliver PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents using methods known in the art. Bioadhesive polymers (e.g., biodegradable hydrogels) (see H.S. Sawhney, C.P. Pathak and J.A. Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference) can also be used to deliver PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents for the treatment of PNPLA3-related diseases or disorders. Other suitable delivery systems can include timed-release, delayed-release or sustained-release delivery systems. Such systems can avoid repeated administration of PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents, increasing convenience for the subject and healthcare professionals. Many types of release delivery systems are available and are known to those of ordinary skill in the art. (See, for example, U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686, the teachings of each of which are incorporated herein by reference). In addition, pump-based hardware delivery systems can be used, some of which are suitable for implantation.
[0257] The use of long-term sustained-release implants can be applicable to prophylactic treatment of subjects and subjects at risk of developing recurrent PNPLA3-related diseases or disorders. As used herein, long-term release means that the implant is constructed and arranged to deliver therapeutic levels of PNPLA3 dsRNA agents or PNPLA3 antisense polynucleotide agents for at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, one year or longer. Long-term sustained-release implants are well known to those of ordinary skill in the art and include some of the release systems described above.
[0258] The PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent can be prepared for storage in the form of a lyophilized preparation or an aqueous solution by mixing a molecule or compound having a desired purity with an optional pharmaceutically acceptable carrier, excipient, or stabilizer [Remington's Pharmaceutical Sciences, 21st Edition, (2006)]. Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient at the dosages and concentrations employed and include buffers, such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as or polyethylene glycol (PEG).
[0259] Cells, Subjects, and Controls
[0260] The methods of the present invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some aspects of the invention, the subject is a human or a vertebrate mammal, including but not limited to dogs, cats, horses, cows, goats, mice, rats, and primates, such as monkeys. Accordingly, the present invention can be used to treat PNPLA3-related diseases or disorders in human and non-human subjects. In some aspects of the invention, the subject can be a farm animal, a zoo animal, a domesticated animal, or a non-domesticated animal, and the methods of the invention can be used in veterinary prophylactic and therapeutic regimens. In some embodiments of the invention, the subject is human and the methods of the invention can be used in human prophylactic and therapeutic regimens.
[0261] Some non-limiting examples of subjects to which the present invention can be applied are subjects diagnosed with, suspected of having, or at risk of having a disease or disorder associated with elevated PNPLA3 expression and / or activity (also referred to as "elevated PNPLA3 expression level"). Some non-limiting examples of diseases and disorders associated with elevated levels of PNPLA3 expression and / or activity are described elsewhere herein. The methods of the present invention can be applied to subjects who have been diagnosed at the time of treatment with a disease or disorder associated with elevated PNPLA3 expression and / or activity, or subjects who are considered to be at risk of developing a disease or disorder associated with elevated PNPLA3 expression and / or activity. In some aspects of the present invention, the disease or disorder associated with elevated PNPLA3 expression and / or activity level is an acute disease or disorder, and in certain aspects of the present invention, the disease or disorder associated with elevated PNPLA3 expression and / or activity level is a chronic disease or disorder.
[0262] In a non-limiting example, the PNPLA3 dsRNA reagent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of having non-alcoholic steatohepatitis (NASH), which is a disease in which reduced PNPLA3 expression is desired. The methods of the present invention can be applied to subjects who have been diagnosed at the time of treatment with the disease or disorder, or subjects who are considered to be at risk of developing the disease or disorder.
[0263] In another non-limiting example, the PNPLA3 dsRNA reagent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of having non-alcoholic fatty liver disease, which is a disease in which reduced PNPLA3 expression is desired. The methods of the present invention can be applied to subjects who have been diagnosed at the time of treatment with the disease or disorder, or subjects who are considered to be at risk of developing the disease or disorder.
[0264] Cells to which the method of the present invention can be applied include in vitro, in vivo, and ex vivo cells. The cells can be in a subject, in culture, and / or in suspension, or in any other suitable state or condition. Cells to which the method of the present invention can be applied can be liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, renal cells, or other types of vertebrate cells, including human and non-human mammalian cells. In certain aspects of the present invention, the cells to which the method of the present invention can be applied are healthy, normal cells that are not known to be diseased cells. In certain embodiments of the present invention, the cells to which the method and composition of the present invention are applied are liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, and / or renal cells. In certain aspects of the present invention, the control cells are normal cells, but it should be understood that cells suffering from a disease or disorder can also serve as control cells in certain situations, for example, to compare the results of treated cells suffering from a disease or disorder with untreated cells suffering from the same disease or disorder, etc.
[0265] According to the method of the present invention, the level of PNPLA3 polypeptide activity can be determined and compared with a control level of PNPLA3 polypeptide activity. The control can be a predetermined value, which can take various forms. It can be a single cut-off value, for example, a median or an average value. It can be established based on comparison groups, such as a group having a normal level of PNPLA3 polypeptide and / or PNPLA3 polypeptide activity and a group having an elevated level of PNPLA3 polypeptide and / or PNPLA3 polypeptide activity. Another non-limiting example of a comparison group can be a group having one or more symptoms of a PNPLA3-related disease or disorder or being diagnosed with a PNPLA3-related disease or disorder; a group without one or more symptoms of the disease or disorder or not being diagnosed with the disease or disorder; a group of subjects who have been administered the siRNA treatment of the present invention; a group of subjects who have not been administered the siRNA treatment of the present invention. Generally, the control can be based on apparently healthy normal individuals or apparently healthy cells in an appropriate age range. It should be understood that the control according to the present invention can also be a sample of a material tested in parallel with the experimental material in addition to the predetermined value. Examples include samples from a control population or control samples produced by manufacturing to be tested in parallel with the experimental samples. In some embodiments of the present invention, the control can include cells or subjects not contacted or treated with the PNPLA3 dsRNA agent of the present invention, and in such cases, the control level of PNPLA3 polypeptide and / or PNPLA3 polypeptide activity can be compared with the level of PNPLA3 polypeptide and / or PNPLA3 polypeptide activity in cells or subjects contacted with the PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent of the present invention.
[0266] In some embodiments of the present invention, the PNPLA3 polypeptide level determined for a subject can be a control level for PNPLA3 polypeptide levels determined at different times for the same subject being compared. In a non-limiting example, the PNPLA3 level is assayed in a biological sample obtained from a subject who has not yet received the PNPLA3 treatment of the present invention. In some embodiments, the biological sample is a serum sample. The level of PNPLA3 polypeptide determined in a sample obtained from a subject can be used as a baseline or control value for the subject. In the treatment methods of the present invention, after administering to the subject one or more PNPLA3 dsRNA agents, one or more additional serum samples can be obtained from the subject, and the level of PNPLA3 polypeptide in the subsequent one or more samples can be compared to the control / baseline level of the subject. Such comparison can be used to evaluate the onset, progression, or regression of a PNPLA3-related disease or disorder in the subject. For example, a higher level of PNPLA3 polypeptide in a baseline sample obtained from a subject than the level obtained from the same subject after administering the PNPLA3 dsRNA agent or PNPLA3 antisense polynucleotide agent of the present invention indicates regression of the PNPLA3-related disease or disorder and indicates the efficacy of the administered PNPLA3 dsRNA agent of the present invention for treating the PNPLA3-related disease or disorder.
[0267] In some aspects of the present invention, one or more values of the level of PNPLA3 polypeptide and / or PNPLA3 polypeptide activity determined for a subject can be used as a control value for later comparison of the level of PNPLA3 polypeptide and / or PNPLA3 activity in the same subject, thus allowing evaluation of changes in the "baseline" PNPLA3 polypeptide activity in the subject. Thus, an initial PNPLA3 polypeptide level and / or an initial PNPLA3 polypeptide activity level can be present in and / or determined in a subject, and the methods and compounds of the present invention can be used to reduce the level of PNPLA3 polypeptide and / or PNPLA3 polypeptide activity in the subject, where the initial level is used as the control level for the subject.
[0268] Using the method of the present invention, the PNPLA3 dsRNA reagent and / or PNPLA3 antisense polynucleotide agent of the present invention can be administered to a subject. When the level of PNPLA3 polypeptide in a serum sample obtained from a subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-administration level of PNPLA3 polypeptide in a serum sample obtained from the subject at a previous time point or compared to a non-exposed control level (e.g., the level of PNPLA3 polypeptide in a control serum sample), the efficacy of the administration and treatment of the present invention can be evaluated. It should be understood that both the PNPLA3 polypeptide level and the PNPLA3 polypeptide activity level are related to the PNPLA3 gene expression level. Certain embodiments of the method of the present invention include administering to a subject an amount of the PNPLA3 dsRNA and / or PNPLA3 antisense agent of the present invention that effectively inhibits PNPLA3 gene expression, and thereby reducing the PNPLA3 polypeptide level and reducing the PNPLA3 polypeptide activity level in the subject.
[0269] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of PNPLA3 polypeptide in one or more biological samples obtained from one or more subjects. This determination can be used to evaluate the efficacy of the treatment method of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of PNPLA3 polypeptide in a biological sample obtained from a subject previously treated with the PNPLA3 dsRNA reagent and / or PNPLA3 antisense agent of the present invention. A PNPLA3 polypeptide level determined in a serum sample obtained from a treated subject that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more lower compared to the pre-treatment level of PNPLA3 polypeptide determined for the subject or compared to the level of an unexposed control biological sample indicates the level of efficacy of the treatment administered to the subject.
[0270] In some embodiments of the invention, the physiological characteristics of a PNPLA3-related disease or disorder determined for a subject can be determined relative to a control of physiological characteristics determined for the same subject at different times. In a non-limiting example, physiological characteristics determined in a biological sample (e.g., a liver or serum sample) obtained from a subject who has never been administered a PNPLA3 treatment of the invention include, for example, PNPLA3 mRNA levels, PNPLA3 protein levels, or the quantity or extent of amyloid deposits. The PNPLA3 mRNA level (and / or other physiological characteristics of the PNPLA3 disease or disorder) determined in a sample obtained from a subject can serve as a baseline or control value for the subject. After administering a PNPLA3 dsRNA reagent to the subject one or more times in the treatment method of the invention, one or more additional liver or serum samples can be obtained from the subject, and the PNPLA3 mRNA level and / or PNPLA3 protein level in the subsequent samples can be measured and / or the samples can be compared to the control / baseline levels and / or ratios of the subject. Such comparisons can be used to evaluate the onset, progression, or regression of a PNPLA3-related disease or disorder in the subject. For example, a higher PNPLA3 mRNA level in a baseline sample obtained from a subject after administering a PNPLA3 dsRNA reagent or a PNPLA3 antisense polynucleotide agent of the invention than the PNPLA3 mRNA level measured in a sample obtained from the same subject indicates a regression of the PNPLA3-related disease or disorder and indicates the efficacy of the administered PNPLA3 dsRNA reagent of the invention for treating the PNPLA3-related disease or disorder.
[0271] In some aspects of the invention, the value of one or more physiological characteristics of a PNPLA3-related disease or disorder determined for a subject can serve as a control value for later comparison of the physiological characteristics of the same subject, thereby allowing evaluation of changes from the subject's "baseline" physiological characteristics. Thus, an initial physiological characteristic can be present and / or determined in a subject, and the methods and compounds of the invention can be used to reduce the PNPLA3 polypeptide level and / or PNPLA3 polypeptide activity in the subject, wherein the initial physiological characteristic determination serves as a control for the subject.
[0272] Using the method of the present invention, the PNPLA3 dsRNA reagent and / or PNPLA3 antisense polynucleotide agent of the present invention can be administered to a subject in an effective amount to treat a PNPLA3 disease or disorder. The efficacy of the administration and treatment of the present invention can be evaluated by measuring changes in one or more physiological characteristics of the PNPLA3 disease or disorder. In non-limiting examples, the PNPLA3 mRNA level in a serum sample obtained from a subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-administration lipid in a serum sample obtained from the subject at a previous time point, or compared to a non-contact control level (e.g., the PNPLA3 mRNA level in a control serum sample). It should be understood that the PNPLA3 mRNA level, PNPLA3 protein level, or the quantity or degree of amyloid deposition in a subject is each related to the PNPLA3 gene expression level. Certain embodiments of the method of the present invention include administering to a subject an effective amount of the PNPLA3 dsRNA and / or PNPLA3 antisense agent of the present invention to inhibit the gene expression of PNPLA3, thereby reducing the PNPLA3 mRNA level, PNPLA3 protein level, or the quantity or degree of amyloid deposition in the subject, or otherwise positively affecting the physiological characteristics of a PNPLA3-related disease or disorder in the subject.
[0273] Some embodiments of the present invention include using methods such as, but not limited to, the following to determine the presence, absence, and / or change in the physiological characteristics of a PNPLA3-related disease or disorder: (1) evaluating the physiological characteristics of one or more biological samples obtained from one or more subjects; (2) imaging the subject (e.g., but not limited to obtaining liver imaging); and (3) performing a physical examination of the subject. This determination can be used to evaluate the efficacy of the treatment method of the present invention.
[0274] Kit
[0275] It comprises one or more PNPLA3 dsRNA agents and / or PNPLA3 antisense polynucleotide agents and instructions for their use in the methods of the present invention. The kits of the present invention may comprise one or more of a PNPLA3 dsRNA agent, a PNPLA3 sense polynucleotide, and a PNPLA3 antisense polynucleotide agent that can be used to treat PNPLA3-related diseases or disorders. Kits comprising one or more of a PNPLA3 dsRNA agent, a PNPLA3 sense polynucleotide, and a PNPLA3 antisense polynucleotide agent can be prepared for the treatment methods of the present invention. The components of the kits of the present invention can be packaged in an aqueous medium or in a lyophilized form. The kits of the present invention may comprise a carrier that is partitioned into one or more container devices or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, etc., that are hermetically enclosed. The first container device or series of container devices may comprise one or more compounds, such as a PNPLA3 dsRNA agent and / or a PNPLA3 sense or antisense polynucleotide agent. The second container device or series of container devices may comprise targeting agents, labeling agents, delivery agents, etc., which in one embodiment of the treatment methods of the present invention may be included as part of the PNPLA3 dsRNA agent and / or PNPLA3 antisense polynucleotide to be administered.
[0276] The kits of the present invention may further include instructions. The instructions are typically in written form and will provide guidance for performing the treatment embodied by the kit and for making decisions based on that treatment.
[0277] The following examples are provided to illustrate specific examples of the practice of the present invention and are not intended to limit the scope of the present invention. It will be apparent to those of ordinary skill in the art that the present invention can be applied to a variety of compositions and methods. Specific embodiments
[0279] Example 1. Preparation of Intermediate A and Intermediate B.
[0280] As shown in Scheme 1 below, Intermediate A was synthesized by treating commercially available galactosamine pentaacetate with trimethylsilyl trifluoromethanesulfonate (TMSOTf) in dichloromethane (DCM). Subsequently, glycosylation was carried out with Cbz-protected 2-(2-aminoethoxy)ethanol to obtain Compound II. The Cbz protecting group was removed by hydrogenation to obtain Intermediate A as the trifluoroacetic acid (TFA) salt. Intermediate B was synthesized based on the same scheme except that Cbz-protected 2-(2-(2-aminoethoxy)ethoxy)ethanol was used as the starting material.
[0281]
[0282] Scheme 1
[0283] To a solution of Compound I (20.0 g, 51.4 mmol) in 100 mL of 1,2-dichloroethane (DCE) was added TMSOTf (17.1 g, 77.2 mmol). The resulting reaction solution was stirred at 60 °C for 2 h and then at 25 °C for 1 h. The Cbz-protected 2-(2-aminoethoxy)ethan-1-ol (13.5 g, 56.5 mmol) in DCE (100 mL) dried over powdered molecular sieve (10 g) was added dropwise to the above reaction solution at 0 °C under a N2 atmosphere. The resulting reaction mixture was stirred at 25 °C for 16 h under a N2 atmosphere. The reaction mixture was filtered and washed with saturated NaHCO3 (200 mL), water (200 mL), and saturated brine (200 mL). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain a crude product, which was triturated with 2-methyltetrahydrofuran / heptane (5 / 3, v / v, 1.80 L) for 2 h. The resulting mixture was filtered and dried to obtain Compound II (15.0 g, 50.3% yield) as a white solid. 10% Pd / C (1.50 g) was carefully added to a dried and argon-purged hydrogenation flask, followed by 10 mL of tetrahydrofuran (THF), and then a solution of Compound II (15.0 g, 26.4 mmol) in THF (300 mL) and TFA (trifluoroacetic acid, 3.00 g, 26.4 mmol). The resulting mixture was degassed and purged with H2 three times and stirred at 25 °C for 3 h under a H2 (45 psi) atmosphere. Thin-layer chromatography (TLC, solvent: DCM:MeOH = 10:1) indicated that Compound II had been completely consumed. The reaction mixture was filtered and concentrated under reduced pressure. The residue was dissolved in anhydrous DCM (500 mL) and concentrated. This process was repeated 3 times to obtain Intermediate A (14.0 g, 96.5% yield) as a foamy white solid.
[0284] To a dried and argon-purged hydrogenation flask was carefully added 10% Pd / C (1.50 g), followed by 10 mL of tetrahydrofuran (THF), and then a solution of Compound II (15.0 g, 26.4 mmol) in THF (300 mL) and TFA (trifluoroacetic acid, 3.00 g, 26.4 mmol). The resulting mixture was degassed and purged with H2 three times and stirred at 25 °C for 3 h under a H2 (45 psi) atmosphere. Thin-layer chromatography (TLC, solvent: DCM:MeOH = 10:1) indicated that Compound II had been completely consumed. The reaction mixture was filtered and concentrated under reduced pressure. The residue was dissolved in anhydrous DCM (500 mL) and concentrated. This process was repeated 3 times to obtain Intermediate A (14.0 g, 96.5% yield) as a foamy white solid. 11H NMR (400 MHz, DMSO-d6): δ ppm 7.90 (d, J = 9.29 Hz, 1H), 7.78 (br s, 3H), 5.23 (d, J = 3.26 Hz, 1H), 4.98 (dd, J = 11.29, 3.26 Hz, 1H), 4.56 (d, J = 8.53 Hz, 1H), 3.98 - 4.07 (m, 3H), 3.79 - 3.93 (m, 2H), 3.55 - 3.66 (m, 5H), 2.98 (br d, J = 4.77 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.90 (s, 3H), 1.76 (s, 3H).
[0285] Intermediate B was synthesized using a procedure similar to that used for the synthesis of Intermediate A. 1 1H NMR (400 MHz, DMSO-d6): δ ppm 7.90 (br d, J = 9.03 Hz, 4H), 5.21 (d, J = 3.51 Hz, 1H), 4.97 (dd, J = 11.1 Hz, 1H), 4.54 (d, J = 8.53 Hz, 1H), 3.98 - 4.06 (m, 3H), 3.88 (dt, J = 10.9 Hz, 1H), 3.76 - 3.83 (m, 1H), 3.49 - 3.61 (m, 9H), 2.97 (br s, 2H), 2.10 (s, 3H), 1.99 (s, 3H), 1.88 (s, 3H), 1.78 (s, 3H). Mass calc. for C 20 H 34 N2O 11 : 478.22; found: 479.3 (M + H + )
[0286] Example 2. Synthesis of GalNAc ligand clusters phosphoramidites GLPA1, GLPA2, and GLPA15.
[0287] GLPA1 and GLPA2 were prepared according to Scheme 2 below. Starting from benzyl-protected propane-1,3-diamine, it was alkylated with tert-butyl 2-bromoacetate to obtain the triester compound I. The benzyl protecting group was removed by hydrogenation to obtain the secondary amine compound II. The amide was coupled with 6-hydroxyhexanoic acid to obtain compound III. Then the tert-butyl protecting group was removed after treatment with HCl in dioxane to yield the triacid compound IV. Amide coupling between the triacid compound IV and Intermediate A or Intermediate B was carried out to obtain compound Va or Vb. The phosphoramidites GLPA1 or GLPA2 were synthesized by phosphorylating compound Va or Vb with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and a catalytic amount of 1H-tetrazole.
[0288]
[0289] Scheme 2
[0290] To a solution of N-benzyl-1,3-propanediamine (5.00 g, 30.4 mmol) in dimethylformamide (DMF, 100 mL) was added tert-butyl 2-bromoacetate (23.7 g, 121 mmol), followed by dropwise addition of diisopropylethylamine (DIEA, 23.61 g, 182 mmol). The resulting reaction mixture was stirred at 25 °C to 30 °C for 16 h. LCMS showed that N-benzyl-1,3-propanediamine had been completely consumed. The reaction mixture was diluted with H2O (500 mL) and extracted with EtOAc (500 mL × 2). The combined organic layers were washed with saturated brine (1 L), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give a crude product, which was purified by silica gel column chromatography (gradient: petroleum ether:ethyl acetate from 20:1 to 5:1). Compound I (12.1 g, 78.4% yield) was obtained as a colorless oil. 1 1H NMR (400 MHz, CDCl3): δ ppm 7.26 - 7.40 (m, 5H), 3.79 (s, 2H), 3.43 (s, 4H), 3.21 (s, 2H), 2.72 (dt, J = 16.9, 7.34 Hz, 4H), 1.70 (quin, J = 7.2 Hz, 2H), 1.44 - 1.50 (m, 27H).
[0291] The dried hydrogenation flask was purged with argon three times. Pd / C (200 mg, 10%) was added, followed by MeOH (5 mL), and then a solution of Compound I (1.00 g, 1.97 mmol) in MeOH (5 mL) was added. The reaction mixture was degassed under vacuum and refilled with H2. This process was repeated three times. The mixture was stirred at 25 °C under a H2 (15 psi) atmosphere for 12 h. LCMS showed that Compound I had been completely consumed. The reaction mixture was filtered under reduced pressure under a N2 atmosphere. The filtrate was concentrated under reduced pressure to give Compound II (655 mg, 79.7% yield) as a yellow oil, which was used in the next step without further purification. 1 1H NMR (400 MHz, CDCl3): δ ppm 3.44 (s, 4H), 3.31 (s, 2H), 2.78 (t, J = 7.1 Hz, 2H), 2.68 (t, J = 6.9 Hz, 2H), 1.88 (br s, 1H), 1.69 (quin, J = 7.03 Hz, 2H), 1.44 - 1.50 (s, 27H).
[0292] A mixture of compound II (655 mg, 1.57 mmol), 6-hydroxyhexanoic acid (249 mg, 1.89 mmol), DIEA (1.02 g, 7.86 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI, 904 mg, 4.72 mmol) and 1-hydroxybenzotriazole (HOBt, 637 mg, 4.72 mmol) in DMF (6 mL) was degassed and purged with N2 three times, and then stirred at 25 °C for 3 h under a N2 atmosphere. LCMS indicated the desired product. The reaction mixture was diluted with H2O (10 mL) and extracted with EtOAc 20 mL (10 mL×2). The organic layers were combined, washed with saturated brine (20 mL), dried over anhydrous Na2SO4, filtered, and concentrated to give a crude product, which was purified by silica gel column chromatography (gradient: petroleum ether:ethyl acetate from 5:1 to 1:1) to give compound III (650 mg, 77.8% yield) as a yellow oil. 1 H NMR (400 MHz, CDCl3): δ ppm 3.90 - 3.95 (s, 2H), 3.63 (t, J = 6.40 Hz, 2H), 3.38 - 3.45 (m, 6H), 2.72 (t, J = 6.65 Hz, 2H), 2.40 (t, J = 7.28 Hz, 2H), 1.55 - 1.75 (m, 8H), 1.44 (s, 27H). C 27 H 50 Calculated for C28H52N2O8: 530.36; Found: 531.3 (M + H + ).
[0293] A mixture of compound III (5.5 g, 10.3 mmol) in HCl / dioxane (2 M, 55 mL) was stirred at 25 °C for 3 h. LCMS showed complete consumption of compound III. The reaction mixture was filtered, washed with EtOAc (50 mL), and dried under reduced pressure to give a crude product. It was dissolved in CH3CN (50 mL), and the volatiles were removed under vacuum. This process was repeated three times to give compound IV (2.05 g, 54.5% yield) as a white solid. 11H NMR (400 MHz, D2O): δ ppm 4.21 (s, 1H), 4.07 (d, J = 4.5 Hz, 4H), 3.99 (s, 1H), 3.45 - 3.52 (m, 3H), 3.42 (t, J = 6.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 3.24 - 3.31 (m, 1H), 2.37 (t, J = 7.4 Hz, 1H), 2.24 (t, J = 7.4 Hz, 1H), 1.99 (dt, J = 15.5, 7.53 Hz, 1H), 1.85 - 1.94 (m, 1H), 1.85 - 1.94 (m, 1H), 1.39 - 1.56 (m, 4H), 1.19 - 1.31 (m, 2H).
[0294] A mixture of compound IV (500 mg, 1.05 mmol), intermediate A (2.02 g, 3.67 mmol), DIEA (813 mg, 6.30 mmol), EDCI (704 mg, 3.67 mmol) and HOBt (496 mg, 3.67 mmol) in DMF (10 mL) was degassed and purged with N2 three times, and then the mixture was stirred at 25 °C for 3 h under a N2 atmosphere. LCMS indicated the desired product. The reaction mixture was quenched by the addition of H2O (10 mL) and extracted with DCM (10 mL × 2). The combined organic layers were extracted with 10% citric acid (20 mL). The aqueous phase was neutralized with saturated NaHCO3 solution and re-extracted with DCM (10 mL × 2). The organic layer was dried over sodium sulfate, filtered and concentrated under reduced pressure to give compound Va (570 mg, 0.281 mmol, 26.8% yield) as a white solid. 1 1H NMR: (400 MHz, CDCl3) ppm δ 7.84 - 8.12 (m, 3H), 6.85 - 7.15 (m, 2H), 6.66 - 6.81 (m, 1H), 5.36 (br d, J = 2.7 Hz, 3H), 5.11 - 5.27 (m, 3H), 4.63 - 4.85 (m, 3H), 3.90 - 4.25 (m, 18H), 3.37 - 3.75 (m, 28H), 3.15 - 3.28 (m, 4H), 2.64 (br d, J = 6.53 Hz, 2H), 2.30 - 2.46 (m, 2H), 2.13 - 2.18 (m, 9H), 2.05 (s, 9H), 1.94 - 2.03 (m, 18H), 1.68 (br s, 2H), 1.45 (br s, 2H), 1.12 (br t, J = 7.0 Hz, 2H).
[0295] At ambient temperature and under N2, diisopropylammonium tetrazolide (30.3 mg, 0.177 mmol) was added to a solution of compound Va (260 mg, 0.161 mmol) in anhydrous DCM (5 mL), followed by the dropwise addition of 3-bis(diisopropylamino)phosphoryloxypropionitrile (194 mg, 0.645 mmol). The reaction mixture was stirred at 20 °C to 25 °C for 2 h. LCMS indicated that compound Va had been completely consumed. After cooling to -20 °C, the reaction mixture was added to stirred brine / saturated aqueous NaHCO3 (1:1, 5 mL) at 0 °C. After stirring for 1 min, DCM (5 mL) was added. The layers were separated. The organic layer was washed with brine / saturated aqueous NaHCO3 (1:1, 5 mL), dried over Na2SO4, filtered and concentrated to a volume of approximately 1 mL. The residue solution was added dropwise to 20 mL of methyl tert-butyl ether (MTBE) with stirring. This resulted in the precipitation of a white solid. The mixture was centrifuged and the solid was collected. The solid was redissolved in 1 mL of DCM and precipitated by the addition of MTBE (20 mL). The solid was separated again by centrifugation. The collected solid was dissolved in anhydrous CH3CN. The volatiles were removed. The process was repeated two more times to afford the GalNAc ligand phosphoramidite compound GLPA1 (153 mg, 84.4 μmol) as a white solid. 1 1H NMR (400 MHz, CDCl3): ppm δ 7.71 - 8.06 (m, 2H), 6.60 - 7.06 (m, 3H), 5.37 (br d, J = 3.0 Hz, 3H), 5.18 - 5.32 (m, 3H), 4.70 - 4.86 (m, 3H), 3.92 - 4.25 (m, 18H), 3.42 - 3.85 (m, 30H), 3.25 (m, 4H), 2.59 - 2.75 (m, 4H), 2.27 - 2.44 (m, 2H), 2.15 - 2.20 (s, 9H) 2.07 (s, 9H), 1.96 - 2.03 (m, 18H), 1.65 (br s, 4H), 1.44 (br d, J = 7.28 Hz, 2H), 1.14 - 1.24 (m, 12H). 31 31P NMR (CDCl3): ppm δ 147.15.
[0296] The GalNAc ligand phosphoramidite compound GLPA2 was synthesized using the same procedure except that intermediate B was used. 11H NMR (400 MHz, CDCl3): δ ppm 7.94 - 8.18 (m, 1H), 7.69 (br s, 1H), 6.66 - 7.10 (m, 3H), 5.35 (d, J = 3.5 Hz, 3H), 5.07 - 5.25 (m, 3H), 4.76 - 4.86 (m, 3H), 4.01 - 4.31 (m, 10H), 3.91 - 4.01 (m, 8H), 3.74 - 3.86 (m, 4H), 3.52 - 3.71 (m, 30H), 3.42 - 3.50 (m, 6H), 3.15 - 3.25 (m, 4H), 2.52 - 2.70 (m, 4H), 2.22 - 2.45 (m, 2H), 2.15 - 2.22 (s, 9H), 2.06 (s, 9H), 1.95 - 2.03 (m, 18H), 1.77 (br s, 2H), 1.58 - 1.66 (m, 4H), 1.40 (m, 2H), 1.08 - 1.24 (m, 12H). 31 31P NMR (CDCl3): δ ppm 147.12.
[0297] GLPA15 was prepared according to the following Scheme 3:
[0298]
[0299] Scheme 3
[0300] Starting from the secondary amine compound I (compound II in Scheme 2), Cbz protection was introduced to obtain compound II. The tert-butyl group of compound II was removed by treatment with an acid to obtain the triacid compound III. Compound III was subjected to amide coupling with intermediate A to obtain compound IV. The Cbz protecting group of compound IV was removed by hydrogenation to obtain the secondary amine compound V, which reacted with glutaric anhydride to obtain the carboxyl compound VI. Compound VI reacted with piperidin-4-ol under amide coupling reaction conditions to obtain compound VII. The phosphoramidite compound GLPA15 was synthesized by treating compound VII with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and a catalytic amount of 1H-tetrazole.
[0301] 11H NMR (400 MHz in DMSO-d6): δ ppm 8.05 (br d, J = 6.50 Hz, 2H), 7.81 (br d, J = 9.01 Hz, 3H), 5.22 (d, J = 3.25 Hz, 3H), 4.98 (dd, J = 11.26, 3.25 Hz, 3H), 4.55 (br d, J = 8.50 Hz, 3H), 4.03 (s, 9H), 3.64 - 3.97 (m, 12H), 3.55 - 3.63 (m, 6H), 3.50 (br s, 5H), 3.40 (br d, J = 6.13 Hz, 6H), 3.17 - 3.30 (m, 9H), 3.07 (br d, J = 14.26 Hz, 4H), 2.76 (t, J = 5.82 Hz, 2H), 2.18 - 2.47 (m, 6H), 2.10 (s, 9H), 1.99 (s, 9H), 1.89 (s, 9H), 1.78 (s, 9H), 1.52 - 1.74 (m, 6H), 1.12 - 1.19 (m, 12H). 31P NMR (DMSO-d6): ppm δ 145.25。
[0302] In some studies, methods for linking a targeting group comprising GalNAc (also referred to herein as a GalNAc delivery compound) to the 5'-end of the sense strand include using GalNAc phosphoramidite (GLPA1) in the final coupling step of solid-phase synthesis during a synthetic process, such as the process used if oligonucleotide chain growth for adding nucleotides to the 5'-end of the sense strand is carried out.
[0303] In some studies, methods for linking a targeting group comprising GalNAc to the 3'-end of the sense strand include using a solid support (CPG) comprising GLO-n. In some studies, methods for linking a targeting group comprising GalNAc to the 3'-end of the sense strand include linking the GalNAc targeting group to the CPG solid support via an ester bond and using the resulting CPG with the linked GalNAc targeting group during the synthesis of the sense strand, which results in the GalNAc targeting group being linked to the 3'-end of the sense strand.
[0304] Example 3. Phosphoramidite Compound 2
[0305]
[0306] Scheme 4
[0307] 4,4'-Dimethoxytrityl chloride (DMTrCl, 232 g, 684 mmol, 1.0 eq) in pyridine (400 mL) was added to a solution of compound A (isomannitol, 100 g, 684 mmol, 1.0 eq) in pyridine (600 mL). The mixture was stirred at 25 °C for 16 h. LC-MS showed that compound A was completely consumed and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL), extracted with dichloromethane (500 mL × 2), and the combined organic phases were washed with brine (500 mL), dried over Na2SO4 and concentrated in vacuo to give a residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to afford a yellow solid of compound B (150 g, yield 48.9%).
[0308] 1 H NMR: EC4783 - 404 - P1B1_C (400 MHz, DMSO - d6) δ ppm 7.46 (br d, J = 7.63 Hz, 2H) 7.28 - 7.37 (m, 6H) 7.19 - 7.25 (m, 1H) 6.90 (br d, J = 7.88 Hz, 4H) 4.70 (d, J = 6.50 Hz, 1H) 3.99 - 4.09 (m, 6H) 3.88 - 3.96 (m, 2H) 3.83 (br dd, J = 7.82, 6.94 Hz, 1H) 3.74 (s, 6H) 3.41 (br t, J = 8.13 Hz, 1H) 3.05 (t, J = 8.44 Hz, 1H) 2.85 (br t, J = 7.50 Hz, 1H).
[0309] Under N2 atmospheric pressure, to a solution of compound B (80.0 g, 178 mmol, 1.0 equiv) in dichloromethane (5.0 mL) at 25 °C, 2H-tetrazole (0.45 M, 436 mL, 1.1 equiv) was added dropwise, and then a solution of compound C (2-cyanoethyl diisopropyl chlorophosphoramidite, 80.6 g, 267 mmol, 85.0 mL, 1.5 equiv) in dichloromethane (200 mL) was added dropwise; the reaction mixture was stirred at 25 °C for 1.0 h; LC-MS showed that compound B was completely consumed and a main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20 °C and poured into ice-cold sat; NaHCO3 (500 mL), extracted with dichloromethane (500 mL * 3), the combined organic layers were washed with NaHCO3 / brine = 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated in vacuo (35 °C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give isomannitol phosphoramidite compound 2 (77 g, 119 mmol, 66.5% yield) as a white solid.
[0310] 1 H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J = 7.50 Hz, 2H)
[0311] 7.05 - 7.14 (m, 6H) 6.96 - 7.02 (m, 1H) 6.67 (br dd, J = 8.82, 1.81 Hz, 4H) 3.95 - 4.07 (m, 2H) 3.73 - 3.83 (m, 1H) 3.62 - 3.72 (m, 2H) 3.48 - 3.53 (m, 6H) 3.27 - 3.37 (m, 3H) 3.11 (s, 6H) 2.82 (td, J = 8.54, 2.31 Hz, 1H) 2.47 - 2.63 (m, 3H) 2.28 (br d, J = 1.63 Hz, 3H) 0.82 - 1.00 (m, 13H).
[0312] Phosphoramidite compound 1:
[0313]
[0314] Scheme 5
[0315] Under N2 atmosphere at 0 - 5 °C, compound D (607 mg, 3.34 mmol, 3.0 equiv) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 equiv) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 equiv) in DCM (5.0 mL). The mixture was stirred at 25 °C for 1.0 h. LC-MS showed complete consumption of compound B, several new peaks were shown on LC-MS, and about 70.9% of the desired compound was detected. The resulting reaction mixture was cooled to -20 °C and poured into a cold (0 - 5 °C) saturated NaHCO3 (5.0 mL) solution, extracted with DCM (5.0 mL * 2), and the combined organic layers were washed with cold (0 - 5 °C) saturated NaHCO3 / brine = 1:1 (5.0 mL / 5.0 mL). Dried over Na2SO4 and concentrated in vacuo to obtain a residue (about 5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N ) to give compound 1 as a white solid (280 mg, 471 μmol, 42.3% yield).
[0316] 1 1H NMR: EC10615 - 49 - P1N (400 MHz, DMSO - d6) δ ppm 7.44 (br d, J = 7.63 Hz, 2H), 7.31 (br t, J = 7.94 Hz, 6H), 7.18 - 7.26 (m, 1H), 6.89 (br d, J = 8.00 Hz, 4H), 4.08 - 4.13 (m, 1H), 3.95 - 4.03 (m, 1H), 3.84 - 3.93 (m, 1H), 3.77 - 3.83 (m, 1H), 3.74 (s, 6H), 3.43 - 3.53 (m, 3H), 3.38 (br d, J = 6.75 Hz, 1H), 2.94 - 3.04 (m, 1H), 2.70 - 2.85 (m, 1H), 1.09 - 1.15 (m, 12H), 1.07 (br s, 3H).
[0317] Other phosphoramidites can be prepared according to the procedures described herein and / or the prior art, for example but not limited to, US426,220 and WO02 / 36743.
[0318] Example 4. Preparation of a solid support comprising the phosphoramidite monomer of the present invention
[0319]
[0320] representing the macroporous amine - methylated polyethylene resin support moiety
[0321] Solution 6
[0322] Place a 50L glass kettle under nitrogen protection, add dichloromethane (19.50kg) to the glass kettle, and start stirring. Control the temperature at 20-30℃, add DMTr-imann (1.47kg) to the glass kettle, add triethylamine (1.50kg), 4-dimethylaminopyridine (0.164kg) to the reactor, and add succinic anhydride (1.34kg). Keep the system warm at 20-30℃ for 18h, then take a sample and end the reaction. Add saturated sodium bicarbonate solution (22.50kg) to the reaction system, stir for 10-20min, and then stand until stratification, transfer the lower organic phase to, extract the upper aqueous phase twice with dichloromethane, combine the organic phases, dry with anhydrous sodium sulfate, filter the filtrate, and then transfer to rotary evaporation to concentrate until there is no fraction, forming 1.83kg of gray solid to off-white solid.
[0323] Add N,N-dimethylformamide (23.50kg) to a 100L glass kettle and start stirring. Control the temperature at 20-30°C, under nitrogen protection, add the product of the previous step, O-benzotriazole-tetramethyluronium hexafluorophosphate (0.33kg), and N,N-diisopropylethylamine (0.13kg) to the above 100L glass kettle through a solid addition funnel. After adding, stir for 10-30 minutes and then release to a 50L galvanized bucket for standby. Add macroporous amine methyl resin (3.25kg) (purchased from Tianjin Nankai Hecheng Technology Co., Ltd., batch number HA2X1209, loading amount 0.48mmol / g) to the above 100L solid phase synthesis kettle through a solid addition funnel, control the temperature at 20-30°C, add N,N-dimethylformamide (21.00kg+21.00kg) to the solid phase synthesis kettle, and the reaction solution in the previous galvanized bucket for standby. The system was kept warm for reaction, and the solid loading was tracked until it was ≥250umol / g. The loading detection method was UV. The system was filtered with nitrogen, and the filter cake was rinsed three times with N,N-dimethylformamide (26.00kg+26.10kg+26.00kg), and the filter cake was left in the kettle. CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40kg+4.42kg+4.30kg) and CAP.B (20% pyridine and 30% N-methylimidazole and 50% acetonitrile, 4.40kg+4.40kg+4.47kg) were added to the 80L glass kettle, and stirred for 3-8 minutes and then set aside. This operation was repeated 3 times to cap the mixture, and acetonitrile (18.00kg+18.00kg+18.00kg+17.50kg+17.50kg) was added to the solid phase synthesis reactor, and nitrogen was bubbled for 10 to 30 minutes before filter pressing. This operation was repeated four times, and the filter cake was transferred to a 50L filter press tank after nitrogen was purged in the solid phase synthesis reactor for 2 to 4 hours, and the temperature was controlled at 15 to 30°C, and the drying was continued. The yellow to white solid product after drying weighed 3.516kg.
[0324] Example 5. Synthesis of PNPLA3 RNAi agent.
[0325] The PNPLA3 RNAi reagent duplexes shown in Table 2-3 above were synthesized according to the following general procedure:
[0326] The sense and antisense strand sequences of the siRNA were synthesized on an oligonucleotide synthesizer using a well-established solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain growth was achieved through a 4-step cycle: deprotection, condensation, capping, and an oxidation or sulfurization step for adding each nucleotide. The synthesis was carried out on a solid support made of controlled pore glass (CPG, ). Monomer phosphoramidites could be purchased from commercial sources or could be the phosphoramidite compounds in Example 3 and WO2016 / 028649. The phosphoramidite compounds herein could be linked to the 3'-end as monomer phosphoramidites and further linked to the CPG solid support. In the case of 5'-end attachment, the phosphoramidite compounds could be used for the final coupling reaction and could be further conjugated to the target ligand if needed.
[0327] Phosphoramidites with GalNAc ligand clusters (GLPA1, GLPA2, and GLPA15 as non-limiting examples) were synthesized according to the procedures of Examples 1-2 herein. For siRNAs used for in vitro screening (Table 2), the synthesis was carried out on a 2 μmol scale, and for siRNAs used for in vivo testing (Table 3), the synthesis was carried out on a 5 μmol or larger scale. In the case where the GalNAc ligand (GLO-0 as a non-limiting example) was linked to the 3'-end of the sense strand, a GalNAc ligand-linked CPG solid support was used. When the GalNAc ligand (GLS-5 or GLS-15 as non-limiting examples) was linked to the 5'-end of the sense strand, GalNAc phosphoramidites (GLPA1, GLPA2, or GLPA15 as non-limiting examples) were used for the final coupling reaction.
[0328] The sense and antisense strands were synthesized by a 4-step cycle solid-phase synthesis method, and the detailed steps are as follows: A 3% dichloromethane solution of trichloroacetic acid (TCA) or a 10% toluene solution of dichloroacetic acid (DCA) was used for the deprotection of the 4,4'-dimethoxytrityl protecting group (DMT). 5-Ethylthio-1H-tetrazole was used as an activator in the coupling step. Capping was carried out with capping agent A (acetonitrile solution of acetic anhydride) / capping agent B (pyridine / NMI / acetonitrile solution) (v / v, 1:1). A Py / H2O solution of I2 and a pyridine / MeCN solution of phenylacetyl disulfide (PADS) or a pyridine solution of dihydroxanthine (DDTT) were used for the oxidation reaction and the sulfurization reaction, respectively.
[0329] After the final solid-phase synthesis step, the solid support-bound oligomers are cleaved and the protecting groups are removed by treatment with a 1:1 volume of 40 wt.% aqueous methylamine and 28% ammonium hydroxide solution. The solid support-bound oligomers containing phosphonate mimics are treated with MeCN:TMSI:pyridine = 50:2:2 (v / v / v) if necessary before cleavage and protection. To synthesize siRNA for in vitro screening, the crude mixture is concentrated. The remaining solid is dissolved in 1.0 M NaOAc and ice-cold EtOH is added to precipitate the single-stranded product as the sodium salt, which can be used for annealing without further purification. To synthesize siRNA for in vivo testing, the crude single-stranded product is further purified by ion pairing reversed phase HPLC (IP-RP-HPLC). The purified single-stranded oligonucleotide product from IP-RP-HPLC is converted to the sodium salt by dissolving in 1.0 M NaOAc and precipitated by adding ice-cold EtOH. Annealing of equimolar complementary sense and antisense strand oligonucleotides is carried out in water to form the double-stranded siRNA product, which is lyophilized to give a fluffy white solid.
[0330] Example 6. In Vitro Screening of PNPLA3 siRNA Duplexes
[0331] Hep3B cells are trypsinized and adjusted to an appropriate density, and then seeded into 96-well plates. According to the manufacturer's recommendations, at the time of seeding, the test siRNA or control siRNA is transfected into the cells using Lipofectamine RNAiMax (Invitrogen - 13778 - 150). The siRNA is tested in triplicate at two concentrations (0.2 nM and 1.0 nM).
[0332] Day 0, psiCHECK(TM)-2 vector transfection (one plate)
[0333] (1) Transfer 2.5 μg of psiCHECK(TM)-2 vector plasmid to a RNase-free Eppendorf tube (solution mix #1)
[0334] (2) Add trypsin-dissociated Hep3B cells to one flask, count the cells using a Vi-Cell counter, and adjust the cell density to 1*10^5 / ml
[0335] (3) Transfer 7.5 μL of Fugene-HD to the solution mix #1 tube and mix well.
[0336] (4) Add the solution from step 3 to the cell suspension, mix well, and aliquot the suspension into 96-well plates (100 μl / well)
[0337] Day 1, siRNA transfection
[0338] (1) Dilute RNAiMAX reagent with Opti- MEM medium.
[0339] (2) Dilute siRNA with RNA-free water to make a 12× stock solution.
[0340] (3) Mix equal volumes of diluted RNAiMax and siRNA. Incubate the mixture at RT for 15 minutes to form a complex.
[0341] (4) Add 45 μl / well of the compound RNAiMAX (Opti-MEM) mixture to 225 μl / well of fresh DMEM medium, discard the supernatant in the assay plate, and add 120 μl / well of the compound mixture to a 96-well plate.
[0342] (5) The no-compound control wells are defined as cells transfected with the psiCHECK TM-2 vector and not treated with siRNA; the blank control is the well with only cells.
[0343] Day 2, Dual- luciferase assay
[0344] (1) Add the reagent to the assay plate and wait for 10 minutes to allow cell lysis.
[0345] (2) Transfer 100 μl of cell lysate to the plate and then measure firefly luminescence.
[0346] (3) Add 50 μl of Dual- Stop& Reagent to the assay plate and mix, wait for 10 minutes, and then measure Renilla luminescence.
[0347] (4) Calculate the relative expression
[0348] Data analysis
[0349] Sample well ratio = (Renilla luminescence of sample - background blank) / (Firefly luminescence of sample - background blank)
[0350] No-compound control well ratio = (Renilla luminescence of control - background blank) / (Firefly luminescence of control - background blank)
[0351] % Inhibition rate = 100 - (Ratio of sample wells / Average ratio of wells without compound control) × 100%
[0352] Table 4 provides the experimental results of in vitro studies using various PNPLA3 RNAi reagents to inhibit PNPLA3 expression. The duplex sequences used correspond to the sequences shown in Table 2.
[0353]
[0354]
[0355]
[0356] Table 5 provides the experimental results of in vitro studies using various PNPLA3 RNAi reagents to inhibit PNPLA3 expression. The duplex sequences used correspond to the sequences shown in Table 2.
[0357]
[0358] Example 7. In Vivo Testing of PNPLA3 siRNA Duplexes
[0359] Seven days before siRNA administration, female C57BL / 6J mice (4 per group) were infected by intravenous injection of an adeno-associated virus 8 (AAV8) vector solution encoding the human PNPLA3 and luciferase genes. On day 1, the mice were subcutaneously injected with a single dose of 6 mg / kg of the PNPLA3 siRNA reagent or PBS. Blood samples were collected on day 1, before siRNA administration, and on days 15, 22, and / or 29 (final). Plasma samples were isolated and luciferase activity was measured according to the protocol recommended by the manufacturer. Since the expression level of human PNPLA3 is correlated with the expression level of luciferase, the percentage of remaining PNPLA3 was calculated as the ratio of luciferase signals between the plasma samples after dosing and before dosing in the siRNA treatment group, and normalized according to the ratio of luciferase signals between the blood samples after and before dosing in the saline administration group. The siRNA duplexes with the modification patterns described in the present invention tested achieved significant knockdown of PNPLA3 mRNA and showed a longer duration of activity.
[0360] Table 6 provides the experimental results of in vivo studies using various PNPLA3 RNAi reagents to inhibit PNPLA3 expression. The duplex sequences used correspond to the sequences shown in Table 3.
[0361]
[0362] Table 7 provides the experimental results of in vivo studies using various PNPLA3 RNAi agents to inhibit PNPLA3 expression. The duplex sequences used correspond to the sequences shown in Table 3.
[0363]
[0364] Table 8 provides the experimental results of in vivo studies using various PNPLA3 RNAi agents to inhibit PNPLA3 expression.
[0365] The duplex sequences used correspond to the sequences shown in Table 3.
[0366]
[0367] Table 9 provides the experimental results of in vivo studies using various PNPLA3 RNAi agents to inhibit PNPLA3 expression. The duplex sequences used correspond to the sequences shown in Table 3.
[0368]
[0369] Example 8 In Vivo Testing of PNPLA3 siRNA Agents in Cynomolgus Monkeys
[0370] Eighteen healthy adult male cynomolgus monkeys (2 - 6 years old) were recruited and randomly divided into 6 groups (3 monkeys per group). Each animal received a single subcutaneous injection of saline or the test article at 4 mg / kg on Day 0, and liver biopsy samples were collected on Day 0 (before dosing), Day 21, and Day 42. The PNPLA3 mRNA levels in liver tissues were measured by QPCR method. The remaining gene amounts of PNPLA3 mRNA (normalized to the pre - dosing level on Day 0) for each group are listed in Table 10.
[0371] Data Analysis:
[0372] ΔCT = average Ct of target gene – average Ct of GAPDH
[0373] ΔΔCT = ΔCT (sample) – ΔCT (before dosing);
[0374] mRNA relative expression = 2 -ΔΔCT
[0375] Table 10 provides the experimental results of in vivo studies using different PNPLA3 RNAi agents to inhibit PNPLA3 expression. The duplex sequences used correspond to the sequences listed in Table 3.
[0376]
[0377]
[0378] Equivalent solutions
[0379] Although several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily conceive of many other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each such variation and / or modification is considered to be within the scope of the present invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and the actual parameters, dimensions, materials, and / or configurations will depend on one or more specific applications of the teachings of the present invention. Those skilled in the art will recognize or be able to determine using only routine experimentation many equivalents to the specific embodiments of the invention described herein. Accordingly, it is to be understood that the foregoing embodiments are presented by way of example only, and that within the scope of the appended claims and their equivalents, the invention may be practiced otherwise than as specifically described and claimed. The present invention relates to each and every separate feature, system, article, material, and / or method described herein. Additionally, any combination of two or more such features, systems, articles, materials, and / or methods, if such features, systems, articles, materials, and / or methods are not mutually inconsistent, is included within the scope of the present invention.
[0380] All definitions defined and used herein should be understood to be prior to dictionary definitions, definitions in documents incorporated by reference, and / or the ordinary meaning of the defined terms.
[0381] Unless explicitly stated to the contrary, a noun without an article modifier as used herein in the specification and claims should be understood to mean "at least one".
[0382] The phrase "and / or" as used herein in the specification and claims should be understood to mean "one or both" of the elements so conjoined, i.e., the elements exist jointly in some cases and separately in others. Unless explicitly stated to the contrary, other elements may optionally exist in addition to the elements specifically identified by the "and / or" phrase, whether related or unrelated to those specifically identified.
[0383] All references, patents, patent applications, and publications cited or referenced in this application are hereby incorporated herein by reference in their entirety.
Claims
1. A double-stranded ribonucleic acid (dsRNA) reagent for inhibiting the expression of patatin-like phospholipase domain-containing protein 3 (PNPLA3), wherein the dsRNA reagent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:2 by no more than 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially or completely complementary, and optionally comprise a targeting ligand.
2. A double-stranded ribonucleic acid (dsRNA) reagent for inhibiting the expression of patatin-like phospholipase domain-containing protein 3 (PNPLA3), wherein the dsRNA reagent comprises a sense strand and an antisense strand, and the nucleotide positions 2 to 18 in the antisense strand comprise a region complementary to the PNPLA3 RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides that differ from one of the antisense sequences listed in Table 1-3 by 0, 1, 2 or 3 nucleotides, and optionally comprises a targeting ligand.
3. The dsRNA reagent according to claim 1 or 2, wherein the region complementary to the PNPLA3 RNA transcript comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides that differ from one of the antisense sequences listed in Table 1-3 by no more than 3 nucleotides.
4. The dsRNA reagent according to any one of claims 1-3, wherein the antisense strand of the dsRNA is at least substantially complementary to any target region of SEQ ID NO:1 and is provided in any one of Table 1-3.
5. The dsRNA reagent according to any one of claims 1-3, wherein the antisense strand of the dsRNA is completely complementary to any target region of SEQ ID NO:1 and is provided in any one of Table 1-3.
6. The dsRNA reagent according to any one of claims 1-5, wherein the dsRNA reagent comprises the sense strand sequence listed in any one of Table 1-3, and the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA reagent.
7. The dsRNA reagent according to any one of claims 1-5, wherein the dsRNA reagent comprises the sense strand sequence listed in any one of Table 1-3, and the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA reagent.
8. The dsRNA reagent according to any one of claims 1-7, wherein the dsRNA reagent comprises the antisense strand sequence listed in any one of Table 1-3.
9. The dsRNA reagent according to any one of claims 1-8, wherein the dsRNA reagent comprises the sequence listed as a duplex sequence in any one of Table 1-3.
10. The dsRNA according to any one of claims 1-9, wherein the dsRNA reagent comprises at least one modified nucleotide.
11. The dsRNA reagent according to any one of claims 1-10, wherein all or substantially all of the nucleotides of the antisense strand are modified nucleotides.
12. The dsRNA reagent of claim 10 or 11, wherein the at least one modified nucleotide comprises: 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2’3’-seco nucleotide mimetic, locked nucleic acid nucleotide, unlocked nucleic acid nucleotide (UNA), glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, reverse nucleotide, reverse abasic nucleotide, reverse 2'-Ome nucleotide, reverse 2'-deoxy nucleotide, isomannose nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide and 3'-OMe nucleotide, nucleotide containing 5'-thiophosphate group, nucleotide containing vinyl phosphonate, or terminal nucleotide linked to cholesterol derivative or didodecylamide group, 2'-amino-modified nucleotide, aminophosphate, or nucleotide containing unnatural base.
13. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of patatin-like phospholipase domain-containing protein 3 (PNPLA3), wherein the dsRNA reagent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding PNPLA3, wherein the length of each strand is about 15 to about 30 nucleotides, and wherein the sense strand sequence is represented by formula (I): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ N8 N′ L N′ L (N′ L ) m′ -3′ (I) Wherein: Each N' F represents a 2'-fluoro-modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 , N' N7 and N' N8 each independently represents a modified or unmodified nucleotide; each N' L independently represents a modified or unmodified nucleotide, but does not represent a 2'-fluoro-modified nucleotide, and m' and n' are each independently integers from 0 to 7.
14. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of patatin-like phospholipase domain-containing protein 3 (PNPLA3), wherein the dsRNA reagent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding PNPLA3, wherein the length of each strand is about 18 to about 30 nucleotides, and wherein the antisense strand sequence is represented by formula (II): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′(II) Wherein: Each N F represents a 2'-fluoro-modified nucleotide; N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 and N M8 each independently represents a modified or unmodified nucleotide, preferably, N M1 ,N M2 ,N M3 ,N M6 and N M7 each independently represents a 2'-fluoro-modified nucleotide; each N L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide, and n is an integer from 0 to 7.
15. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of patatin-like phospholipase domain-containing protein 3 (PNPLA3), wherein the dsRNA reagent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to the mRNA encoding PNPLA3, wherein the complementary region comprises at least 15 consecutive nucleotides, and wherein the dsRNA duplex is represented by formula (III): Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ N8 N′ L N′ L (N′ L ) m′ - Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L - 5′ (III) Wherein: Each N F and N′ F each independently represents a 2'-fluoro-modified nucleotide, N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 ,N M8 ,N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 ,N′ N6 ,N′ N7 and N′ N8 each independently represents a modified or unmodified nucleotide; each N L and N′ L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide, and m′, n′ and n are each independently an integer from 0 to 7.
16. The dsRNA reagent according to any one of claims 1-14, wherein the dsRNA reagent comprises an E-vinyl phosphonate nucleotide at the 5' end of the guide strand.
17. The dsRNA reagent of claim 16, wherein the antisense strand sequence can be represented by formula (II’): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′(II’) Wherein, Each N F represents a 2'-fluoro-modified nucleotide, and each N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 and N M8 each independently represents a modified or unmodified nucleotide. Preferably, each N M1 ,N M2 ,N M3 ,N M6 and N M7 independently represents a 2'-fluoro-modified nucleotide, and each N L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide; N Z represents a nucleotide containing vinyl phosphonate; and n is an integer from 0 to 7.
18. The dsRNA reagent according to claim 16, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to the mRNA encoding PNPLA3, wherein the complementary region comprises at least 15 consecutive nucleotides, and the dsRNA duplex is represented by formula (III’): Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ N8 N′ L N′ L (N′ L ) m′ - Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z - 5′ (III’) wherein: Each N F and N′ F each independently represents a 2'-fluoro-modified nucleotide; each N M1 ,N M2 ,N M3 ,N M4 ,N M5 ,N M6 ,N M7 ,N M8 ,N′ N1 ,N′ N2 ,N′ N3 ,N′ N4 ,N′ N5 ,N′ N6 ,N′ N7 and N′ N8 each independently represents a modified or unmodified nucleotide; each N L and N′ L independently represents a modified or unmodified nucleotide, but not a 2'-fluoro-modified nucleotide; N Z represents a nucleotide containing vinyl phosphonate; and each m′, n′ and n is independently an integer from 0 to 7.
19. The dsRNA reagent according to any one of claims 16-18, wherein N Z is a nucleotide modified with vinyl phosphonate; preferably, N Z is VPu*, and its structure is:
20. The dsRNA reagent according to any one of claims 1-19, wherein the dsRNA reagent comprises at least one phosphorothioate internucleoside linkage.
21. The dsRNA reagent according to any one of claims 1-19, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage.
22. The dsRNA reagent according to any one of claims 1-19, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage.
23. The dsRNA reagent according to any one of claims 20-22, wherein the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages, preferably, the 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages are at the 5'-end, 3'-end or both ends of the sense strand.
24. The dsRNA reagent according to any one of claims 20-22, wherein the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages, preferably, the 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages are at the 5'-end, 3'-end or both ends of the antisense strand.
25. The dsRNA reagent according to any one of claims 1-24, wherein all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides.
26. The dsRNA reagent according to any one of claims 1-25, wherein the modified sense strand is a modified sense strand sequence listed in one of Tables 2-3.
27. The dsRNA reagent according to any one of claims 1-25, wherein the modified antisense strand is a modified antisense strand sequence listed in one of Tables 2-3.
28. The dsRNA reagent according to any one of claims 1-27, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is 16 to 23 nucleotides.
29. The dsRNA reagent according to any one of claims 1-28, wherein the length of the complementary region is 19-21 nucleotides.
30. The dsRNA reagent according to any one of claims 1-29, wherein the length of each strand does not exceed 30 nucleotides.
31. The dsRNA reagent according to any one of claims 1-30, wherein the length of each strand does not exceed 25 nucleotides.
32. The dsRNA reagent according to any one of claims 1-31, wherein the length of each strand does not exceed 23 nucleotides.
33. The dsRNA reagent according to any one of claims 1-32, wherein the dsRNA reagent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.
34. The dsRNA agent according to claim 33, wherein the one or more targeting groups or linking groups are conjugated to the sense strand.
35. The dsRNA agent according to claim 33 or 34, wherein the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc).
36. The dsRNA agent according to any one of claims 33-35, wherein the targeting group has the structure:
37. The dsRNA agent according to any one of claims 1-36, wherein the dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand.
38. The dsRNA agent according to any one of claims 1-36, wherein the dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand.
39. The dsRNA agent according to any one of claims 1-38, wherein the antisense strand comprises a reverse abasic residue at the 3'-end.
40. The dsRNA agent according to any one of claims 1-38, wherein the sense strand comprises one or two reverse abasic residues or one or two imann residues at the 3' and / or 5'-end.
41. The dsRNA agent according to any one of claims 1-40, wherein the dsRNA agent has two blunt ends.
42. The dsRNA agent according to any one of claims 1-40, wherein at least one strand comprises a 3'-overhang of at least 1 nucleotide.
43. The dsRNA agent according to any one of claims 1-40, wherein at least one strand comprises a 3'-overhang of at least 2 nucleotides.
44. A composition comprising the dsRNA agent according to any one of claims 1-43.
45. The composition according to claim 44, further comprising a pharmaceutically acceptable carrier.
46. The composition according to claim 45, further comprising one or more additional therapeutic agents.
47. The composition according to claim 46, wherein the composition is packaged in a kit, container, package, dispenser, pre-filled syringe or vial.
48. The composition according to claim 44, wherein the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.
49. A cell comprising the dsRNA agent according to any one of claims 1-43.
50. The cell according to claim 42, wherein the cell is a mammalian cell, optionally a human cell.
51. A method of inhibiting the expression of the PNPLA3 gene in a cell, the method comprising: (i) preparing a cell comprising an effective amount of the double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-43 or the composition according to any one of claims 44-48.
52. The method according to claim 51, further comprising: (ii) maintaining the cell prepared in claim 51(i) for a time sufficient to obtain degradation of the mRNA transcript of the PNPLA3 gene, thereby inhibiting the expression of the PNPLA3 gene in the cell.
53. The method according to claim 51, wherein the cells are located in a subject and the dsRNA reagent is administered subcutaneously to the subject.
54. The method according to claim 51, wherein the cells are located in a subject and the dsRNA reagent is administered to the subject by IV administration.
55. The method according to claim 53 or 54, further comprising evaluating the inhibition of the PNPLA3 gene after administering the dsRNA reagent to the subject, wherein the means for evaluation comprises: (i) determining one or more physiological characteristics of a PNPLA3-related disease or disorder in the subject, and (ii) comparing the determined physiological characteristics with baseline pre-treatment physiological characteristics of a PNPLA3-related disease or disorder and / or with control physiological characteristics of a PNPLA3-related disease or disorder, wherein the comparison indicates the presence or absence of one or more of the inhibition of PNPLA3 gene expression in the subject.
56. The method according to claim 55, wherein the determined physiological characteristics are one or more of the following: PNPLA3 mRNA level, PNPLA3 protein level, fat level and / or lipid droplet level in the liver, or the number or degree of amyloid deposits in the subject.
57. The method according to claim 56, wherein a decrease in one or more of the PNPLA3 mRNA level of the subject, the PNPLA3 protein level of the subject, the fat level and / or lipid droplet level in the liver, and the number or degree of amyloid deposits in the subject indicates a decrease in PNPLA3 gene expression in the subject.
58. A method for inhibiting PNPLA3 gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) reagent according to any one of claims 1-43 or a composition according to any one of claims 44-48.
59. The method according to claim 58, wherein the dsRNA reagent is administered subcutaneously to the subject.
60. The method according to claim 58, wherein the dsRNA reagent is administered to the subject by IV administration.
61. The method according to any one of claims 58-60, further comprising evaluating the inhibition of the PNPLA3 gene after administering the dsRNA reagent, wherein the means for evaluation comprises: (i) determining one or more physiological characteristics of a PNPLA3-related disease or disorder in the subject, and (ii) comparing the determined physiological characteristics with a pre-treatment physiological characteristic baseline of a PNPLA3-related disease or disorder and / or with a physiological characteristic control of a PNPLA3-related disease or disorder, wherein the comparison indicates the presence or absence of one or more of the inhibition of PNPLA3 gene expression in the subject.
62. The method according to claim 61, wherein the determined physiological characteristics are one or more of the following: PNPLA3 mRNA level, PNPLA3 protein level, fat level and / or lipid droplet level in the liver, or the number or degree of amyloid deposits.
63. The method according to claim 62, wherein a decrease in one or more of the PNPLA3 mRNA level of the subject, the PNPLA3 protein level of the subject, the fat level and / or lipid droplet level in the liver, and / or the number or degree of amyloid deposits in the subject indicates a decrease in PNPLA3 gene expression in the subject.
64. A method of treating a disease or disorder associated with the presence of a PNPLA3 protein, the method comprising administering to a subject an effective amount of the double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-43, or the composition according to any one of claims 44-48, to inhibit PNPLA3 gene expression.
65. The method according to claim 64, wherein the disease or disorder is one or more of the following: liver disease, fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), cirrhosis, fat accumulation in the liver, liver, liver inflammation, hepatocyte necrosis, hepatocellular carcinoma, liver fibrosis, obesity, alcoholic liver disease, HCV hepatitis, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, or non-alcoholic fatty liver disease (NAFLD).
66. The method according to claim 64, further comprising administering to the subject an additional treatment regimen.
67. The method according to claim 66, wherein the additional treatment regimen comprises: Administering to the subject one or more of the PNPLA3 antisense polynucleotides of the present invention, administering to the subject a non-PNPLA3 dsRNA therapeutic agent, and behavioral modification of the subject.
68. The method according to claim 67, wherein the non-PNPLA3 dsRNA therapeutic agent is one or more of the following: HMG-CoA reductase inhibitor, fibrate, bile acid sequestrant, niacin, antiplatelet agent, angiotensin converting enzyme inhibitor, angiotensin II receptor antagonist, acyl-CoA cholesterol acyltransferase (ACAT) inhibitor, cholesterol absorption inhibitor, cholesteryl ester transfer protein (CETP) inhibitor, microsomal triglyceride transfer protein (MTTP) inhibitor, cholesterol regulator, bile acid regulator, peroxisome proliferator-activated receptor (PPAR) agonist, gene-based therapy, complex vascular protectant, glycoprotein IIb / IIIa inhibitor, aspirin or aspirin-like compound, IB AT inhibitor, squalene synthase inhibitor, monocyte chemoattractant protein (MCP)-I inhibitor, or fish oil.
69. The method according to claim 64, wherein the dsRNA reagent is administered subcutaneously to the subject.
70. The method according to claim 64, wherein the dsRNA reagent is administered to the subject by IV administration.
71. The method according to any one of claims 64-70, further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.
72. The method according to claim 71, wherein the method of determining the efficacy of the treatment in the subject comprises: (i) Determine one or more physiological characteristics of a PNPLA3-related disease or disorder in a subject, and (ii) Compare the determined physiological characteristics with the baseline pre-treatment physiological characteristics of the PNPLA3-related disease or disorder, wherein the comparison indicates the presence, absence, and / or level of the efficacy of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject.
73. The method according to claim 72, wherein the determined physiological characteristics are: PNPLA3 mRNA level, PNPLA3 protein level, fat level and / or lipid droplet level in the liver, or the number or degree of amyloid deposition in the subject.
74. The method according to claim 72, wherein a decrease in one or more of the PNPLA3 mRNA level, PNPLA3 protein level, fat level and / or lipid droplet level in the liver, or the number or degree of amyloid deposits in the subject indicates the presence of the efficacy of administering a double-stranded ribonucleic acid (dsRNA) agent to the subject.
75. A method of reducing the PNPLA3 protein level in a subject as compared to the baseline pre-treatment level of the PNPLA3 protein in the subject, the method comprising administering to the subject an effective amount of the double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-43 or the composition according to any one of claims 44-48 for reducing the PNPLA3 gene expression level.
76. The method according to claim 75, wherein the dsRNA reagent is administered subcutaneously to the subject or by intravenous administration to the subject.
77. A method of altering the physiological characteristics of a PNPLA3-related disease or disorder in a subject as compared to the baseline of the pre-treatment physiological characteristics of the PNPLA3-related disease or disorder of the subject, the method comprising administering to the subject an effective amount of the double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-43 or the composition according to any one of claims 44-48 to alter the physiological characteristics of the PNPLA3-related disease or disorder of the subject.
78. The method according to claim 77, wherein the dsRNA reagent is administered subcutaneously to the subject or by intravenous administration to the subject.
79. The method according to claim 77, wherein the physiological characteristics are one or more of the following: PNPLA3 mRNA level, PNPLA3 protein level, fat level and / or lipid droplet level in the liver, or the number or degree of amyloid deposition in the subject.
Citation Information
Patent Citations
Drug delivery product and methods
US20050281781A1
Discharge apparatus
US2151796A
Drug-delivery system
US3854480A
Seal-lock
US426220A
Cholesterol matrix delivery system for sustained release of macromolecules
US4452775A