Cationic lipid nano-particles with repairing and permeation promoting functions as well as preparation method, product and application of cationic lipid nano-particles

Abstract

The invention belongs to the technical field of biological medicines and cosmetics, and particularly relates to a cationic lipid nanoparticle with repairing and permeation promoting functions as well as a preparation method, a product and application of the cationic lipid nanoparticle. The cationic lipid nanoparticles are prepared from the following components in percentage by mass: 5 percent to 40 percent of grease, 0.1 percent to 5 percent of sterol, 0.5 percent to 10 percent of lecithin, 0.05 percent to 0.5 percent of sphingosine, 0.05 percent to 0.5 percent of polyhydroxy acid, 2.5 percent to 20 percent of polyhydric alcohol and the balance of water. The zeta potential absolute value of the cationic lipid nanoparticles is larger than 40, and the cationic lipid nanoparticles are not prone to aggregation and high in stability; the lipid nanoparticles can be used for wrapping fat-soluble active matters, improving the stability of the active matters, promoting the transdermal permeation and absorption of the active matters and increasing the retention amount of the active matters in a skin layer, and have wide application value in cosmetics.

Description

Technical Field

[0001] The present invention belongs to the technical fields of biomedicine and cosmetics, and particularly relates to a cationic lipid nanoparticle with repair and penetration promotion functions, a preparation method thereof, a product, and an application thereof. Background Art

[0002] Nanotechnology has been widely applied in various industries, especially in the cosmetics field. The introduction of nanocarrier technology has brought revolutionary changes to product innovation and efficacy improvement. Research shows that nanocarrier technology can not only significantly enhance the chemical stability of active ingredients, but also effectively promote the transdermal absorption of functional ingredients, thus significantly increasing the retention amount of active ingredients in the local skin. In addition, nanocarrier technology has excellent sustained-release and controlled-release properties, and can form a reservoir effect in skin tissues to continuously and stably release functional ingredients, achieving long-term skin care effects. More importantly, this technology can significantly improve the solubility and aqueous dispersibility of poorly soluble cosmetic functional ingredients, and then optimize the compatibility of functional ingredients, providing new possibilities for the innovation of cosmetic formulations.

[0003] Currently, the nanocarrier technologies widely used in the cosmetics field mainly include nano-liposomes, nano-emulsions, solid lipid nanoparticles, etc. The surface zeta potential of these nanoparticles is usually negative, and the absolute value of most of them is less than 30 mV. Zeta potential is one of the key parameters for evaluating the colloidal stability of nanoparticles. When the absolute value of the Zeta potential of nanoparticles is relatively high, it indicates that there are more charges on the surface, and the particles tend to repel each other, thus maintaining the stability of the whole system; on the contrary, if the absolute value of the Zeta potential is relatively low, the surface charge of the particles is less, and the particles tend to attract each other, resulting in a decrease in the system stability. Therefore, the higher the absolute value of the Zeta potential, the more stable the dispersion system of nanoparticles usually is. In an aqueous phase system, the critical value of the dispersion stability of nanoparticles is usually considered to be +30 mV or -30 mV. If the Zeta potential of nanoparticles in the aqueous phase is higher than +30 mV or lower than -30 mV, the dispersion system is considered to have high stability.

[0004] The outermost layer of human skin is the stratum corneum, which mainly consists of water, proteins (mainly keratin), and lipids. Components such as phospholipids, fatty acids, chondroitin sulfate, hyaluronic acid, and collagen in the stratum corneum endow the skin surface with negative charge characteristics. This negatively charged property is prevalent in human tissues and is closely related to the occurrence and development of various common diseases. However, this negatively charged property also poses significant challenges to targeted drug delivery. Although anionic proteoglycans play a crucial role in maintaining tissue structure and function, they also make the tissue matrix dense and endow the tissue with a high negative charge density, which greatly hinders the penetration of drugs through the deep regions of the tissue and the delivery to resident cells. To address this challenge, the development of a positively charged multi-stage delivery method using electrostatic interactions provides a new solution for overcoming the negatively charged keratin barrier.

[0005] In summary, the research and development of nanocarriers with positively charged surfaces, such as cationic liposomes, cationic polymer nanoparticles, etc., utilize the principle of electrostatic interaction to strongly attract these carriers to the negatively charged skin stratum corneum, thereby enhancing the binding ability of the nanocarriers to the skin surface and improving the efficiency and depth of drug delivery. Summary of the Invention

[0006] Aiming at the above deficiencies, the present invention provides a cationic lipid nanoparticle with an absolute zeta potential value on the surface greater than 40, which realizes strong mutual repulsion between particles, effectively prevents agglomeration, and thus ensures its high stability. They can not only significantly improve the stable state of the active ingredient, but also accelerate the process of the active ingredient being absorbed by the skin by optimizing its transdermal penetration path, and significantly increase the accumulation amount of the active ingredient in each layer of the skin.

[0007] The technical solution of the present invention is as follows: On the one hand, the present invention provides a cationic lipid nanoparticle, which, by mass percentage, comprises 5%-40% oil, 0.1-5% sterol, 0.5%-10% lecithin, 0.05%-0.5% sphingosine, 0.05%-0.5% polyhydroxy acid, 2.5-20% polyol, and the balance is water.

[0008] Specifically, the cationic lipid nanoparticle, by mass percentage, comprises 5%-30% oil, 0.2-5% sterol, 1%-8% lecithin, 0.05%-0.2% sphingosine, 0.05%-0.2% polyhydroxy acid, 3.5-12.5% polyol, and the balance is water.

[0009] Specifically, the oil or fat may be one or more of soybean oil, olive oil, corn germ oil, macadamia nut oil, tomato seed oil, Limnanthes alba seed oil, sunflower oil, camellia oil, caprylic / capric triglyceride, oleic triglyceride, linoleic triglyceride, linolenic triglyceride, lauric triglyceride, coco-caprylate / caprate, jojoba oil, squalene or squalane.

[0010] Preferably, the oil or fat may be one or more of macadamia nut oil, soybean oil, Limnanthes alba seed oil, caprylic / capric triglyceride, coco-caprylate / caprate or squalane.

[0011] Specifically, the sterol may be one or more of phytosterol, stigmasterol, cholesterol, β-sitosterol, sitosterol, campesterol, ergosterol, campesterol or brassicasterol.

[0012] Preferably, the sterol may be one or two of β-sitosterol, phytosterol or cholesterol. Specifically, the lecithin may be one or more of soybean lecithin, egg yolk lecithin, sunflower lecithin, hydrogenated soybean lecithin, hydrogenated egg yolk lecithin or hydrogenated sunflower lecithin.

[0013] Preferably, the mass content of phosphatidylcholine in the lecithin is greater than 45%.

[0014] Preferably, the mass content of phosphatidylcholine in the lecithin is greater than 70%.

[0015] Preferably, the lecithin may be one or two of soybean lecithin or egg yolk lecithin.

[0016] Specifically, the sphingosine may be one or more of phytosphingosine, sphingosine or dihydrosphingosine.

[0017] Preferably, the sphingosine may be one or two of phytosphingosine or sphingosine.

[0018] Specifically, the polyhydroxy acid may be one or more of sialic acid, lactobionic acid, gluconic acid, maltobionic acid or glycolic acid.

[0019] Preferably, the polyhydroxy acid may be one or two of sialic acid or lactobionic acid.

[0020] Specifically, the polyol may be one or more of glycerol, 1,3-propanediol, 1,3-butanediol, 2,3-butanediol, 1,2-pentanediol, 1,2-hexanediol or 1,2-octanediol.

[0021] Preferably, the polyol may be two or more of glycerol, 1,2-pentanediol or 1,2-hexanediol.

[0022] Preferably, in some embodiments, the cationic lipid nanoparticles, by mass percentage, comprise 20 g of triglyceride caprylate / caprate, 1.5 g of phytosterol, 5 g of soy lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol and 55.6 g of water.

[0023] Preferably, in some embodiments, the cationic lipid nanoparticles, by mass percentage, comprise 5 g of macadamia nut oil, 0.2 g of cholesterol, 1 g of soy lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol and 75.9 g of water.

[0024] Preferably, in some embodiments, the cationic lipid nanoparticles, by mass percentage, comprise 30 g of limnanthes alba seed oil, 3.5 g of β - sitosterol, 8 g of soy lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 1 g of glycerol and 49.6 g of water.

[0025] Preferably, in some embodiments, the cationic lipid nanoparticles, by mass percentage, comprise 10 g of caprylic / capric triglyceride, 5 g of phytosterol, 5 g of soy lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol and 62.1 g of water.

[0026] Preferably, in some embodiments, the cationic lipid nanoparticles, by mass percentage, comprise 20 g of squalane, 1.5 g of phytosterol, 5 g of egg yolk lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol and 55.6 g of water.

[0027] Specifically, the pH of the cationic lipid nanoparticles can be 4.5 - 6.5.

[0028] More specifically, the pH of the cationic lipid nanoparticles can be 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.0, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5 and any point value within the range.

[0029] Specifically, the zeta potential of the cationic lipid nanoparticles can be 40 - 80 mV.

[0030] More specifically, the zeta potential of the cationic lipid nanoparticles can be 40 mV, 41 mV, 42 mV, 43 mV, 44 mV, 45 mV, 46 mV, 47 mV, 48 mV, 49 mV, 50 mV, 55 mV, 60 mV, 65 mV, 70 mV, 75 mV, 80 mV, or any value within this range.

[0031] Specifically, the particle size of the cationic lipid nanoparticles can be 100 - 200 nm.

[0032] More specifically, it can be 100 nm, 101 nm, 102 nm, 103 nm, 104 nm, 105 nm, 106 nm, 107 nm, 108 nm, 109 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, or any value within this range.

[0033] Specifically, the cationic lipid nanoparticles also contain an antioxidant.

[0034] More specifically, the antioxidant can be one or more of tocopheryl acetate, tocopherol, BHT, carnosic acid, dimethylmethoxy chromanol, butylated hydroxyanisole, and dibutylhydroxytoluene.

[0035] More specifically, the mass percentage of the antioxidant is 0.1 - 0.5%.

[0036] In another aspect, the present invention provides a method for preparing the aforementioned cationic lipid nanoparticles, comprising the following steps: S1. Mix oils, sterols, and lecithin, and stir to obtain a homogeneous oil phase; S2. Dissolve sphingosine, polyhydroxy acid, and polyol in water, and stir to obtain a homogeneous aqueous phase; S3. Add the oil phase prepared in step S1 to the aqueous phase prepared in step S2, and homogenize to obtain cationic lipid nanoparticles.

[0037] Specifically, the conditions for stirring in steps S1 and S2 can be: stirring at 50 - 80 °C.

[0038] Preferably, the conditions for stirring in steps S1 and S2 can be: stirring at 60 - 70 °C.

[0039] Preferably, the conditions for stirring in steps S1 and S2 can be: stirring at 65 °C.

[0040] Specifically, the method for homogenization in step S3 includes, but is not limited to: high-pressure homogenization method or microfluidization method.

[0041] Preferably, the homogenization method described in step S3 may be high-pressure homogenization.

[0042] Preferably, the homogenization pressure of the high-pressure homogenization method may be 700-1000 bar, and the number of cycles may be 3-5 times.

[0043] Specifically, in some embodiments, an antioxidant is added in step S1.

[0044] On the other hand, the present invention provides a cosmetic, comprising the aforementioned cationic lipid nanoparticles and a fat-soluble active substance.

[0045] Specifically, the fat-soluble active substance includes but is not limited to one or more of coenzyme Q10, retinol, retinol palmitate, retinol propionate, bakuchiol, ascorbyl tetraisopalmitate, hydroxypinacolone retinoate, retinyl retinoate, myristyl nicotinate, tocopheryl retinoate, pyridoxine tri-hexyldecanoate, tocopheryl nicotinate, astaxanthin, fucoxanthin or lutein.

[0046] On the other hand, the present invention provides a drug, comprising the aforementioned cationic lipid nanoparticles.

[0047] Specifically, the drug further includes pharmaceutically acceptable excipients.

[0048] On the other hand, the present invention provides the use of the aforementioned cationic lipid nanoparticles in the preparation of a drug or a cosmetic.

[0049] Specifically, the drug further includes pharmaceutically acceptable excipients.

[0050] Specifically, the cosmetic further includes excipients that can be added to the cosmetic.

[0051] The beneficial effects of the present invention are as follows: (1) The cationic lipid nanoparticles provided by the present invention are made of lipid materials that are endogenous-like and derived from natural and biotechnological fermentation. The prepared cationic lipid nanoparticles have the advantages of being safe, non-irritating and having high biocompatibility.

[0052] (2) The cationic lipid nanoparticles provided by the present invention have cations derived from ionizable sphingosine, which are positively charged in an acidic environment and uncharged or have a very low positive charge in a neutral environment. They are endogenous lipids in the human body and have high safety. Different from the first-generation quaternary ammonium salt lipids, which are permanently charged cationic lipids and have high irritation.

[0053] (3) The cationic lipid nanoparticles provided by the present invention have a zeta potential with an absolute value greater than 40 on the surface, so the particles repel each other and are not easily aggregated, showing high stability.

[0054] (4) The cationic lipid nanoparticles provided by the present invention can be used for encapsulating fat-soluble active substances, improving the stability of the active substances, promoting the transdermal penetration and absorption of the active substances, and increasing the retention amount of the active substances in the skin layer. Specific Embodiments

[0055] The present invention will be further clearly and completely described below through examples. The following examples are only a part of the examples of the present invention, and are not used to limit the present invention, but only to illustrate the present invention. The experimental methods used in the following examples are all conventional experiments unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0056] Examples 1 - 8 The composition formula tables of Examples 1 - 8 are shown in Table 1. The unit of the raw material content in the formula table is g, and the total weight is 100 g.

[0057] Table 1 Composition formula tables of Examples 1 - 8

[0058] The components in Table 1 are used to obtain cationic lipid nanoparticles according to the following steps: S1. Stir and dissolve fats, sterols, and lecithin at 65 °C to form a homogeneous oil phase; S2. Stir and dissolve sphingosine, polyhydroxy acid, polyol, and water at 65 °C to form a homogeneous aqueous phase; S3. Add the S1 oil phase to the S2 aqueous phase, shear and emulsify at 65 °C under the condition of 4000 rmp to form a primary emulsion, and then circulate and homogenize 4 times under the condition of 1000 bar by a high-pressure homogenizer to obtain cationic lipid nanoparticles.

[0059] Example 9 S1. Stir and dissolve 5 g of coenzyme Q10, 20 g of glyceryl caprylate / caprate, 1.5 g of phytosterol, and 5 g of soybean lecithin (PC > 70%) at 65 °C to form a homogeneous oil phase; S2. Stir and dissolve 0.2 g of phytosphingosine, 0.2 g of n-acetylneuraminic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol, and 55.6 g of water at 65 °C to form a homogeneous aqueous phase; S3. Add the S1 oil phase to the S2 aqueous phase, shear and emulsify at 65 °C under the condition of 4000 rmp to form a primary emulsion, and then circulate and homogenize 4 times under the condition of 1000 bar by a high-pressure homogenizer to obtain coenzyme Q10 cationic lipid nanoparticles with a particle size of 152 nm and a zeta surface potential of +61.8 mV at pH 5.32.

[0060] Example 10 S1. Dissolve 5 g of coenzyme Q10, 5 g of macadamia nut oil, 0.2 g of cholesterol, and 1 g of soy lecithin (PC>70%) under stirring at 65 °C to form a homogeneous oil phase; S2. Dissolve 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol, and 75.9 g of water under stirring at 65 °C to form a homogeneous aqueous phase; S3. Add the oil phase of S1 to the aqueous phase of S2, shear - emulsify at 65 °C and 4000 rmp to form a primary emulsion, and then circulate and homogenize 3 times under 700 bar by a high - pressure homogenizer to obtain retinol palmitate cationic lipid nanoparticles with a particle size of 173 nm and a pH of 5.26, and a zeta surface potential of +63.1 mV.

[0061] Example 11 S1. Dissolve 5 g of coenzyme Q10, 30 g of Limnanthes alba seed oil, 3.5 g of β - sitosterol, and 8 g of soy lecithin (PC>70%) under stirring at 65 °C to form a homogeneous oil phase; S2. Dissolve 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 1 g of glycerol, and 49.6 g of water under stirring at 65 °C to form a homogeneous aqueous phase; S3. Add the oil phase of S1 to the aqueous phase of S2, shear - emulsify at 65 °C and 4000 rmp to form a primary emulsion, and then circulate and homogenize 5 times under 800 bar by a high - pressure homogenizer to obtain ascorbyl tetraisopalmitate cationic lipid nanoparticles with a particle size of 161 nm and a pH of 5.13, and a zeta surface potential of +64.5 mV.

[0062] Example 12 S1. Dissolve 5 g of coenzyme Q10, 10 g of caprylic / capric triglyceride, 5 g of phytosterol, and 5 g of soy lecithin (PC>70%) under stirring at 65 °C to form a homogeneous oil phase; S2. Dissolve 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol, and 62.1 g of water under stirring at 65 °C to form a homogeneous aqueous phase; S3. Add the oil phase of S1 to the aqueous phase of S2, shear - emulsify at 65 °C and 4000 rmp to form a primary emulsion, and then circulate and homogenize 4 times under 700 bar by a high - pressure homogenizer to obtain tocopherol nicotinate cationic lipid nanoparticles with a particle size of 188 nm and a pH of 5.24, and a zeta surface potential of +62.7 mV.

[0063] Example 13 S1. Dissolve 5 g of coenzyme Q10, 20 g of squalane, 1.5 g of phytosterol and 5 g of egg yolk lecithin (PC>80%) under stirring at 65°C to form a homogeneous oil phase; S2. Dissolve 0.2 g of phytosphingosine, 0.2 g of neuraminic acid, 2 g of 1,2 - hexanediol, 0.5 g of 1,2 - pentanediol, 10 g of glycerol and 55.6 g of water under stirring at 65°C to form a homogeneous aqueous phase; S3. Add the oil phase of S1 to the aqueous phase of S2, shear and emulsify at 65°C under the condition of 4000 rmp to form a primary emulsion, and then circulate and homogenize 4 times under the condition of 1000 bar by a high - pressure homogenizer to obtain psoralenol cationic lipid nanoparticles with a particle size of 176 nm and a pH of 5.21, and a zeta surface potential of +59.3 mV.

[0064] Comparative Example 1 The difference from Example 9 is that phytosphingosine is replaced with an equal weight of neuraminic acid, and the others are the same as Example 9, preparing lipid nanoparticles with a pH of 2.67, a particle size of 158 nm, and a zeta surface potential of - 21.8 mV.

[0065] Comparative Example 2 The difference from Example 9 is that neuraminic acid is replaced with an equal weight of phytosphingosine, and the others are the same as Example 9. Lipid nanoparticles with a pH of 7.15, a particle size of 169 nm, and a zeta surface potential of +26.3 mV are prepared.

[0066] Comparative Example 3 The difference from Example 9 is that neither neuraminic acid nor phytosphingosine is added, and the others are the same as Example 9, preparing lipid nanoparticles with a pH of 5.56, a particle size of 156 nm, and a zeta surface potential of - 25.3 mV.

[0067] Test Example 1 After placing the samples of Examples 1 - 13 and Comparative Examples 1 - 3 in a 45°C high - temperature acceleration chamber for 1 month, observe the stability of the lipid nanoparticles. The results are shown in Table 2: Table 2

[0068] The results show that the lipid nanoparticles prepared in Examples 1 - 13 of the present invention all have excellent stability.

[0069] Test Example 2 Transdermal Penetration Test Samples from Examples 9 - 13 and Comparative Examples 1 - 3 were each diluted with deionized water to 1 mg / mL for standby. The transdermal penetration of coenzyme Q10 was tested using the Franz diffusion cell method. Freshly prepared abdominal skin of Panamanian test pigs was fixed onto the Franz diffusion cell. 0.2 mL of each sample was placed into the supply pool, and the upper opening of the supply pool was sealed with a sealing film. 15 mL of acceptor solution (35% ethanol physiological saline solution) was added to the receptor pool. Air bubbles between the skin and the acceptor solution were removed. The stirring speed of the Franz diffusion cell was 50 rmp. The experiment was stopped after 6 h, and the skin was removed. The skin surface was rinsed with physiological saline, dried, and a 0.25 cm sample of the skin was cut 2 skin, homogenized using a glass homogenizer, fixed volume with ethanol, and the content in the skin layer was to be detected. The content of coenzyme Q10 was detected by HPLC, and the retention amount of coenzyme Q10 in the skin layer was calculated. The results are shown in Table 3: Table 3

[0070] As can be seen from Table 3, the cationic charges in Examples 9 - 13 are more conducive to the retention and storage of the active substance coenzyme Q10 in the skin layer.

[0071] Test Example 3 In vitro anti - photo - damage test Keratinocytes (Peking Union Medical College Cell Center) were used as the cell model. After irradiating keratinocytes with 30 mJ of UVB to induce ultraviolet light damage to keratinocytes, Examples 9 - 13 and Comparative Example 3 were respectively added, and the final concentration of coenzyme Q10 was 25 μg / mL. After culturing for 12 h, the cells were centrifuged and separated, and the total mRNA was extracted from the cell lysate for standby to detect the expression of each mRNA. The control group was keratinocytes without irradiation treatment, and the UVB - damaged group was keratinocytes with photo - damage. The expression levels of genes such as MMP - 1, MMP - 3, TNF - α, and IL - 6 in each sample were detected by real - time fluorescence quantitative PCR (Real - time PCR) using a Roche 480 device. The internal reference gene was GAPDH, and the primer sequences for each gene were as follows: GAPDH - F (SEQ ID NO:1): 5’TGCACCACCAACTGCTTAGC; GAPDH - R (SEQ ID NO:2): 3’GGCATGGACTGTGGTCATGAG.

[0072] MMP1 - F (SEQ ID NO:3): 5’GGGACAGAATGTGCTACACG; MMP1 - R (SEQ ID NO:4): 3’TTTCCTCAGAAAGAGCAGCA.

[0073] MMP3-F (SEQ ID NO:5): 5’TTCCTGATGTTGGTCACTTCAGA; MMP3-R (SEQ ID NO:6): 3’TCCTGTATGTAAGGTGGGTTTTCC.

[0074] TNF-α-F (SEQ ID NO:7): 5’ATCAGAGGGCCTGTACCTCA; TNF-α-R (SEQ ID NO:8): 3’ATGGCAGAGAGGAGGTTGAC.

[0075] IL-6-F (SEQ ID NO:9): 5’GATGGATGCTTCCAATCTGGAT; IL-6-R (SEQ ID NO:10): 3’AGGTACTCTAGGTATACCTCAAACTCCAA.

[0076] The results are shown in Table 4: Table 4

[0077] As can be seen from Table 4, it shows that the cationic charge in Examples 9 - 13 can more effectively increase the effective absorption of coenzyme Q10 by cells, more effectively reduce the photo-damage after UVB-damaged cells, and thus more effectively enhance the photo-damage repair effect of cells.

[0078] Test Example 4 Measurement of Transepidermal Water Loss (TEWL) Value of the Epidermis The repair performance of the moisturizing and repairing lotion prepared in Example 9 and Comparative Example 3 was tested.

[0079] Experimental grouping: Women aged 30 - 40 with dry skin or in need of moisturizing were selected as the test subjects, a total of 30. They were randomly divided into 2 groups, with 15 in each group. There were no significant differences in age and skin properties between the groups, and they were comparable. The two groups used the moisturizing lotions prepared in Example 9 and Comparative Example 3 respectively. The formula of the moisturizing lotion is as follows: 1. It consists of 5 g of glycerol, 4 g of 1,3-propanediol, 0.5 g of D-panthenol, 0.5 g of trehalose, 10 g (Example 9 or Comparative Example 3), and 80 g of deionized water.

[0080] Usage method and test method of the moisturizing water: evenly spray the moisturizing water on the back of the hand of the subject that has been washed with clean water. Use the Tewameter TM Hex instrument to measure the TEWL value before spraying and smearing (D0) and 1 hour after spraying and smearing (D0T1h). The larger the TEWL value, the greater the trans-epidermal water loss per unit time and per unit cross-sectional area, and vice versa. Therefore, the decreasing trend of the TEWL value represents the recovery state of the trans-epidermal water loss of the skin with damaged skin barrier. The lower the TEWL value, the better the repair effect of the moisturizing water on the skin barrier.

[0081] The results are shown in Table 5: Table 5

[0082] As can be seen from Table 5, in Example 9, since the surface has a cationic charge and is more likely to attract the negative charge on the skin surface, it is more conducive to forming a dense protective film formed by the arrangement of particles on the skin surface, which is more conducive to preventing the water loss on the epidermal surface, and thus is also more conducive to the penetration of lipid nanoparticles and their retention in the skin layer.

[0083] The above detailed description is a specific description of one of the feasible embodiments of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or changes made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention shall be subject to the appended claims.

Claims

1. A cationic lipid nanoparticle, characterized in that, The cationic lipid nanoparticles, by mass percentage, comprise 5%-40% oil, 0.1-5% sterol, 0.5%-10% lecithin, 0.05%-0.5% sphingosine, 0.05%-0.5% polyhydroxy acid, and 2.5-20% polyol, with the balance being water.

2. The cationic lipid nanoparticles according to claim 1, wherein The cationic lipid nanoparticles, by mass percentage, comprise 5%-30% oil, 0.2-5% sterol, 1%-8% lecithin, 0.05%-0.2% sphingosine, 0.05%-0.2% polyhydroxy acid, and 3.5-12.5% polyol, with the balance being water.

3. The cationic lipid nanoparticles according to claim 1, wherein, The oil is one or more of soybean oil, olive oil, corn germ oil, macadamia nut oil, tomato seed oil, tamanu oil, sunflower oil, camellia oil, caprylic / capric triglyceride, oleic triglyceride, linoleic triglyceride, linolenic triglyceride, lauric triglyceride, coco-caprylate / caprate, jojoba oil, squalene, or squalane; The sterol is one or more of phytosterol, stigmasterol, cholesterol, β-sitosterol, sitosterol, campesterol, ergosterol, campesterol, or brassicasterol; The lecithin is one or more of soybean lecithin, egg yolk lecithin, sunflower lecithin, hydrogenated soybean lecithin, hydrogenated egg yolk lecithin, or hydrogenated sunflower lecithin; The sphingosine is one or more of phytosphingosine, sphingosine, or dihydrosphingosine; The polyhydroxy acid is one or more of sialic acid, lactobionic acid, gluconic acid, maltobionic acid, or glycolic acid; The polyol is two or more of glycerol, 1,3-propanediol, 1,3-butanediol, 2,3-butanediol, 1,2-pentanediol, 1,2-hexanediol, or 1,2-octanediol.

4. The cationic lipid nanoparticles according to claim 3, wherein The cationic lipid nanoparticles, by mass percentage, comprise any one of (1)-(5): (1) 20 g of caprylic / capric triglyceride, 1.5 g of phytosterol, 5 g of soybean lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2-hexanediol, 0.5 g of 1,2-pentanediol, 10 g of glycerol, and 55.6 g of water; (2) 5 g of macadamia nut oil, 0.2 g of cholesterol, 1 g of soybean lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2-hexanediol, 0.5 g of 1,2-pentanediol, 10 g of glycerol, and 75.9 g of water; (3) 30 g of tamanu oil, 3.5 g of β-sitosterol, 8 g of soybean lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2-hexanediol, 0.5 g of 1,2-pentanediol, 1 g of glycerol, and 49.6 g of water; (4) 10 g of coco-caprylate / caprate, 5 g of phytosterol, 5 g of soybean lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2-hexanediol, 0.5 g of 1,2-pentanediol, 10 g of glycerol, and 62.1 g of water; (5) 20 g of squalane, 1.5 g of phytosterol, 5 g of egg yolk lecithin, 0.2 g of phytosphingosine, 0.2 g of sialic acid, 2 g of 1,2-hexanediol, 0.5 g of 1,2-pentanediol, 10 g of glycerol, and 55.6 g of water.

5. The cationic lipid nanoparticles according to claim 4, characterized in that, The pH of the cationic lipid nanoparticles is 4.5 - 6.5; the zeta potential of the cationic lipid nanoparticles is 40 - 80 mV.

6. The cationic lipid nanoparticles according to any one of claims 1-5, characterized in that, The particle size of the cationic lipid nanoparticles is 100 - 200 nm.

7. A method for preparing the cationic lipid nanoparticles according to any one of claims 1 - 6, comprising the following steps: S1. Mix an oil, a sterol, and lecithin, and stir to obtain a homogeneous oil phase; S2. Dissolve sphingosine, a polyhydroxy acid, and a polyol in water, and stir to obtain a homogeneous aqueous phase; S3. Add the oil phase prepared in step S1 to the aqueous phase prepared in step S2, and homogenize to obtain the cationic lipid nanoparticles.

8. The method according to claim 7, wherein The conditions for the stirring in steps S1 and S2 are: stirring at 50 - 80 °C; the method for the homogenization in step S3 is high-pressure homogenization or microfluidization.

9. A cosmetic, characterized in that, Comprising the cationic lipid nanoparticles according to any one of claims 1 - 6 and a fat-soluble active substance; the fat-soluble active substance is selected from one or more of coenzyme Q10, retinol, retinol palmitate, retinol propionate, bakuchiol, ascorbyl tetraisopalmitate, hydroxypinacolone retinoate, retinol retinoate, myristyl nicotinate, tocopheryl retinoate, pyridoxine tri-hexyldecanoate, tocopheryl nicotinate, astaxanthin, fucoxanthin, or lutein.

10. Use of the cationic lipid nanoparticles according to any one of claims 1 - 6 in the preparation of a drug or a cosmetic.

Images