Dammar diol derivatives, processes for their preparation and use

By preparing dammarene glycol derivatives and expressing the P450 enzyme gene BmCYP068 (codon-optimized from Portulaca oleracea) in Saccharomyces cerevisiae, the problem of the lack of effective drugs to inhibit multiple tumors in the prior art was solved, and significant inhibitory effects on human breast cancer, colon cancer, ovarian cancer and gastric cancer cells were achieved.

CN120241746BActive Publication Date: 2025-11-21YUNNAN AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510063334.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-15
Publication Date
2025-11-21
Estimated Expiration
2045-01-15

AI Technical Summary

Technical Problem

The lack of effective drugs to inhibit many types of tumors in the current technology has led to persistently high mortality rates for many cancers.

Method used

Using dammarene diol derivatives and their preparation methods, a recombinant plasmid was constructed by homologous recombination of the codon-optimized P450 enzyme gene BmCYP068 from Portulaca oleracea with the Y33 vector. The plasmid was then expressed in Saccharomyces cerevisiae, and dammarene diol derivative compounds I and II were obtained by extraction and column chromatography.

Benefits of technology

Compounds I and II exhibited better inhibitory effects on human breast cancer, colon cancer, ovarian cancer, and gastric cancer cell lines in vitro than the positive control drug, and their preparation methods are simple and low-cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120241746B_ABST
    Figure CN120241746B_ABST
Patent Text Reader

Abstract

The present application relates to dammar diol derivatives and its preparation method and application, belong to the field of biochemistry technology. The structure of the dammar diol derivative is as shown in formula (1);, formula (1);In formula (1), R is or. Pharmacological experiments prove that the dammar diol derivative has obvious antitumor effect, wherein the human breast cancer cell, colon cancer cell, ovarian cancer cell and gastric cancer cell line have better inhibitory effect than the positive control drug, and can be used as a lead compound or candidate compound for the development of antitumor drugs.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biochemistry, and particularly relates to a dammarenediol derivative, a preparation method and application thereof. BACKGROUND

[0002] At present, the treatment of tumors is still traditional surgical treatment, radiotherapy and drug treatment, but to a large extent, drug treatment is still the main method, and drugs play an important role in the treatment of malignant tumors. In recent years, tumor chemotherapy has made great progress, and the survival time of patients has been significantly prolonged, especially in the treatment of leukemia, malignant lymphoma and other diseases. However, there are still many kinds of tumors without good inhibitory drugs, resulting in high mortality. Therefore, the research and development of new anti-tumor drugs have important clinical significance for the treatment of malignant tumors. SUMMARY

[0003] The present application belongs to the technical field of biochemistry, and particularly relates to a dammarenediol derivative, a preparation method and application thereof.

[0004] To achieve the above object, the technical scheme adopted by the present application is as follows:

[0005] The application of the dammarenediol derivative in the preparation of anticancer drugs, wherein the structure of the dammarenediol derivative is shown in formula (1);

[0006]

[0007] In formula (1), R is

[0008] Further, preferably, the anticancer drug is an anti-human breast cancer, anti-human lung cancer, anti-colon cancer, anti-ovarian cancer or anti-gastric cancer drug.

[0009] Further, preferably, the preparation method of the dammarenediol derivative comprises the following steps:

[0010] (1) homologous recombination of a P450 enzyme gene BmCYP068 of a codon-optimized Bacopa monnieri with a Y33 vector to obtain a Y33-BmCYP068 recombinant plasmid; the nucleotide sequence of the P450 enzyme gene BmCYP068 of the codon-optimized Bacopa monnieri is shown in SEQ ID NO. 1;

[0011] (2) transforming a Dammarenediol II-producing Saccharomyces cerevisiae transgenic engineering bacteria DM yeast chassis strain with the Y33-BmCYP068 recombinant plasmid to obtain a transgenic engineering bacteria containing the Y33-BmCYP068 recombinant plasmid;

[0012] (3) The transgenic engineered bacteria containing the Y33-BmCYP068 recombinant plasmid were cultured in SC-His-Leu-Ura liquid medium at 30℃ and 220rpm for 5 days, and then the cells were collected by centrifugation at 5000rpm for 30min.

[0013] (4) The collected cells were lysed and broken with lysis buffer, and then extracted with a mixture of petroleum ether and ethyl acetate in a volume ratio of 1:1. The extract was concentrated and dried, and then subjected to column chromatography to obtain the dammarene diol derivative shown in formula (1).

[0014] Furthermore, preferably, in step (4), the lysis solution is a solvent with a volume concentration of 50% EtOH, to which KOH is added to a mass concentration of 20%.

[0015] Furthermore, preferably, in step (4), the extraction is performed three times.

[0016] Furthermore, preferably, in step (4), during concentration and drying, a rotary evaporator is used to concentrate and dry at 50°C.

[0017] Furthermore, preferably, in step (4), during silica gel column chromatography, a mixed solvent of petroleum ether and ethyl acetate is used as the eluent for gradient elution, with gradient elution ratios of 12:1, 10:1, 8:1, 6:1, 4:1, 2:1, and 1.5:1, respectively; TLC is used for tracking.

[0018] This invention uses the YCplac33 vector to perform homologous recombination with the codon-optimized P450 enzyme gene BmCYP 068 of *Portulaca oleracea*. Those skilled in the art should know that the YCplac33 vector is abbreviated as Y33 vector.

[0019] In this invention, gradient elution is monitored by TLC, and identical portions are combined for concentration. Once each gradient is eluted to the point where there are no obvious main spots on the TLC plate, the next concentration gradient can be changed.

[0020] In this invention, the codon-optimized P450 enzyme gene BmCYP068 of *Portulaca oleracea* has a nucleotide sequence as shown in SEQ ID NO.1, with a full length of 1554 bp.

[0021] The codon-optimized P450 enzyme gene BmCYP068 from *Portulaca oleracea* described in this invention was identified from *Portulaca oleracea* plants through transcriptome sequencing and bioinformatics techniques, and was obtained through extensive experimental screening. After codon optimization, it was synthesized artificially. The reaction formula for the preparation method of this invention is as follows:

[0022]

[0023] Compared with the prior art, the present application has the following beneficial effects:

[0024] (1) The in vitro anti-tumor activity experiment of the dammarenediol derivative provided by the present application on various human cancer cells shows that the compound I and the compound II have better inhibitory effect on human breast cancer (MCF-7), colon cancer (SW480), ovarian cancer (SKOV3) and gastric cancer (SGC7901) cell lines than the positive control drug, indicating that the two compounds can be used as a lead compound or a candidate compound for the development of an anti-tumor drug;

[0025] (2) The preparation method provided by the present application is simple, has high yield and low cost. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 It is a schematic diagram of construction of the recombinant expression plasmid Y33-BmCYP068.

[0027] Figure 2 It is an electrophoresis detection result of the recombinant P450 enzyme gene BmCYP068 of the spilanthes acuta after codon optimization; wherein M is a nucleic acid marker, and 1-6 are positive single colony detection results.

[0028] Figure 3 It is a schematic diagram of a gene fusion fragment of a DM chassis.

[0029] Figure 4 It is a HPLC detection result of the catalysis of the P450 enzyme gene BmCYP068 of the spilanthes acuta after codon optimization on the substrate Dammarenediol II in yeast; wherein DM+PPD standard: peak time of Dammarenediol II standard and PPD standard; DM chassis+Y33 empty load: reaction result of the control group Y33 empty plasmid as a positive control; DM chassis+BmCYP068: reaction result of the P450 enzyme gene BmCYP068 of the spilanthes acuta after codon optimization catalyzing the substrate Dammarenediol II in yeast, peak time of products I and II;

[0030] Figure 5 It is a characteristic peak ion map of the reaction product I (theoretical molecular weight 460);

[0031] Figure 6 It is a characteristic peak ion map of the reaction product II (theoretical molecular weight 460);

[0032] Figure 7 It is an NMR detection result, NMR of the reaction product 1 13 C spectrum;

[0033] Figure 8NMR for reaction product 1 1 H spectrum;

[0034] Figure 9 HMBC spectrum for reaction product 1

[0035] Figure 10 HSQC spectrum for reaction product 1

[0036] Figure 11 COSY spectrum for reaction product 1

[0037] Figure 12 ROESY spectrum for reaction product 1

[0038] Figure 13 NMR for reaction product 2 13 C spectrum;

[0039] Figure 14 NMR for reaction product 2 1 H spectrum;

[0040] Figure 15 HMBC spectrum for reaction product 2

[0041] Figure 16 HSQC spectrum for reaction product 2

[0042] Figure 17 COSY spectrum for reaction product 2

[0043] Figure 18 ROESY spectrum for reaction product 2

[0044] Figure 19 Inhibition of human breast cancer (MCF-7) cell line by Compound I and Compound II

[0045] Figure 20 Inhibition of human colon cancer (SW480) cell line by Compound I and Compound II

[0046] Figure 21 Inhibition of human ovarian cancer (SKOV3) cell line by Compound I and Compound II

[0047] Figure 22 Inhibition of human gastric cancer (SGC7901) cell line by Compound I and Compound II

[0048] Figure 23Inhibition of human lung cancer (A549) cell line by compound I and compound II.

[0049] The above NMR detection was performed on a Bruker AV-800MHz spectrometer (Santa Clara, USA) with compound in DMSO-d6. DETAILED DESCRIPTION

[0050] The application will be further described in detail below with reference to examples.

[0051] Those skilled in the art will understand that the following examples are only for illustration of the application and should not be regarded as limiting the scope of the application. If no specific technique or condition is specified in the examples, the technique or condition described in the literature in the art or according to the product manual is used. If no manufacturer is specified for the materials or equipment used, it is a conventional product that can be obtained by purchase.

[0052] Preparation of compound I and compound II in Example 1

[0053] After a series of work such as codon optimization, artificial synthesis, homologous recombination, in vivo induction expression of yeast bottom cell, yeast metabolite extraction, HPLC, LC-MS, NMR detection, etc. on the nucleotide sequence of BmCYP068 (see ZL202311077715.2) cytochrome p450 monooxygenase (CYPs) of Bacopa monnieri, compound I and compound II were purified by silica gel column chromatography.

[0054] The operation steps of each stage in the preparation of compound I and compound II are as follows:

[0055] The medium formula used in the application is shown in Table 1.

[0056] Table 1 Medium formula used in the application

[0057]

[0058] (1) Codon optimization and artificial synthesis of BmCYP068 gene

[0059] After codon optimization of the P450 synthase encoding gene BmCYP068 annotated from the transcriptome, the company performed artificial synthesis.

[0060] (2) Construction and identification of gene recombination vector

[0061] The schematic diagram of homologous recombination is shown in detail Figure 1First, the YCplac33 vector was linearized by single digestion with XbaI enzyme to obtain the linearized vector. The digestion system (50 μL) consisted of 1 μg of circular YCplac33 vector, 5 μL of 10×NE Buffer, 1 μL of Restriction Enzyme, and double-distilled water to a total volume of 50 μL. The reaction solution was incubated at 37℃ for 15 min to obtain the linearized YCplac33 vector. The linearized vector was recovered using the EasyPure Quick Gel Extraction Kit (Tiangen Biotech (Beijing) Co., Ltd.). After recovery, the concentration was measured, and the sample was stored at -20℃ for later use. For homologous recombination, assembly was performed according to the instructions of the homologous recombinase kit (Sangon Biotech (Shanghai) Co., Ltd.). The amount of each component was calculated based on the concentration of the insert fragment and vector, and according to the recombination instructions. Finally, the components were added to the PCR reaction tubes on ice, as shown in Table 2. The codon-optimized P450 enzyme gene BmCYP068 from *Portulaca oleracea* was homologously recombined with the linearized vector YCplac33 to obtain a recombinant plasmid named Y33-BmCYP068. The recombinant plasmid was transformed into DH5α *E. coli*, and positive clones were selected for detection and sent to the company for sequencing. The electrophoresis results after assembly are shown below. Figure 2 This indicates successful assembly. The successfully sequenced positive monoclonal clones were preserved in 50% (v:v) glycerol (i.e., positive monoclonal preservation solution) and stored in an ultra-low temperature freezer at -80°C.

[0062] Table 2 Candidate gene recombination reaction system

[0063] Component Recombination reaction μL Linearized vector YCplac33 X Inserted gene fragment Y 5 x CE II Buffer 4 Exnase II 2 ddH2O to 20 μL

[0064] Where X = (0.02 × number of YCplac33 base pairs) ng / linearized YCplac33 concentration ng / μL; Y = (0.02 × number of YCplac33 base pairs) ng / BmCYP068 recovery concentration ng / μL;

[0065] (3) Extraction of recombinant plasmids

[0066] 10 μL of the positive monoclonal seed culture after sequencing was placed in 6 mL of LB liquid medium (100 mg / mL Amp) and incubated overnight at 37°C on a shaker (220 rpm). Plasmids were extracted according to the instructions of the plasmid DNA miniaturization kit (GenStar, Shenzhen, China). The concentration of extracted plasmid DNA was determined using a NanoReady ultra-micro UV-Vis spectrophotometer, and the extracted DNA was stored at -20°C for later use.

[0067] (4) Preparation of competent cells from DM yeast chassis

[0068] DM yeast cell strains from SC-His-Leu solid medium plates were inoculated into 100 mL of SC-His-Leu liquid medium and cultured at 30 °C and 220 rpm until OD = 0.8–0.9. The cells were then centrifuged in 50 mL centrifuge tubes for 5 min at 5000 g. The cells were washed twice with 25 mL of sterile water, and the centrifugation process was repeated. The washed cells were resuspended in 1 mL ddH2O, mixed thoroughly, and transferred to 1.5 mL centrifuge tubes. The cells were collected by centrifugation at 13000 rpm for 30 s. The cells were resuspended in 600 μL ddH2O, and aliquoted into two tubes (100 μL each) for transformation.

[0069] The aforementioned DM yeast chassis cell strain, sourced from Yunnan Agricultural University, can provide dammarenediol (DM), a precursor for the functional validation of BmCYP068. The construction method for this DM yeast chassis cell strain is described in ZL2025100515909: A recombinant Saccharomyces cerevisiae capable of simultaneously producing 23-OH-Dammarenediol II and 25-OH-Dammarenediol II, with the following steps:

[0070] S1: Gene expression cassettes were constructed from the mevalonate pathway-related genes ERG1, ERG9, ERG20, and tHMG1 from *Saccharomyces cerevisiae* BY4742, the dammarene diol synthase gene synPgDDS from ginseng, the NADPH-cytochrome P450 reductase gene synBmCPR1 from *Portulaca oleracea*, the leucine selection tag (LEU2), and yeast-derived promoters and terminators to form modules for the DM synthesis pathway. Specifically, the HXT promoter was used. 7. Gene expression cassettes were constructed by controlling the expression of the tHMG1 gene in recombinant BY-MVA bacteria using promoter TEF2 and terminator TDH2, the ERG1 gene using promoter IPI1 and terminator ENO2, the ERG20 gene using promoter GPM and terminator CYC1, the ERG9 gene using promoter PGK1 and terminator FBA1, and the synPgDDS gene using promoter TDH3 and terminator PGT1. Figure 3The BY-MVA recombinant strain is an existing one, constructed as follows: The expression of the ERG1 gene introduced into BY4742 is controlled by the promoter IDP1 and terminator TDH2; the expression of the ERG9 gene introduced into BY4742 is controlled by the promoter TEF1 and terminator CYC1; the expression of the ERG20 gene introduced into BY4742 is controlled by the promoter CPS1 and terminator ENO2; and the expression of the tHMG1 gene introduced into BY4742 is controlled by the promoter PGK1 and terminator ADH1. This forms a gene expression cassette. The cassette and the HIS3 selection tag are then co-transformed into the YPRCδ15 site of *Saccharomyces cerevisiae* BY4742 using a lithium acetate transformation method via homologous recombination.

[0071] S2. The gene expression cassette and LEU2 selection tag were co-transformed into the δDNA site of the BY-MVA recombinant bacteria using the lithium acetate conversion method to obtain the recombinant bacteria DM-BmCPR, which can produce DM, namely the DM yeast chassis cell strain.

[0072] (5) Transformation of DM yeast chassis cells

[0073] Centrifuge the two tubes of bacterial cells in a handheld centrifuge for 20 seconds, discard the supernatant, and add the following transformation system to each tube: 240 μL of PEG 4000 (50%), 36 μL of LAC (lithium acetate) 1.0 mol, 10 μL of SSDNA (frog fish sperm) 2.0 μg / μL, and 400 ng of Y33-BmCYP068 plasmid containing the target fragment. Add ddH2O to a total volume of 74 μL. Resuspend the mixture, incubate at 30°C for 20 min, and heat-shock at 42°C for 40 min to obtain a resuspended solution. Spread 200 μL of the resuspended solution onto an SC-His-Leu-Ura plate, invert the plate, and incubate at 30°C for 2–4 days. Select positive clones for verification to obtain the engineered bacteria transformed with Y33-BmCYP068.

[0074] (6) Screening of positive strain clones

[0075] Add 20 μL of ddH2O to each of eight 0.2 mL PCR tubes. Pick four single colonies from each of the two plate cultures, for a total of eight colonies, and add one colony to each PCR tube. Incubate the PCR tubes at 95°C for 10 min to lyse the cell wall. Add the following reaction mixture to each PCR tube: 10 μL Super 2x Mix, 7.4 μL sterile water, 0.8 μL universal forward primer (10 mM), 0.8 μL universal reverse primer (10 mM), and 1 μL of single colony template dissolved in water, for a total of 20 μL. The universal primers for detection were designed using software (SnapGene 3.2.1). The universal forward primer is gatgctttctttttctctttttttacagatc (SEQ ID NO.2), and the universal reverse primer is gcgtgaatgtaagcgtgac (SEQ ID NO.3). The PCR amplification cycle parameters were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 90 s, for 35 cycles; 72℃ for 5 min, 10℃ for 5 min.

[0076] (7) Detection and sequencing

[0077] Add 5 μL of the above PCR product to 1.0 μL of loading buffer, mix well, and detect the amplification result by 1% agarose gel electrophoresis. If the size is similar to the target fragment, it is a true positive yeast strain, indicating successful transformation. Incubate the identified positive clones in SC-His-Leu-Ura liquid medium at 30℃ and 220 rpm for 1 day, then preserve the bacteria. Add 50% (v:v) glycerol to the bacterial culture at a 1:1 ratio to the preservation tube, mix thoroughly, and store in a -80℃ ultra-low temperature freezer for later use.

[0078] (8) Yeast-induced expression and detection

[0079] Normally growing positively transformed strains were selected and cultured in 50 ml of SC-His-Leu-Ura liquid medium. After 5 days of culture at 30°C and 220 rpm with shaking, the cells were collected by centrifugation at 8000 rpm for 5 min. The cells were lysed and disrupted using 5 ml of lysis buffer (using 50% EtOH as solvent and adding KOH to a mass concentration of 20%). The cells were extracted three times with a 1:1 mixture of 5 ml petroleum ether and ethyl acetate. The extracts were evaporated to dryness at 50°C using a rotary evaporator and dissolved in 3 ml of chromatographic methanol. The extracted metabolites were analyzed by HPLC.

[0080] The HPLC detection conditions are as follows:

[0081] The instrument used for HPLC analysis was an Agilent high-performance liquid chromatograph. The chromatographic column was an Agilent EC-C18 column (4.6 × 100 mm, 2.7 μm), and the column temperature was 25℃. The mobile phase was water (A)-acetonitrile (B), with gradient elution: 0–10 min, 70%–75% B; 10–20 min, 75%–85% B; 20–22 min, 85%–100% B; 22–25 min, 100% B. The total mobile phase A+B used during elution was 100%. Linear gradient elution was employed. The elution time was 25 min. The injection volume was 10 μL. The flow rate was 0.8 mL / min. The detection wavelength was 203 nm, and the detector was a diode array detector. The detection results are shown below. Figure 4 This indicates that new products were produced in the experimental samples under the catalysis of the pseudopurslane P450 enzyme BmCYP068.

[0082] The LC-MS detection conditions are as follows:

[0083] To further confirm the reaction products detected by HPLC, an Agilent 1290UPLC / 6540Q-TOF liquid chromatography-mass spectrometry (LC / MS / MS) system was used for detection: Mass spectrometry conditions: negative ion mode ion source, voltage: 3500V; fragmentation voltage: 135V; cone voltage: 60V; radio frequency voltage: 750V, scan range: 100-1000m / z, scan mode: SRM. Chromatographic conditions: The column was an Agilent EC-C18 column (4.6 × 100 mm, 2.7 μm), column temperature: 25℃; the mobile phase was water (A)-acetonitrile (B), gradient elution: 0–10 min, 70%–75% B; 10–20 min, 75%–85% B; 20–22 min, 85%–100% B; 22–25 min, 100% B; the total mobile phase A+B used during elution was 100%; linear gradient elution was used; elution time: 25 min; injection volume: 10 μL; flow rate: 0.8 mL / min; detection wavelength: 203 nm; detector: diode array detector. Data analysis was performed using MassHunter workstation (Agilent) software. Detection results are shown below. Figures 5-6 .

[0084] (9) The engineered bacteria transformed from Y33-BmCYP068 were cultured in 10L of volume and fermented in shake flasks for 5 days. After centrifugation at 5000rpm for 30min, the cells were collected and extracted three times with a 1:1 mixture of 500mL petroleum ether and ethyl acetate. The extract was evaporated to dryness at 50℃ using a rotary evaporator to obtain 5g of dried extract. A silica gel column (300 mesh, 125g) with a mass 25 times that of the dried extract was used for gradient elution with petroleum ether:ethyl acetate (12:1-1.5:1, v / v) (the gradient elution ratios were 12:1, 10:1, 8:1, 6:1, 4:1, 2:1, and 1.5:1, respectively; TLC was used for tracking). Compound I and compound II were obtained at ratios of 4:1 and 2:1, respectively. The structures of the two compounds were determined by NMR analysis. NMR detection was performed in DMSO-d6 on a Bruker AV-800MHz spectrometer (Santa Clara, USA). Results are shown below. Figures 7-18 Based on NMR spectroscopy analysis, compound I was identified as 23-OH-Dammarenediol II, and compound II was identified as 25-OH-Dammarenediol II.

[0085] Example 2: CCK assay was used to observe the effects of compounds I and II on the proliferation of human breast cancer cells (MCF-7), lung cancer cells (A549), colon cancer cells (SW480), ovarian cancer cells (SKOV3), and gastric cancer cells (SGC7901).

[0086] 1. Materials

[0087] 1.1 Cancer cell types: Human breast cancer cell line: MCF-7, human lung cancer cell line: A549, colon cancer cell line: SW480, ovarian cancer cell line: SKOV3, human gastric cancer cell line: SGC7901;

[0088] Storage conditions: Frozen in liquid nitrogen

[0089] Sample size: 120 groups

[0090] 1.2 Experimental reagents: Compound I and Compound II (self-prepared), purity was determined by HMR analysis, purity ≥98%, meeting experimental requirements. The powders were sealed and stored at 4℃.

[0091] 2. Methods

[0092] 2.1 Cultivation conditions

[0093] Complete cell culture medium:

[0094] MCF-7 and SW480: 90% DMEM+10% FBS+1% Penicillin / Streptomycin Solution (wt%);

[0095] A549 and SGC7901: 90% RPMI1640+10% FBS+1% Penicillin / Streptomycin Solution (wt%);

[0096] SKOV3: 90% DMEM / F12+10% FBS+1% Penicillin / Streptomycin Solution (wt%).

[0097] Culture conditions: 95% air; 5% carbon dioxide (v:v); incubated at 37℃ with 70%-80% humidity.

[0098] 2.2 Cell treatment:

[0099] 1. Cell resuscitation: Thaw the cryovials rapidly by shaking in a 42°C water bath, add 4 mL of complete cell culture medium and mix well. Centrifuge at 1000 rpm for 4 min, discard the supernatant, add 2 mL of complete cell culture medium and resuspend. Then add all cell suspensions to culture flasks and incubate overnight. Change the medium the next day and check the cell density.

[0100] 2. Cell passage: If the cell density reaches 80%-90%, cell passage can be performed.

[0101] Propagation steps:

[0102] 1) Add 500 μL of 0.25% Trypsin to the bottle and place it in a 37°C incubator for 1 min to digest the cells. Observe the cell digestion under a microscope. If most of the cells become round and detach, quickly return them to the operating table, tap them a few times, add 50 μL of complete cell culture medium to stop the digestion, centrifuge at 1000 rpm for 4 min, and wash the cells twice with PBS.

[0103] 2) Discard the supernatant, add 2 mL of culture medium and mix well.

[0104] 3) Divide the cell suspension into new culture flasks at a ratio of 1:2 (v:v).

[0105] 3. Cell cryopreservation: After the experiment, when the cells are in good growth condition, use a pipette to digest and collect the cells, and add cell cryopreservation solution (Thermo Fisher Scientific Inc) to cryopreserve the cells.

[0106] 2.3 CCK8 Detection

[0107] 1. Take cells in the logarithmic growth phase, using 10 cells per well. 4 Cells were seeded into 96-well plates.

[0108] 2. Overnight cell culture.

[0109] 3. On the second day, seven concentrations of compound I and compound II (1000 μmol / L, 100 μmol / L, 10 μmol / L, 1 μmol / L, 0.1 μmol / L, 0.01 μmol / L, and 0.001 μmol / L) were added to the culture wells to treat the cells.

[0110] 4. After 24 hours, CCK8 assays were performed on cells treated with different methods (see CCK8 instruction manual for details).

[0111] 5. Based on the CCK8 results, select the concentration range where the cell inhibition rate is 50%. Then, set five concentrations at a 2-fold concentration gradient for CCK8 testing, repeating each concentration three times, and calculate the survival rate. Survival rate (%) = (Experimental OD value - Blank control OD value) / (Negative control OD value - Blank control OD value) * 100. The results were analyzed using GraphPad Prism 8.0 to examine the inhibitory effects of compound I and compound II on cancer cells (Note: Blank control: no cells; Negative control: drug concentration of 0).

[0112] 3. Results

[0113] Compounds I and II showed better efficacy against human breast cancer cells (MCF-7), colon cancer cells (SW480), ovarian cancer cells (SKOV3), and gastric cancer cells (SGC7901) than the positive control drug (corresponding to...). Figures 19-23 The indicated drugs (pertuzumab, fluorouracil, cisplatin, ginsenoside Rg3, and paclitaxel) showed better inhibitory effects in a dose-dependent manner; compounds I and II also had significant inhibitory effects on human lung cancer cells (A549), but at higher concentrations than the positive control drugs. Figures 18-22 As shown in Table 3.

[0114] Table 3. Cytotoxic effects of compounds I and II on five types of cancer cells.

[0115]

[0116]

[0117] 4. Conclusion

[0118] Compounds I and II showed significant inhibitory effects on human breast cancer cells (MCF-7), human lung cancer cells (A549), colon cancer cells (SW480), ovarian cancer cells (SKOV3), and gastric cancer cells (SGC7901). Except for human lung cancer cells (A549), compounds I and II showed better inhibitory effects on the other four types of human cancer cells than the positive control drug.

[0119] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. Use of dammarenyldiol derivatives for the preparation of anticancer medicaments, characterized in that, The structure of the dammarene diol derivative is shown in compound I or compound II. The structure of compound I is shown in the following formula: ; The structure of compound II is shown in the following formula: ; The anticancer drug is an anti-human breast cancer drug. The preparation method of the dammarene diol derivative comprises the following steps: (1) The P450 enzyme gene of Bacopa monnieri optimized by codon is recombined with Y33 vector by homologous recombination to obtain Y33- BmCYP068 BmCYP068 The recombinant plasmid is obtained by homologous recombination of the P450 enzyme gene of Bacopa monnieri optimized by codon BmCYP068 The nucleotide sequence is shown as SEQ ID NO. 1.​ (2) Y33- BmCYP068 The recombinant plasmid is transformed into the Dammarenediol II-producing Saccharomyces cerevisiae transgenic engineering bacteria DM yeast chassis strain to obtain a transgenic engineering bacteria containing Y33- BmCYP068 The recombinant plasmid is transformed into the Dammarenediol II-producing Saccharomyces cerevisiae transgenic engineering bacteria DM yeast chassis strain to obtain a transgenic engineering bacteria containing Y33- (3) Y33- BmCYP068 The genetically engineered bacteria of the recombinant plasmid were cultured in a liquid medium of SC-His-Leu-Ura at 30°C and 220 rpm for 5 days, and then the cells were collected by centrifugation at 5000 rpm for 30 min. (4) The collected cells are lysed by a lysis solution, and then extracted by a mixture of petroleum ether and ethyl acetate with a volume ratio of 1:1; after the extraction solution is concentrated and dried, column chromatography is performed to obtain the dammarene diol derivative.

2. Use of damagenediol derivatives according to claim 1 for the preparation of anticancer drugs, characterized in that: In step (4), the lysis solution is a solvent with a volume concentration of 50% EtOH, and KOH is added to a mass concentration of 20%.

3. Use of damagenediol derivatives according to claim 1 for the preparation of anticancer drugs, characterized in that: In step (4), the extraction is performed three times.

4. Use of damagenediol derivatives according to claim 1 for the preparation of anticancer drugs, characterized in that: In step (4), when concentrated and dried, a rotary evaporator is used at 50°C for concentration and drying.

5. Use of damagenediol derivatives according to claim 1 for the preparation of anticancer drugs, characterized in that: In step (4), when the silica gel column chromatography is performed, a mixture of petroleum ether and ethyl acetate is used as an eluent for gradient elution, and the gradient elution ratio is 12:1, 10:1, 8:1, 6:1, 4:1, 2:1 and 1.5:1 in turn; TLC tracking is performed.

Citation Information

Patent Citations

  • P450 enzyme gene BmCYP068 of bacopa monnieri and application thereof

    CN117327715A