Application of AhR in regulation and control of ALDH1A3

By regulating the AhR signaling pathway and using specific reagents to activate or inhibit AhR, the problem of insufficient expression of ALDH1A3 protein is solved, promoting retinoic acid synthesis and skin barrier function gene transcription, and improving skin barrier function.

CN120242012APending Publication Date: 2025-07-04GUANGDONG HONG KONG MACAO GREATER BAY AREA PRECISION MEDICINE RESEARCH INSTITUTE (GUANGZHOU)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410009028.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-03
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

There is a lack of effective methods for regulating the expression of ALDH1A3 protein in the prior art, resulting in insufficient anabolic retinoic acid and affecting the integrity of skin barrier function.

Method used

By activating or inhibiting the AhR signaling pathway, AhR is regulated by activating or inhibitors, transcriptional regulation of ALDH1A3, retinoic acid synthesis and skin barrier function genes is achieved, including the use of benzopyrene, nicarbazole, ITE, 3-indole methanol, β-naphthaleneflavonoids, VAF347, L-kynurenine, IK-175, BAY-2416964, CH223191 and other reagents.

Benefits of technology

Promote the expression of ALDH1A3 and the synthesis of retinoic acid, enhance the transcription of skin barrier function genes, and improve the integrity of skin barrier function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004648597640000011
    Figure HDA0004648597640000011
  • Figure HDA0004648597640000012
    Figure HDA0004648597640000012
  • Figure HDA0004648597640000013
    Figure HDA0004648597640000013
Patent Text Reader

Abstract

The invention provides application of AhR in regulation and control of ALDH1A3 and synthesis of retinoic acid. Specifically, the invention provides an application of a reagent in preparation of a product, the reagent is used for regulating and controlling AhR or an AhR signal channel, and the product is used for at least one of the following: regulating and controlling ALDH1A3; regulating and controlling synthesis of retinoic acid; the expression of skin barrier function related genes is regulated and controlled. The inventor provides the application by utilizing the relationship between AhR and ALDH1A3, the relationship between ALDH1A3 and retinoic acid and the relationship between retinoic acid and the skin barrier function, and when an AhR or AhR signal channel is regulated and controlled, the generation of ALDH1A3, retinoic acid synthesis and skin barrier function gene transcription can be regulated and controlled at the same time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to the use of AhR in regulating ALDH1A3 protein. Background Art

[0002] Aryl Hydrocarbon Receptor (AHR or AhR) is a transcription regulatory factor that can bind ligands intracellularly. Under normal circumstances, AhR exists in the cytoplasm and forms a complex with multiple chaperone proteins. However, after binding to a ligand, AhR enters the nucleus through the nuclear pore and forms a dimer with Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT). The formed dimer can bind to the Xenobiotic Response Element (XRE) in DNA to promote the expression of downstream genes. AhR can also bind to other transcription factors in the nucleus, thereby affecting the expression of genes regulated by the bound transcription factors. Moreover, recent studies have found that the AhR signaling pathway is of great significance for maintaining the balance of the immune system.

[0003] The human Aldehyde dehydrogenases (ALDH) family contains 19 subtypes, and the subcellular localization of different ALDH subtypes varies (including the nucleus, mitochondria, and cytoplasm) and their functions are also different. Aldehyde dehydrogenase 1 (ALDH1) is one of the members of the aldehyde dehydrogenase family, and ALDH1A3 is a subtype of ALDH1. ALDH is an enzyme involved in the production of retinoic acid in cells. It has been found that upregulating the expression of ALDH1A3 can promote the anabolic metabolism of retinoic acid. Retinoic acid plays an important role in the process of cell differentiation and the body's self-protection by stem cells, and is crucial for maintaining the integrity of the skin barrier function.

[0004] Therefore, there is an urgent need for a new method to regulate the expression of ALDH1A3 protein, so as to promote the anabolic metabolism of retinoic acid and further promote the integrity of the skin barrier function. Summary of the Invention

[0005] The present invention aims to solve at least one of the technical problems existing in the prior art to some extent.

[0006] During the experiment, the inventor first discovered a certain relationship between AhR and ALDH1A3. When AhR is activated by environmental stimulants (benzo[a]pyrene BaP, 6-formylindolo[3,2-b]carbazole FICZ), it can target the transcription of ALDH1A3, thereby regulating the synthesis and metabolism of retinoic acid and the expression of genes related to skin barrier function. Therefore, after activating AhR, it can further regulate the transcription of genes related to barrier function and promote the integrity of the skin barrier function.

[0007] Therefore, in the first aspect of the present invention, the present invention proposes the use of a reagent in the preparation of a product. According to the embodiments of the present invention, the reagent is used to regulate AhR or the AhR signaling pathway, and the product is used for at least one of the following: regulating ALDH1A3; regulating retinoic acid synthesis; regulating the transcription of skin barrier function genes. The inventor proposed the above-mentioned use by utilizing the relationship between AhR and ALDH1A3, the relationship between ALDH1A3 and retinoic acid, and the relationship between retinoic acid and skin barrier function. When regulating AhR or the AhR signaling pathway, it can simultaneously achieve the regulation of the occurrence of ALDH1A3, retinoic acid synthesis, and the transcription of skin barrier function genes.

[0008] According to the embodiments of the present invention, the use of the reagent in the preparation of a product may further include at least one of the following additional technical features:

[0009] According to the embodiments of the present invention, the reagent is used to activate or overexpress AhR or activate the AhR signaling pathway, and the product is used for at least one of the following: activating ALDH1A3 or promoting the expression of ALDH1A3; promoting retinoic acid synthesis; promoting the transcription of skin barrier function genes. When AhR is overexpressed or the AhR signaling pathway is activated, not only can ALDH1A3 be activated or its expression increased, but also the synthesis of retinoic acid participated by ALDH1A3 can be increased, and further promote the transcription of skin barrier function genes.

[0010] According to the embodiments of the present invention, the reagent includes at least one selected from benzo[a]pyrene, 6-formylindolo[3,2-b]carbazole, ITE, 3-indolemethanol, β-naphthoflavone, VAF347, and L-kynurenine.

[0011] According to an embodiment of the present invention, the skin barrier function genes are selected from at least one of EPS8 (epidermal growth factor receptor pathway substrate 8 Gene), SATB1 (matrix attachment region-binding protein 1), KRT14 (Keratin 14), KRT17 (Keratin 17), SCEL (Sciellin), KRT4 (Keratin 4), PTGS1 (Prostaglandin (Endoperoxide Synthase 1)), LYPD1 (LY6 / PLAUR Domain Containing 1), SOX9 (SRY (Box) Transcription Factor 9), IVL (Involucrin), KRT6A (Keratin 6A), COL6A3 (collagen type VI alpha 3 chain Gene), and SPRR1B (small proline rich protein 1B Gene).

[0012] According to an embodiment of the present invention, when the reagent activates or overexpresses AhR or activates the AhR signaling pathway, it inhibits the transcription of skin barrier function genes including at least one of Special AT (Rich Sequence Binding Protein 1), GRHL3 (GrainyheadLike Transcription Factor 3), SOCS1 (Suppressor of cytokine signaling 1), PTGS2 (Prostaglandin Endoperoxide Synthase 2), PPL (Periplakin), OCLN (Occludin), PTCH1 (Patched1), and OVOL1 (ovo like transcriptional repressor 1 Gene).

[0013] According to an embodiment of the present invention, the product is selected from drugs, skin care products, or health care products.

[0014] According to an embodiment of the present invention, the reagent is used to inhibit the activity of AhR, or reduce the expression of AhR, or inhibit the AhR signaling pathway, and the product is used for at least one of the following: inhibiting the activity of ALDH1A3 or inhibiting the expression of ALDH1A3; inhibiting retinoic acid synthesis; inhibiting the transcription of skin barrier function genes. When AhR or the AhR signaling pathway is inhibited, not only can the activity or expression of ALDH1A3 be inhibited, but also the synthesis of retinoic acid participated by ALDH1A3 can be inhibited, and further inhibit the transcription of skin barrier function genes.

[0015] According to an embodiment of the present invention, the reagent includes at least one selected from IK-175, BAY-2416964, and CH223191.

[0016] According to an embodiment of the present invention, the reagent includes siRNA, shRNA, or CRISPR / Cas for reducing the expression of AhR.

[0017] According to an embodiment of the present invention, the reagent includes the one having the nucleotide sequence shown in SEQ ID NO:1.

[0018] AGACCGACTTAATACAGAGTTGG (SEQ ID NO:1)

[0019] According to an embodiment of the present invention, the skin barrier function genes are selected from at least one of EPS8, SATB1, KRT14, KRT17, SCEL, KRT4, PTGS1, LYPD1, SOX9, IVL, KRT6A, COL6A3, and SPRR1B.

[0020] In the second aspect of the present invention, the present invention provides a method for regulating the expression or activity of ALDH1A3 protein. According to an embodiment of the present invention, the method includes performing a regulation process on the AhR signaling pathway.

[0021] According to an embodiment of the present invention, the method for regulating the expression or activity of ALDH1A3 protein may further include at least one of the following additional technical features:

[0022] According to an embodiment of the present invention, the regulation process on the AhR signaling pathway is achieved by regulating AhR.

[0023] According to an embodiment of the present invention, the regulation process includes an activation process or an inhibition process.

[0024] According to an embodiment of the present invention, the activation treatment is achieved by an activator, and the activator is selected from benzopyrene, benzocarbazole, ITE, 3-indole methanol, β-naphthoflavone, VAF347 or L-kynurenine.

[0025] According to an embodiment of the present invention, the inhibition treatment is achieved by an inhibitor.

[0026] According to an embodiment of the present invention, the inhibitor is selected from IK-175, BAY-2416964 or CH223191.

[0027] According to an embodiment of the present invention, when the AhR signaling pathway is activated, the expression of ALDH1A3 protein is up-regulated or the activity of ALDH1A3 is increased.

[0028] According to an embodiment of the present invention, when the AhR signaling pathway is inhibited, the expression of ALDH1A3 protein is down-regulated or the activity of ALDH1A3 is decreased.

[0029] In the third aspect of the present invention, the present invention provides a method for regulating retinoic acid synthesis. According to an embodiment of the present invention, the method includes performing a regulation treatment on the AhR signaling pathway.

[0030] According to an embodiment of the present invention, the method for regulating retinoic acid synthesis may further include at least one of the following additional technical features:

[0031] According to an embodiment of the present invention, the regulation treatment on the AhR signaling pathway is achieved by regulating AhR.

[0032] According to an embodiment of the present invention, the regulation treatment includes an activation treatment or an inhibition treatment.

[0033] According to an embodiment of the present invention, the activation treatment is achieved by an activator, and the activator is selected from benzopyrene, benzocarbazole, ITE, 3-indole methanol, β-naphthoflavone, VAF347 or L-kynurenine.

[0034] According to an embodiment of the present invention, the inhibition treatment is achieved by an inhibitor.

[0035] According to an embodiment of the present invention, the inhibitor is selected from IK-175, BAY-2416964 or CH223191.

[0036] According to an embodiment of the present invention, when the AhR signaling pathway is activated, the synthesis of retinoic acid is promoted.

[0037] According to an embodiment of the present invention, when the AhR signaling pathway is inhibited, the synthesis of retinoic acid is inhibited.

[0038] In a fourth aspect of the present invention, the present invention provides a method for regulating the transcription of skin barrier function genes. According to an embodiment of the present invention, the method includes performing a regulation process on the AhR signaling pathway.

[0039] According to an embodiment of the present invention, the method for regulating the transcription of skin barrier function genes may further include at least one of the following additional technical features:

[0040] According to an embodiment of the present invention, the regulation process on the AhR signaling pathway is achieved by regulating AhR.

[0041] According to an embodiment of the present invention, the regulation process includes an activation process or an inhibition process.

[0042] According to an embodiment of the present invention, the activation process is achieved by an activator selected from benzopyrene, dibenzo[c,g]carbazole, ITE, 3-indolemethanol, β-naphthoflavone, VAF347, or L-kynurenine.

[0043] According to an embodiment of the present invention, the inhibition process is achieved by an inhibitor.

[0044] According to an embodiment of the present invention, the inhibitor is selected from IK-175, BAY-2416964, or CH223191.

[0045] According to an embodiment of the present invention, when the AhR signaling pathway is activated, the transcription of skin barrier function genes is promoted.

[0046] According to an embodiment of the present invention, when the AhR signaling pathway is inhibited, the transcription of skin barrier function genes is inhibited.

[0047] According to an embodiment of the present invention, the skin barrier function genes are selected from at least one of EPS8, SATB1, KRT14, KRT17, SCEL, KRT4, PTGS1, LYPD1, SOX9, IVL, KRT6A, COL6A3, and SPRR1B.

[0048] It should be noted that the "method for regulating the expression or activity of ALDH1A3 protein", "method for regulating retinoic acid synthesis", and "method for regulating the transcription of skin barrier function genes" described in the present invention can be applied to in vitro studies (such as studying the relationship between the AhR signaling pathway and the expression of ALDH1A3 protein in cells, studying the relationship between the AhR signaling pathway and retinoic acid synthesis in cells, studying the relationship between the AhR signaling pathway and the transcription of skin barrier function genes in cells), scientific research, etc.

[0049] In the fifth aspect of the present invention, there is provided the use of an activator of AhR in the preparation of a drug for promoting skin barrier integrity. As described above, activating AhR can not only promote the expression of ALDH1A3, but also promote retinoic acid synthesis and the transcription of skin barrier function genes. The increase in retinoic acid can not only promote the transcription of skin barrier function genes but also promote skin barrier integrity.

[0050] Additional aspects and advantages of the present invention will be given in part in the following description, become apparent in part from the following description, or be learned through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the following description of embodiments in conjunction with the accompanying drawings, in which:

[0052] Figure 1 is a gel electrophoresis diagram showing that BaP activates AhR to up-regulate the expression of ALDH1A3 according to an embodiment of the present invention;

[0053] Figure 2 is a graph showing the dose-effect dependence of BaP on the transcriptional regulation of ALDH1A3 through AhR according to an embodiment of the present invention (where WT: wild cell line; KO: AhR knockout cell line. **: P < 0.01; ***: P < 0.001);

[0054] Figure 3 is a graph showing the dose-effect dependence of FICZ on the transcriptional regulation of ALDH1A3 through AhR according to an embodiment of the present invention (where WT: wild cell line; KO: AhR knockout cell line. **: P < 0.01; ***: P < 0.001);

[0055] Figure 4 is a graph showing the results of BaP and FICZ regulating the intracellular concentration of all-trans retinoic acid (atRA) through AhR according to an embodiment of the present invention, where

[0056] Retinal was added in A;

[0057] Retinol was added in B;

[0058] Figure 5 is a graph showing the results of the BaP-AhR-atRA pathway leading to epidermal thickening in mouse keratinocytes according to an embodiment of the present invention, where

[0059] The mouse in A is an AhR + / + mouse and AhR - / - mouse;

[0060] The mouse in B is an AhR+ / + K14-cre mice and AhR - / - K14-cre mice;

[0061] Figure 6 It is the gene expression map related to skin barrier function after BaP-treated HaCaT cells according to the embodiments of the present invention. Detailed implementation manners

[0062] The embodiments of the present invention will be described in detail below. The following described embodiments are exemplary and are only used to explain the present invention, and should not be construed as a limitation to the present invention. For those not specified in the embodiments regarding specific technologies or conditions, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For the reagents or instruments not specified for the manufacturers, they are all conventional products that can be obtained through commercial purchases.

[0063] Example 1: New target ALDH1A3 of AhR signaling pathway

[0064] Previously, the inventors successfully constructed an AhR-specific knockout human keratinocyte cell line (HaCaT) by CRISPR / Cas9 technology, or the immortalized human keratinocyte cell line HaCaT was purchased from the China Center for Type Culture Collection (Wuhan, China). High-affinity ligands benzo[a]pyrene (BaP, 1 μM) or 6-formylindolo[3,2-b]carbazole (FICZ, 100 nM) were added to stimulate the wild cell line (WT cell line) and AhR knockout cell line (KO cell line) respectively. After 6 hours of cell stimulation, transcriptomic sequencing was performed. The RNA-seq results showed that the expression of ALDH1A3 was significantly down-regulated in AhR knockout cells. This result was verified in WB ( Figure 1 ). The experimental results showed that after BaP treatment of the wild cell line (AhR + / + , WT cell line), the protein expression level of ALDH1A3 increased significantly; while the expression of ALDH1A3 in the AhR knockout cell line (AhR - / - , KO cell line) did not change significantly. At the same time, in the AhR reconstituted cell line (AhR - / - _pAhR), with the increase of AhR expression, the protein expression level of ALDH1A3 also recovered significantly; and the expression of ALDH1A3 protein after BaP stimulation was significantly increased relative to the wild cell line. This indicates that BaP can activate AhR to induce the expression of ALDH1A3 protein.

[0065] After stimulating HaCat cells with BaP and FICZ respectively, the experimental results of the expression level of ALDH1A3 mRNA relative to GAPDH are as Figure 2 and Figure 3As shown: BaP and FICZ can activate AhR and induce the expression of ALDH1A3, and the expression level of ALDH1A3 shows obvious time and dose dependence with the increase of time and the doses of BaP and FICZ.

[0066] Example 2: Promotion of AhR-dependent retinoic acid synthesis through the new target ALDH1A3

[0067] Wild-type cell lines (WT cell lines) and AhR knockout cell lines (KO cell lines) were respectively stimulated with the affinity ligands benzo[a]pyrene (BaP, 1 μM) or 6-formylindolo[3,2-b]carbazole (FICZ, 100 nM). After 24 h of stimulation, 10 μM retinal or retinol, the substrates of ALDH1A3, were added and the cells were incubated in the dark for 6 h. The concentration of retinoic acid (RA) in the cells was detected by liquid chromatography-mass spectrometry (LC-MS). The results are as Figure 4 shown. After stimulation with BaP and FICZ, the synthesis of all-trans retinoic acid (atRA) dependent on AhR can be promoted; the concentration of retinoic acid in the rescued cell line (KO-WT) increased significantly.

[0068] Example 3: In vivo experiments in mice

[0069] In the in vitro cell experiments of Example 1 and Example 2, it was found that after stimulating cells with BaP or FICZ, the expression of ALDH1A3 can be upregulated through AhR, and then the synthesis of atRA in the cells is increased. Next, the above signal pathway was further verified in a mouse model. The mice were divided into 4 groups, including 2 groups of WT (AhR + / + ) mice and 2 groups of AhR - / - mice, with 5-6 mice in each group. BaP or FICZ was applied to the skin of the 4 groups of mice respectively (where BaP (33.3 mg / kg) was applied to the skin of mice for 7 days, and FICZ (0.01%) was applied to the skin of mice for 7 days), and the epidermal thickness of the mice was detected. The experimental results are as Figure 5 shown in A. BaP can increase the epidermal thickness of WT (AhR + / + ) mice through AhR and regulate the proliferation and differentiation of mouse skin.

[0070] Then, K14-cre conditional knockout mice were used for further verification. The K14-cre conditional knockout mice were divided into 4 groups, including 2 groups of AhR + / + K14-cre and 2 groups of AhR - / - K14-cre. The above operations were repeated to further confirm that BaP can increase the epidermal thickness of mice by activating AhR in keratinocytes. The experimental results are as Figure 5 shown in B. BaP can increase AhR + / +The epidermal thickness of &K14-cre mice regulates skin proliferation and differentiation in mice.

[0071] Example 4: Regulating the expression of skin barrier function genes by stimulating the AhR pathway

[0072] HaCaT cells were treated with benzo[a]pyrene (BaP, 1 μM) for 24 h, and then the cells were harvested for RNA extraction. The results of RNA-seq are as Figure 6 shown, indicating that BaP activation of AhR can regulate the expression of genes related to skin barrier function. Among them, EPS8, SATB1, KRT14, KRT17, SCEL, KRT4, PTGS1, LYPD1, SOX9, IVL, KRT6A, COL6A3, and SPRR1B were up-regulated, while GRHL3, SOCS1, PTGS2, PPL, OCLN, PTCH1, and OVOL1 were down-regulated.

[0073] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0074] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. Use of a reagent in the preparation of a product, wherein the reagent is used to regulate AhR or the AhR signaling pathway, and the product is used for at least one of the following: Regulating ALDH1A3; Regulating retinoic acid synthesis; Regulating the transcription of skin barrier function genes.

2. The use according to claim 1, characterized in that, The reagent is used to activate or overexpress AhR or activate the AhR signaling pathway, and the product is used for at least one of the following: Activating ALDH1A3 or promoting the expression of ALDH1A3; Promoting retinoic acid synthesis; Promoting the transcription of skin barrier function genes; Optionally, the reagent comprises at least one selected from benzo[a]pyrene, dibenzo[a,h]carbazole, ITE, 3-indolemethanol, β-naphthoflavone, VAF347, and L-kynurenine; Optionally, the skin barrier function genes are selected from at least one of EPS8, SATB1, KRT14, KRT17, SCEL, KRT4, PTGS1, LYPD1, SOX9, IVL, KRT6A, COL6A3, and SPRR1B; Optionally, the product is selected from drugs, skin care products, or health care products.

3. The use according to claim 1, characterized in that, The reagent is used to inhibit the activity of AhR or reduce the expression of AhR or inhibit the AhR signaling pathway, and the product is used for at least one of the following: Inhibiting the activity of ALDH1A3 or inhibiting the expression of ALDH1A3; Inhibiting retinoic acid synthesis; Inhibiting the transcription of skin barrier function genes; Optionally, the reagent comprises at least one selected from IK-175, BAY-2416964, and CH223191; Optionally, the reagent comprises siRNA, shRNA, or CRISPR / Cas for reducing the expression of AhR; Optionally, the reagent comprises the nucleotide sequence shown in SEQ ID NO:1; Optionally, the skin barrier function genes are selected from at least one of EPS8, SATB1, KRT14, KRT17, SCEL, KRT4, PTGS1, LYPD1, SOX9, IVL, KRT6A, COL6A3, and SPRR1B.

4. A method for regulating the expression or activity of ALDH1A3 protein, characterized in that, Including performing a regulation treatment on the AhR signaling pathway.

5. A method for regulating retinoic acid synthesis, characterized in that, Including performing a regulation treatment on the AhR signaling pathway.

6. A method for regulating the transcription of genes related to skin barrier function, characterized in that, Including performing a regulation treatment on the AhR signaling pathway.

7. The method according to any one of claims 4 to 6, characterized in that The regulation treatment on the AhR signaling pathway is achieved by regulating AhR; Optionally, the regulation treatment includes an activation treatment or an inhibition treatment; Optionally, the activation treatment is achieved by an activator, and the activator is selected from benzo[a]pyrene, dibenzo[a,h]carbazole, ITE, 3-indolemethanol, β-naphthoflavone, VAF347, or L-kynurenine; Optionally, the inhibition treatment is achieved by an inhibitor, and the inhibitor is selected from IK-175, BAY-2416964, or CH223191.

8. The method according to any one of claims 4 to 6, characterized in that When the AhR signaling pathway is activated, the expression of ALDH1A3 protein is upregulated or the activity of ALDH1A3 is increased; Optionally, when the AhR signaling pathway is activated, the synthesis of retinoic acid is promoted; Optionally, when the AhR signaling pathway is activated, the transcription of skin barrier function genes is promoted; Optionally, the skin barrier function gene is selected from at least one of EPS8, SATB1, KRT14, KRT17, SCEL, KRT4, PTGS1, LYPD1, SOX9, IVL, KRT6A, COL6A3, and SPRR1B.

9. The method according to any one of claims 4 to 6, characterized in that, When the AhR signaling pathway is inhibited, the expression of ALDH1A3 protein is down-regulated or the activity of ALDH1A3 decreases; Optionally, when the AhR signaling pathway is inhibited, the synthesis of retinoic acid is inhibited.

10. Use of an activator of AhR in the preparation of a drug for promoting skin barrier integrity.

Citation Information

Patent Citations

  • device for actuating the brakes on bicycles.

    CH223191A