PRRSV monoclonal antibody and Tibetan pig semen ELISA detection kit thereof
By developing monoclonal antibody 7D12 and ELISA detection kits that specifically recognize PRRSV, the problem of PRRSV detection in Tibetan pig semen was solved, and a fast, simple and efficient detection effect was achieved, reducing the economic losses of Tibetan pig breeding industry.
Patent Information
- Application Number
- CN202510417123.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-04-03
AI Technical Summary
The prior art is difficult to effectively detect the pig breeding and respiratory syndrome virus (PRRSV) in Tibetan pig semen, resulting in economic losses and health threats to the Tibetan pig breeding industry.
A monoclonal antibody 7D12 that specifically recognizes PRRSV is provided, and an ELISA detection kit is developed, including coating enzyme label plate, blocking solution, sperm washing solution, enzyme label secondary antibody, washing solution, color developer and terminating solution, to specifically identify and detect PRRSV in Tibetan pig semen.
It realizes rapid, simple, high sensitivity and high specificity detection of PRRSV in Tibetan pig semen, and can process large batches of samples at the same time, reduce production costs, and improve the economic benefits of Tibetan pig breeding industry.
Smart Images

Figure CN120248104A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and specifically relates to a PRRSV monoclonal antibody and a Tibetan pig semen ELISA detection kit thereof. Background Art
[0002] The widespread prevalence of porcine reproductive and respiratory syndrome (PRRS) has caused serious economic losses to the pig farming industry and affected the sustainable development of the farming industry. Porcine reproductive and respiratory syndrome has a profound impact on many aspects of the pig farming industry, and its harm is mainly manifested in reduced production performance, reproductive problems, increased mortality, and economic losses. The growth rate of pigs infected with PRRS slows down by 10% to 20%, resulting in longer time to market, increased feeding costs, and reduced production efficiency. Studies have found that PRRS infection causes fetal maceration, stillbirth, and premature birth in sows, resulting in a 15% to 30% reduction in the number of litters, which seriously affects reproductive performance. In addition, since PRRS infection reduces the immunity of pigs, the mortality rate may increase by 5% to 15%, aggravating the losses and pressure of farmers. In terms of economic losses, depending on the region and size of the farm, PRRS infection may cause farmers to lose between $10 and $30 per pig. Therefore, scientific and effective preventive measures and management practices are an urgent need to ensure the sustainable development of the pig farming industry.
[0003] Tibetan pigs are raised in high altitude areas such as the Tibet Autonomous Region of my country. They have the advantages of being able to adapt to the cold and hypoxic climate of the plateau and having good meat quality. They are grazing pigs that can adapt to the cold and hypoxic climate of the plateau and extensive feeding and management conditions. They have the characteristics of small litters, slow growth, and good meat quality. The crude protein content, unsaturated fatty acid content and essential fatty acid content in the muscle are high. They are a kind of health meat that meets the needs of modern consumption. As the origin and main production area of Tibetan pigs, Linzhi has vigorously developed the Tibetan pig industry in recent years, and its status as a core area of Tibetan pig production has been highlighted. However, with the continuous expansion of the scale of Tibetan pig farming, the harm caused by PRRS is also expanding. It has become one of the diseases that cause reproductive obstacles in large-scale pig farms, posing a certain threat to the healthy development of the Tibetan pig farming industry. At present, there are relatively few reports on Tibetan pig PRRS, and it is urgent to carry out Tibetan pig PRRS prevention and control work, including PRRS serological epidemiological surveys. Carrying out Tibetan pig semen purification work can not only improve the utilization rate of excellent Tibetan pig boars, improve the conception rate and litter size of sows, but also reduce the number of breeding boars, thereby reducing production costs. At the same time, it can also avoid the spread of diseases through mating, thereby improving the economic benefits of pig production. Summary of the invention
[0004] To solve the above technical problems, the present invention provides a PRRSV monoclonal antibody, which can specifically bind to PRRSV.
[0005] Furthermore, based on this antibody, the present invention provides a detection reagent for rapidly detecting PRRSV in Tibetan pig semen.
[0006] Furthermore, for the monoclonal antibody 7D12 that specifically recognizes PRRSV, the amino acid sequence of its light chain variable region is: DIVMTQALSNPVTSASLGSSC RSKSLLHIRNYTSLF WYLQPDGTPQLLIY QMSLHLAS GVPDRFSSSGSGTDFTLRISSLTISNLDQC AQNNTLPYT FGGGTRVLEIK (SEQ ID NO.1), where the underlines are LCDR1 - 3;
[0007] Its nucleotide sequence is:
[0008] gatattgtgatgacccaggcgctgagcaacccggtgaccagcgcgagcctgggcagcagctgccgcagcaaaagcctgctgcatattcgcaactataccagcctgttttggtatctgcagccggatggcaccccgcagctgctgatttatcagatgagcctgcatctggcgagcggcgtgccggatcgctttagcagcagcggcagcggcaccgattttaccctgcgcattagcagcctgaccattagcaacctggatcagtgcgcgcagaacaacaccctgccgtatacctttggcggcggcacccgcgtgctggaaattaaa (SEQ ID NO.3);
[0009] The amino acid sequence of its heavy chain variable region is:
[0010] EVQLVESGGGLVGSLKLSCALSCASGF TFSYGMS WVRQTPEKRRLELWVA TISRGTYPSYSNSG RFTIDNAKAKTLYLQMSLMNSLRSYYCTR EGIFFNFYVEYSAMY WGQTTLTVSS (SEQ ID NO.2), where the underlines are HCDR1 - 3;
[0011] Its nucleotide sequence is:
[0012] gaagtgcagctggtggaaagcggcggcggcctggtgggcagcctgaaactgagctgcgcgctgagctgcgcgagcggctttacctttagctatggcatgagctgggtgcgccagaccccggaaaaacgccgcctggaactgtgggtggcgaccattagccgcggcacctatccgagctatagcaacagcggccgctttaccattgataacgcgaaagcgaaaaccctgtatctgcagatgagcctgatgaacagcctgcgcagctattattgcacccgcgaaggcattttttttaacttttatgtggaatatagcgcgatgtattggggccagaccaccctgaccgtgagcagc(SEQ ID NO.4).
[0013] Furthermore, the antibody can be modified with a label; the label is preferably an enzyme, a fluorescein, a chemiluminescent substance or a fluorescence;
[0014] Furthermore, the present invention also provides a product for detecting PRRSV in a sample, the product comprising the above monoclonal antibody, preferably, the sample is a semen sample of Tibetan pigs.
[0015] Furthermore, the product is an ELISA detection kit, and the kit includes a coated enzyme-linked immunosorbent assay (ELISA) plate, a blocking solution, a sperm washing solution, an enzyme-labeled secondary antibody, a washing solution, a chromogenic agent, and a termination solution, wherein,
[0016] Coated ELISA plate: Dilute the monoclonal antibody 7D12 to 1.0 μg / mL with CBS buffer (0.05 M carbonate-bicarbonate buffer, pH 9.6), take 100 μL to coat a 96-well ELISA plate, and coat overnight at 4°C. After taking it out the next day, wash the plate 3 times with PBST, 3 minutes each time. Use 1% BSA prepared with PBST solution as the blocking solution, add 100 μL of the blocking solution to each well, and block at 37°C for 1 h. After the blocking is completed, wash the plate 3 times with PBST, 3 minutes each time. Pack it into a special packaging bag for 96-well ELISA plates, seal it with a sealer and store it at 4°C.
[0017] The monoclonal antibody 7D12 labeled with horseradish peroxidase is used as the enzyme-labeled antibody;
[0018] Sperm washing solution: Calculated based on a 1 L system, it is 25-35 g of Tris, 8-11 g of citric acid, 8-15 g of glucose, and 3-8 mM of cysteine;
[0019] Washing solution (25×PBST): 100.0 g of NaCl, 0.2 g of KCl, 2.5 g of MgCl₂·6H₂O, 5.0 g of KH₂PO₄, 28.5 g of Na₂HPO₄, 12.5 mL of Tween-20, 2.5 g of thimerosal. Make up to 1000 mL with distilled water, add 0.02% sodium azide as preservative, filter through bacteria removal and dispense into aliquots;
[0020] Blocking solution (1% BSA): Dissolve 1.0 g of bovine serum albumin in 100 mL of washing solution;
[0021] TMB chromogenic solution;
[0022] Stop solution: Take 54.3 mL of concentrated sulfuric acid with a concentration of 95% and make up to 1000 mL with distilled water;
[0023] Positive control: Tibetan pig PRRSV positive serum;
[0024] Negative control: Weigh an appropriate amount of BSA and dissolve it in PBS solution to a concentration of 2 μg / mL. Add 1000 IU of penicillin and streptomycin per milliliter, filter through bacteria removal and make it into powder as the negative control.
[0025] Furthermore, the present invention provides an ELISA detection method for PRRSV in Tibetan pig semen for non-diagnostic purposes, specifically as follows:
[0026] 1) Take an enzyme-labeled plate. After diluting the washing solution with distilled water, wash the plate once (200 μl / well, place at room temperature for 5 min) and then pat dry;
[0027] 2) Add the sample to be tested, 100 μl / well, set positive control and negative control, and incubate at 37 °C for 1 h;
[0028] 3) Discard the sample solution to be tested,
[0029] 4) After patting the enzyme-labeled plate dry, add HRP-labeled antibody, diluted 1:3000, 100 μl / well, and place at 37 °C for 1 h;
[0030] 5) Discard the enzyme-labeled antibody, add the washing solution, 200 μl / well, wash 3 times, 3 min each time;
[0031] 6) Add 50 μl each of freshly prepared substrate solutions A and B to each well, and develop color at room temperature in the dark for 10 min;
[0032] 7) Terminate the reaction: Add 50 μl of stop solution to each well to terminate the reaction; immediately read the absorbance value of each well at OD450nm on an enzyme-labeled immunosorbent assay reader. The condition for the ELISA test to be valid is that the OD value of the positive control is greater than 0.8 and the OD value of the negative control is less than 0.2. The positive control and negative control must be controlled within this range, otherwise the test result is invalid.
[0033] Beneficial effects
[0034] The monoclonal antibody 7D12 that specifically recognizes PRRSV provided by the present invention can specifically recognize PRRSV in the semen of Tibetan pigs. The ELISA detection method containing the above antibody is easy to operate, can quickly detect a large number of samples simultaneously, has the characteristics of high sensitivity, high specificity, short detection time, and wide detection sample range. Brief description of the drawings
[0035] Figure 1 In the specificity test of the kit, the results showed that the detection of PPRSV was positive, while the detection results of other major viral diseases in the pig population were all negative. Examples
[0036] The content of the present invention will be described in detail below with reference to specific drawings and examples. The following examples are only the preferred embodiments of the present invention. It should be noted that the following description is only for explaining the present invention and does not impose any form of limitation on the present invention. Any simple modification, equivalent change and modification made to the embodiments based on the technical essence of the present invention are all within the scope of the technical solution of the present invention.
[0037] In the following examples, the materials, plasmids, reagents, etc. used are all obtained from commercial sources unless otherwise specified.
[0038] Example 1 Screening and identification of the monoclonal antibody 7D12 that specifically recognizes PRRSV
[0039] According to the early research results, ORF5 amplification primers were designed and synthesized (ORF5-F:
[0040] ATGTTGCGGAAATGCTAGACC; ORF5-R: CTACAATCGACGCCATTGTTC). RNA in the diseased material was extracted using a viral RNA extraction kit and reverse transcribed into cDNA, and PCR amplification was performed using the above ORF5 specific primers. The GP5 protein was expressed and purified. After affinity purification by Ni-NTA-His column, a high-purity protein was obtained. Using the purified GP5 protein of PRRSV as an immunogen, the monoclonal antibody 7D12 was screened and identified by conventional methods. The sequence determination was carried out, and the sequencing results showed that the amino acid sequence of its light chain variable region was:
[0041] DIVMTQALSNPVTSASLGSSC RSKSLLHIRNYTSLF WYLQPDGTPQLLIY QMSLHLAS GVPDRFSSSGSGTDFTLRISSLTISNLDQC AQNNTLPYTFGGGTRVLEIK (SEQ ID NO.1), where the underlined parts are LCDR1-3. Specifically, LCDR1 is RSKSLLHIRNYTSLF (SEQ ID NO.5); LCDR2 is QMSLHLAS (SEQ ID NO.6); LCDR3 is AQNNTLPYT (SEQ ID NO.7);
[0042] Its nucleotide sequence is:
[0043] gatattgtgatgacccaggcgctgagcaacccggtgaccagcgcgagcctgggcagcagctgccgcagcaaaagcctgctgcatattcgcaactataccagcctgttttggtatctgcagccggatggcaccccgcagctgctgatttatcagatgagcctgcatctggcgagcggcgtgccggatcgctttagcagcagcggcagcggcaccgattttaccctgcgcattagcagcctgaccattagcaacctggatcagtgcgcgcagaacaacaccctgccgtatacctttggcggcggcacccgcgtgctggaaattaaa (SEQ ID NO.3);
[0044] The amino acid sequence of its heavy chain variable region is:
[0045] EVQLVESGGGLVGSLKLSCALSCASGF TFSYGMS WVRQTPEKRRLELWVA TISRGTYPSYSNSG RFTIDNAKAKTL YLQMSLMNSLRSYYCTR EGIFFNFYVEYSAMY WGQTTLTVSS (SEQ ID NO.2), where the underlined parts are HCDR1-3. Specifically, HCDR1 is TFSYGMS (SEQ ID NO.8); HCDR2 is TISRGTYPSYSNSG (SEQ IDNO.9); HCDR3 is EGIFFNFYVEYSAMY (SEQ ID NO.10);
[0046] Its nucleotide sequence is:
[0047] gaagtgcagctggtggaaagcggcggcggcctggtgggcagcctgaaactgagctgcgcgctgagctgcgcgagcggctttacctttagcta
[0048] tggcatgagctgggtgcgccagaccccggaaaaacgccgcctggaactgtgggtggcgaccattagccgcggcacctatccgagctatagc
[0049] aacagcggccgctttaccattgataacgcgaaagcgaaaaccctgtatctgcagatgagcctgatgaacagcctgcgcagctattattgcacccgcgaaggcattttttttaacttttatgtggaatatagcgcgatgtattggggccagaccaccctgaccgtgagcagc(SEQ ID NO.4). For specific operations, please refer to the previous basic application of this application (CN2025103557710).
[0050] Example 2 Establishment and Optimization of ELISA Detection Method in Tibetan Pig Semen
[0051] Coating the ELISA plate: Dilute the monoclonal antibody 7D12 with CBS buffer (0.05M carbonate-bicarbonate buffer, pH 9.6). Take 100 μL and coat a 96-well ELISA plate, and incubate overnight at 4°C. After taking it out the next day, wash the plate 3 times with PBST, 3 minutes each time. Use 1% BSA prepared with PBST solution as the blocking solution, add 100 μL of the blocking solution to each well, and block at 37°C for 1 h. After the blocking is completed, wash the plate 3 times with PBST, 3 minutes each time. Load it into a special packaging bag for 96-well ELISA plates, seal it with a sealer and store at 4°C.
[0052] The monoclonal antibody 7D12 labeled with horseradish peroxidase is used as the enzyme-labeled antibody;
[0053] Sperm washing solution (calculated based on a 1L system, Tris 25 - 35 g, citric acid 11 - 8 g, glucose 8 - 15 g, cysteine 3 - 8 mM);
[0054] Washing solution (25×PBST): NaCl 100.0 g, KCl 0.2 g, MgCl2·6H2O 2.5 g, KH2PO4 5.0 g, Na2HPO4 28.5 g, Tween-20 12.5 mL, thimerosal 2.5 g, make up the volume to 1000 mL with distilled water, add 0.02% sodium azide as a preservative, filter through bacteria removal and dispense;
[0055] Blocking solution (1% BSA): Dissolve 1.0 g of bovine serum albumin in 100 mL of washing solution;
[0056] TMB chromogenic solution;
[0057] Stop solution: Take 54.3 mL of concentrated sulfuric acid with a concentration of 95% and add distilled water to 1000 mL.
[0058] Positive control: PRRSV positive control serum (provided by the China Institute of Veterinary Drug Control);
[0059] Negative control: Weigh an appropriate amount of BSA and dissolve it in PBS solution to a concentration of 2 μg / mL. Add 1000 IU of penicillin and streptomycin to each milliliter, filter it through bacteria removal, and make it into powder as the positive control.
[0060] Optimization of ELISA detection parameters
[0061] The square matrix method was used to determine the optimal antibody coating concentration and serum dilution ratio. The results showed that the optimal antigen coating concentration was 1.0 μg / mL, and the optimal serum dilution ratio was 1:400 (Table 1).
[0062] Table 1 Determination of the optimal antibody coating concentration and serum dilution ratio
[0063]
[0064] Determine the optimal reaction time. The results showed that the optimal reaction time was 1 h at 37 °C (Table 2).
[0065] Table 2 Optimal reaction time
[0066]
[0067] Determine the optimal working concentration of the enzyme-labeled antibody. The results showed that the optimal working concentration of the enzyme-labeled antibody for ELISA was 1:3000 (Table 3).
[0068] Table 3 Optimal working concentration of the enzyme-labeled antibody for ELISA
[0069]
[0070]
[0071] Determine the optimal working time of the enzyme-labeled secondary antibody. The results showed that the optimal working time of the enzyme-labeled secondary antibody for ELISA was 1 h at 37 °C (Table 4).
[0072] Table 4 Optimal working time of the enzyme-labeled secondary antibody
[0073]
[0074] In summary, the operation steps of the ELISA detection method for PRRSV in Tibetan pig samples were finally determined.
[0075] 1) Take an ELISA plate. After diluting the washing solution with distilled water, wash the plate once (200 μl / well, leave at room temperature for 5 min), and then pat dry.
[0076] 2) Add the sample to be tested, 100 μl / well. Set positive and negative controls, and incubate at 37 °C for 1 h.
[0077] 3) Discard the sample solution to be tested.
[0078] 4) After patting the ELISA plate dry, add the HRP-labeled antibody, diluted 1:3000, 100 μl / well, and place at 37 °C for 1 h.
[0079] 5) Discard the enzyme-labeled antibody, add the washing solution, 200 μl / well, and wash 3 times, 3 min each time.
[0080] 6) Add 50 μl each of freshly prepared substrate solutions A and B to each well, and develop color at room temperature in the dark for 10 min.
[0081] 7) Terminate the reaction: Add 50 μl of the termination solution to each well to terminate the reaction; immediately read the absorbance value of each well at OD450nm on an ELISA reader. The conditions for a valid ELISA test are that the OD value of the positive control is greater than 0.8, and the OD value of the negative control is less than 0.2. The positive and negative controls must be within this range, otherwise the test results are invalid.
[0082] Sensitivity test of the kit
[0083] After serially diluting the positive reference serum 1:2 to 1:32, take 50 μL of each dilution and add it to the antigen-coated wells, and then add 50 μL of the monoclonal antibody diluted as required by the kit. The inhibition rate (PI) of the positive reference serum after 1:32 dilution is ≥ 30%. At the same time, set strong positive serum control, weak positive serum control, negative serum control, and serum blank control. Each sample is made into 2 parallel wells. The PI of the strong positive control serum is between 80% and 110%; the PI of the weak positive control serum is between 30% and 70%; the PI of the negative control serum is between 10% and 15%, and the OD450nm of the blank control is between 0.74 and 2.1.
[0084] After serially diluting 10 portions of PRRSV positive reference serum, perform a sensitivity test on the ELISA detection kit developed in the laboratory. The results show that the maximum dilution factor for detecting positive in the ELISA kit prepared by the present invention for the positive reference serum is 640 - 2560 times (Table 5), indicating that the developed kit has good sensitivity.
[0085] Table 5 Detection results of the ELISA kit for positive reference serum at different dilution degrees
[0086] sample 1:20 1:40 1:80 1:160 1:320 1:640 1:1280 1:2560 1:5120 1 + + + + + + - - - 2 + + + + + + + - - 3 + + + + + + + - - 4 + + + + + + + + - 5 + + + + + + - - - 6 + + + + + + + + - 7 + + + + + + - - - 8 + + + + + + + - - 9 + + + + + + + + - 10 + + + + + + - - -
[0087] After ten PRRSV-positive reference semen samples were serially diluted, the sensitivity of the ELISA test kit developed in the laboratory was tested. The results showed that the maximum dilution factor at which the ELISA kit prepared in the present invention could detect positive reference semen was 80 - 320 times (Table 6), indicating that the developed kit could be used for semen detection and met the requirements of clinical diagnostic kits.
[0088] Table 6 Detection results of ELISA kit for positive reference semen at different dilution ratios
[0089] sample 1:10 1:20 1:40 1:80 1:160 1:320 1:640 1 + + + + + + - 2 + + + + + - - 3 + + + + + + - 4 + + + + + - - 5 + + + + + + - 6 + + + + + + - 7 + + + + + - - 8 + + + + + - - 9 + + + + + - - 10 + + + + + + -
[0090] Repeatability test: The results of the repeatability test showed that the highest within-batch coefficient of variation of ELISA was 2.47%, and the highest between-batch coefficient of variation for different batches was 4.12%, both less than 5% (Table 7). This indicates that the established ELISA method has high repeatability.
[0091] Table 7 ELISA repeatability test
[0092] sample within-batch coefficient of variation between-batch coefficient of variation S1 0.98 1.98 S2 2.47 2.75 S3 1.94 3.75 S4 0.84 4.12 S5 1.07 1.14
[0093] Kit specificity test
[0094] The kit was tested with porcine foot-and-mouth disease virus (FMDV), porcine parvovirus (PPV), classical swine fever virus (HCV), Japanese encephalitis virus (JEV), porcine circovirus (PCV), pseudorabies virus (PRV), and swine influenza virus (SIV), using the positive and negative controls of this kit as references. The results (see Figure 1 ) showed that the kit of the present invention had good specificity (positive for PPRSV detection and negative for the detection of other major viral diseases in the pig population). This indicates that the kit of the present invention has good specificity and can be used for the clinical detection of PRRSV.
[0095] Clinical stability experiment
[0096] The randomly selected test kits of the same batch were divided into two parts. One part was placed in a 4°C refrigerator, and the other part was placed in a 37°C incubator for 15 days and then taken out and placed in a 4°C refrigerator to equilibrate overnight. The stability was detected using a positive control product. The detection results of both were the same, confirming that the kit of this application had good stability.
[0097] The above description of the embodiments is to enable those of ordinary skill in the art to understand and use the present invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative efforts. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention without departing from the scope of the present invention should be within the protection scope of the present invention.
Claims
1. A monoclonal antibody 7D12 that specifically recognizes PRRSV, characterized in that The LCDR1-3 of the light chain variable region of the monoclonal antibody are RSKSLLHIRNYTSLF, QMSLHLAS, and AQNNTLPYT respectively; the HCDR1-3 of the heavy chain variable region are TFSYGMS, TISRGTYPSYSNSG, and EGIFFNFYVEYSAMYWGQTTLTVSS respectively.
2. A product for detecting PRRSV in a sample, the product comprising the monoclonal antibody 7D12 described in claim 1.
3. The product according to claim 2, wherein the product is an ELISA detection kit, and the kit includes a coated enzyme-linked immunosorbent assay (ELISA) plate, a blocking solution, a sperm washing solution, an enzyme-labeled secondary antibody, a washing solution, a chromogenic agent, and a termination solution.
4. The product according to claim 3, wherein Coated ELISA plate: Dilute the monoclonal antibody 7D12 to 1.0 μg / mL with CBS buffer (0.05 M carbonate-bicarbonate buffer, pH 9.6), take 100 μL to coat a 96-well ELISA plate, and coat overnight at 4°C; the next day, take it out and wash the plate 3 times with PBST, 3 minutes each time; use 1% BSA prepared with PBST solution as the blocking solution, add 100 μL of the blocking solution to each well, and block at 37°C for 1 h; after blocking, wash the plate 3 times with PBST, 3 minutes each time; put it into a special packaging bag for 96-well ELISA plates, seal it with a sealer and store at 4°C; The monoclonal antibody 7D12 labeled with horseradish peroxidase is used as the enzyme-labeled antibody; Sperm washing solution: Calculated based on a 1 L system, it is 25-35 g of Tris, 8-11 g of citric acid, 8-15 g of glucose, and 3-8 mM of cysteine; Washing solution (25×PBST): 100.0 g of NaCl, 0.2 g of KCl, 2.5 g of MgCl2·6H2O, 5.0 g of KH2PO4, 28.5 g of Na2HPO4, 12.5 mL of Tween-20, 2.5 g of thimerosal, make up to 1000 mL with distilled water, add 0.02% sodium azide as a preservative, filter through bacteria and dispense; Blocking solution (1% BSA): Dissolve 1.0 g of bovine serum albumin in 100 mL of washing solution; TMB chromogenic solution; Termination solution: Take 54.3 mL of concentrated sulfuric acid with a concentration of 95% and add distilled water to 1000 mL; Positive control: Tibetan pig PRRSV positive serum; Negative control: Weigh an appropriate amount of BSA in PBS solution to prepare a concentration of 2 μg / mL, add 1000 IU of penicillin and streptomycin to each milliliter, filter through bacteria and make it into powder as the positive control.
5. An ELISA detection method for PRRSV in Tibetan pig semen for non-diagnostic purposes, specifically: 1) Take an ELISA plate, after diluting the washing solution with distilled water, wash the plate once (200 μl / well, place at room temperature for 5 min) and then pat dry; 2) Add the sample to be tested, 100 μl / well, set positive and negative controls, and incubate at 37°C for 1 h; 3) Discard the sample solution to be tested, 4) After patting the ELISA plate dry, add the HRP-labeled antibody, diluted 1:3000 times, 100 μl / well, and place at 37°C for 1 h; 5) Discard the enzyme-labeled antibody, add washing solution at 200 μl / well, wash 3 times, 3 min each time; 6) Add 50 μl each of freshly prepared substrate solutions A and B to each well, develop color at room temperature in the dark for 10 min; 7) Terminate the reaction: Add 50 μl of stop solution to each well to terminate the reaction; immediately read the absorbance value of each well at OD450nm on an ELISA reader. The condition for a valid ELISA test is that the OD value of the positive control is greater than 0.8 and the OD value of the negative control is less than 0.2.
Citation Information
Patent Citations
Novel antibody for the diagnosis and / or prognosis of cancer
CN102971343A
Tibetan pig frozen semen detection reagent and application thereof
CN118909103A
Antibody for highly pathogenic porcine reproductive and respiratory syndrome virus, antibody composition and application
CN119930807A
Antibody for detecting multiple antigens
WO2024034543A1