mRNA transcription vector and construction method and application thereof

Abstract

The application belongs to the technical field of biology, and discloses an mRNA transcription vector, which comprises a plasmid and a template skeleton connected to the plasmid, wherein 5'-UTR of the template skeleton is, and 3'-UTR of the template skeleton is, the 5'-UTR is taken from a fragment of mRNA of chicken hemoglobin subunit beta, and the sequence is as shown in SEQ ID NO:1; the 3'-UTR is taken from a fragment of mRNA of chicken hemoglobin subunit beta, and the sequence is as shown in SEQ ID NO:2; the application realizes the improvement of the expression amount of a target gene by using multiple 5'-UTRs and 3'-UTRs taken from fragments of mRNA of chicken hemoglobin subunit beta, and then the expression amount after subsequent use of a vaccine is improved; in addition, the application also discloses a construction method and application of the mRNA transcription vector.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to mRNA transcription vectors, their construction methods, and applications. Background Technology

[0002] The field of mRNA vaccines is developing rapidly. Currently, mRNA vaccines have achieved some research results in treating infectious diseases such as influenza, Ebola, and SARS-CoV-2. The mechanism of action of mRNA vaccines is to directly deliver mRNA into cells, enabling the host to express the target protein in its own cells, a process similar to viral protein expression. This can simultaneously activate both the body's cellular and humoral immune systems. Compared to traditional inactivated vaccines, mRNA vaccines are developed and produced much faster, and they also demonstrate excellent safety. Because mRNA is a non-infectious, non-integrating platform, there is no potential risk of infection or insertional mutagenesis.

[0003] The preparation of RNA vaccines requires the prior construction of a template for an in vitro transcription (IVT) system. The expression effect of mRNA in cells is related to a variety of factors, among which the regulatory sequences 5'UTR and 3'UTR on the mRNA sequence affect the half-life and expression level of mRNA. Therefore, 5'UTR and 3'UTR are crucial to the expression effect of mRNA. Currently, human α-globin or β-globin are mainly used for the 5'UTR and 3'UTR of mRNA.

[0004] Chinese patent application 202310793276.9 discloses a 5'-UTR for regulating high mRNA expression and its application. This method modifies the 5'-UTR sequence of the HBA1 gene encoding human α-globin, and screens for two 5'-UTRs with excellent effects.

[0005] This solution further provides an expression cassette containing the 5'-UTR, recombinant vector, cells, recombinant bacteria, and a method for constructing the vector, as well as the uses of the "AGGAAATA" nucleic acid and the 5'-UTR. The two 5'-UTRs provided in this solution offer high in vitro transcription efficiency and strong versatility, and can be used for the efficient expression and preparation of target gene mRNA, making them suitable for large-scale industrial-scale in vitro mRNA transcription and mRNA production.

[0006] Further observation of the instructions for this protocol reveals: "The first 34 nt of the 5'-UTR sequence of the HBA1 gene encoding human α-globin is selected as the basic backbone. 'AGGAAATA' is added to its 5' end, combined with the addition of a Kozak sequence to the 3' end, or further, 'AGTATT' nucleic acid is inserted after 'ACT' at the 5' end of the 34 nt sequence. This modifies the 5'-UTR sequence of the HBA1 gene encoding human α-globin, resulting in two 5'-UTR sequences with excellent performance: 5'-UTR sequence 2 (AGGAAATAACTCTTCTGGTCCCCACAG ACTCAGAGAGAACCCGCCACCATGG (SEQ ID NO.4)) and 5'-UTR sequence 3 (AGGAAATAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAAC CCGCCACCATGG (SEQ ID NO.4))." IDNO.5); "It can be seen that this scheme improves the expression level of the target gene by modifying the 5'-UTR sequence of human α-globin and obtaining the 5'-UTR after screening, thus obtaining an expression cassette that can improve the expression level of the target gene.

[0007] The problem this solution aims to solve is: how to provide an mRNA transcription vector that differs from existing technologies and can enhance the expression of target genes. Summary of the Invention

[0008] The purpose of this application is to provide an mRNA transcription vector that enhances the expression level of a target gene by using the 5'-UTR and 3'-UTR of multiple mRNA fragments derived from chicken hemoglobin subunit β, thereby improving the ability of the mRNA to express proteins during vaccine preparation.

[0009] To achieve the above objectives, this application discloses an mRNA transcription vector, comprising a plasmid and a template backbone attached to the plasmid;

[0010] Furthermore, the 5'-UTR of the template backbone is a fragment of mRNA from the chicken hemoglobin subunit β, and its sequence is as shown in SEQ ID NO: 1;

[0011] The 3'-UTR of the template backbone is a fragment of mRNA from the chicken hemoglobin subunit β, and its sequence is shown in SE Q ID NO: 2.

[0012] The insertion position of the foreign gene to be loaded in the peripheral device is between the 5'-UTR and the 3'-UTR.

[0013] Preferably, the template backbone further includes a T7 promoter, the exogenous gene to be loaded, and a PolyA tail;

[0014] The T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail are connected in sequence.

[0015] Preferably, the sequence of the T7 promoter is as shown in SEQ ID NO: 3;

[0016] The sequence of the template skeleton is shown in SEQ ID NO: 4.

[0017] Preferably, the plasmid is at least one of pUC57, pUC19, pMD18-T, and pBR322.

[0018] Preferably, the exogenous gene to be loaded is selected from any one of EGFP, HA, E2, and HN.

[0019] Furthermore, this application also discloses a method for constructing the above-mentioned mRNA transcription vector, comprising the following steps:

[0020] Step 1: Connect the T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail sequentially to obtain the template skeleton;

[0021] Step 2: Link the template backbone to the plasmid to obtain the mRNA transcription vector.

[0022] In addition, this application also discloses the use of the mRNA transcription vector described above for preparing mRNA vaccines.

[0023] The beneficial effects of this application are:

[0024] This application provides an mRNA transcription vector that enhances the expression level of a target gene by using the 5'-UTR and 3'-UTR of multiple mRNA fragments derived from chicken hemoglobin subunit β, thereby enhancing the ability of mRNA to express proteins and subsequently increasing the expression level after vaccine use. Attached image description:

[0025] Figure 1 This is a schematic diagram of the overall structure of the template skeleton;

[0026] Figure 2 This is a schematic diagram illustrating the construction method and structure of pUC57-cmRNA;

[0027] Figure 3 This is a schematic diagram illustrating the construction method and structure of pUC57-cmRNA-EGFP;

[0028] Figure 4 A comparison of EGFP protein translation intensity after transfection into 293T cells and DF1 cells;

[0029] Figure 5 The results of quantitative determination of fluorescence intensity in 293T cells using an ELISA reader;

[0030] Figure 6 The results show the quantitative determination of fluorescence intensity in DF1 cells using an ELISA reader. Detailed Implementation

[0031] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0032] Example 1

[0033] 1.1 Preparation of the template skeleton

[0034] Specifically, it includes the T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail. The overall structure of the template skeleton is as follows: Figure 1 As shown; the template skeleton was synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0035] The sequence of the T7 promoter is shown in SEQ ID NO: 3:

[0036] SEQ ID NO: 3: TAATACGACTCACTATAAG;

[0037] The 5'-UTR is a fragment of the mRNA of chicken hemoglobin subunit β (provided by Suzhou Hongxun Biotechnology Co., Ltd.), and more specifically, its sequence is shown in SEQ ID NO: 1:

[0038] SEQ ID NO: 1: GCTCAGACCTCCTCCGTACCGACAGCCACACGCTACC CTCCAACCGCCGCC;

[0039] The 3'-UTR consists of the 3'-UTRs of two identical chicken hemoglobin subunit β mRNAs (provided by Suzhou Hongxun Biotechnology Co., Ltd.). The sequence connecting the two 3'-UTRs is CCTGAG, which contains an XhoI restriction site. More specifically, its sequence is shown in SEQ ID NO: 2.

[0040] SEQ ID NO: 2: GCACCAGCACCAAAGATCACGGAGCACCTACAACCA TTGCATGCACCTGCAGAAATGCTCCGGAGCTGACAGCTTGTGACAAATAAA GTTCATTCAGTGACACTCA;

[0041] The sequence connecting the 5'-UTR and 3'-UTR is GGGATCCCGGG, which contains a BamHI and a SmaI restriction site.

[0042] The sequence connecting the 3'-UTR and polyA is GAAGATCTTC, which contains a polyA tail sequence selected by GblII with a total length of 100bp. It is divided into two segments by NsiI. The specific polyA sequence is shown in SEQ ID NO: 5.

[0043] SEQ ID NO: 5:AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ATGCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0044] After polyA, an MluI restriction site is added. The overall template backbone structure is as follows: Figure 1 As shown, the sequence of the template skeleton is as shown in SEQ ID NO: 4:

[0045] SEQ ID NO: 4: GAATTCGCC TAATACGACTCACTATAAG GG GCTCAG ACCTCCTCCGTACCGACAG CCACACGCTACCCTCCAACCGCCGCC GGGATCCCGGG GCACCAGCACCAAAGATCACGGAGCACCTACAACCATTG CATGCACCTGCAGAAATGCTCCGGAGCTGACAGCTTGTGACAAATAAAGTTCATTCAGTGACACTCA CCTCGAG GC ACCAGCACCAAAGATCACGGAGCACCTACAACCATTGCATGCACCTGCAGAAATGCTCCGGAGCTGACAGCTTGTG ACAAATAAAGTTCATTCAGTGACACTCA GAAGATCTTC AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGC ATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CGCGTGAAGCTTG;

[0046] It should be noted that the underlined parts in the template skeleton sequence (SEQ ID NO: 4) are, in order, the T7 promoter, 5'-UTR, 3'-UTR, 3'-UTR, and PolyA tail;

[0047] The remaining bases all serve as linkages.

[0048] Example 2

[0049] Preparation of mRNA transcription vectors

[0050] This embodiment provides an mRNA transcription vector, which is prepared by the following method:

[0051] Step 1: The fragment from Example 1 was double-digested with the pUC57-AMP-GG-nolacz plasmid provided by Suzhou Hongxun Biotechnology Co., Ltd. The digestion products were recovered using EcoRI (Code No.: 1040A) and HindIII (Code No.: 1060A) from Takara.

[0052] Step 2: Use Takara's T4 ligase (Code No.: 2011A) to ligate the double-digested fragment to the digested pUC57-AMP-GG-nolacz.

[0053] Step 3: Transform the ligated plasmid into Stbl3 competent cells, identify the strain, and obtain the recombinant plasmid. Name the recombinant plasmid pUC57-cmRNA. Construction method and structure are as follows: Figure 2 As shown, its nucleotide sequence is shown in SEQ ID NO: 6:

[0054]

[0055] Example 3

[0056] This embodiment provides an mRNA encoding the EGFP protein, which is expressed in vitro. The mRNA is prepared by the following method:

[0057] Step 1: Amplification of the EGFP gene. The EGFP gene was amplified and recovered using the pSBT-mRNA-EGFP-120 plasmid provided by Suzhou Hongxun Biotechnology Co., Ltd.

[0058] Step 2: Digest the EGFP from Step 1 with BamHI restriction enzyme, and simultaneously digest pUC57-cmRNA.

[0059] Step 3: Use T4 ligase to ligate EGFP to pUC57-cmRNA. The new plasmid is named pUC57-cmRNA-EGFP. The plasmid construction method and structure are as follows. Figure 3 As shown.

[0060] Step 4: Transform the ligated plasmid into Stbl3 competent cells, identify the strain, and obtain the plasmid template.

[0061] Step 5: Linearize the plasmid using the MluI restriction enzyme.

[0062] Step 6: Use the EasyCap T7 Co-transcription Kit with CAG Trimer (Cat.No.:DD4203-00) to transcribe pUC57-cmRNA-EGFP to obtain mRNA, which is named cmRNA-EGFP.

[0063] Step 7: Transfect the cells using Thermo Fisher Scientific’s Lipofectamine 2000 transfection reagent. Transfect 4 μg mRNA into each well of a six-well plate, and transfect 293T cells and DF-1 cells respectively.

[0064] Step 8: Detect fluorescence intensity every 12 hours using a fluorescence microscope and ELISA reader.

[0065] Comparative Example 1

[0066] This comparative example provides a comparative template backbone (hmRNA-EGFP), which differs from the template backbone prepared in Example 1 in that the 5'-UTR and 3'-UTR are mRNA fragments of human hemoglobin subunit β. More specifically, the 5'-UTR of the mRNA fragment taken from human hemoglobin subunit β is shown in SEQ ID NO: 7.

[0067] SEQ ID NO: 7: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACC TCAAACAGACACC;

[0068] The 3'-UTR of the mRNA fragment derived from human hemoglobin subunit β is shown in SEQ ID NO: 8;

[0069] SEQ ID NO: 8: GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCC TTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGA GCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC;

[0070] Simultaneously, EGFP was expressed in vitro using the template backbone of Comparative Example 1, and the construction method is as described in Example 3.

[0071] Results Analysis

[0072] observe Figures 4-6 First, combine Figure 4 By observing the translation intensity of EGFP protein after transfection, it was found that in 293T cells, the EGFP protein translation efficiency of the cmRNA-EGFP group was stronger than that of hmRNA-EGFP. In DF1 cells, the EGFP protein translation efficiency of the cmRNA-EGFP group showed a greater advantage compared to hmRNA-EGFP.

[0073] Secondly, combine Figures 5-6 By comparing the fluorescence intensity of EGFP protein in different cells at different times, we found that the fluorescence intensity of both reached its highest level 24 h after transfection. However, the fluorescence intensity of cmRNA-EGFP transfection was significantly higher than that of hmRNA-EGFP. Although the fluorescence intensity of all groups decreased 24 h after transfection, the fluorescence intensity of the cmRNA-EGFP group was still significantly higher than that of the hmRNA-EGFP group until 48 h.

[0074] This demonstrates that using the 5'-UTR and 3'-UTR sequences in the pUC57-cmRNA plasmid significantly improves mRNA translation efficiency compared to using the conventional 5'-UTR and 3'-UTR sequences of human hemoglobin subunit β. The results confirm the superiority of the 5'-UTR and 3'-UTR sequences in the pUC57-cmRNA plasmid.

Claims

1. An mRNA transcription vector, characterized in that, This includes plasmids and template backbones attached to the plasmids; The template skeleton includes a T7 promoter, a 5'-UTR, a 3'-UTR, and a PolyA tail; The sequence of the T7 promoter is shown in SEQ ID NO: 3; Furthermore, the 5'-UTR of the template backbone is a fragment of mRNA from the chicken hemoglobin subunit β, and its sequence is as shown in SEQ ID NO: 1; The 3'-UTR of the template backbone is a fragment of mRNA from the chicken hemoglobin subunit β, and its sequence is shown in SEQ ID NO: 2; The sequence of the template skeleton is shown in SEQ ID NO: 4; The insertion position of the foreign gene to be loaded in the peripheral device is between the 5'-UTR and the 3'-UTR.

2. The mRNA transcription vector according to claim 1, characterized in that, The plasmid is at least one of pUC57, pUC19, pMD18-T, and pBR322.

3. The mRNA transcription vector according to claim 1, characterized in that, The exogenous gene to be loaded is selected from any one of EGFP, HA, E2, and HN.

4. The mRNA transcription vector according to claim 1, characterized in that, The nucleotide sequence of the mRNA transcription vector is shown in SEQ ID NO:

6.

5. A method for constructing the mRNA transcription vector according to any one of claims 2-4, characterized in that, Includes the following steps: Step 1: Connect the T7 promoter, 5'-UTR, 3'-UTR, and PolyA tail sequentially to obtain the template skeleton; Step 2: Link the template backbone to the plasmid to obtain the mRNA transcription vector.

6. Use of the mRNA transcription vector as described in any one of claims 1-4 for preparing mRNA vaccines.

Images