Primer and method for detecting full-length mutation of RPE65 gene

Abstract

The invention discloses a primer and a method for detecting RPE65 gene full-length mutation. The nucleic acid sequence of the primer comprises the sequences as shown in SEQ ID NO. 1 to SEQ ID NO. 6. The invention provides a method for detecting point mutation and large fragment deletion of all exons and introns of the RPE65 gene, variation on the exons and introns can be accurately detected, more molecular biology basic information is provided for occurrence of diseases, a complex genetic mechanism is revealed, and the accuracy and comprehensiveness of diagnosis are improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and relates to a primer and method for detecting full-length mutations of the RPE65 gene. Background Art

[0002] The full length of the RPE65 gene is about 21 kb, containing 14 exons and 13 introns, encoding a retinol isomerohydrolase, which is expressed in retinal pigment epithelial cells (RPE) and converts all-trans retinyl esters into 11-cis retinol, which then forms 11-cis retinal chromophore in the retinoid visual cycle. Mutations in the RPE65 gene lead to reduced or absent hydrolytic activity of the RPE65 isoform, blocking the visual cycle and resulting in impaired vision. Individuals with biallelic RPE65 mutation-related retinal dystrophy experience progressive deterioration of vision over time. This vision loss usually occurs in children or adolescents and eventually progresses to complete blindness.

[0003] In 2017, the US Food and Drug Administration (FDA) approved Spark's AAV gene therapy for the treatment of inherited retinal diseases (IRD) caused by double-copy RPE65 gene mutations, including Leber congenital amaurosis (LCA) and retinitis pigmentosa (RP), to help restore and improve vision. Determining the RPE65 mutation status is a prerequisite for assessing a patient's eligibility for RPE65-targeted gene therapy.

[0004] CN118374592A only detects the c.1003G>T mutation site of the RPE65 gene or the c.355T>C mutation site of the RPE65 gene, and cannot comprehensively cover the full length of the gene.

[0005] By consulting the ClinVar database, harmful mutations and suspected harmful mutations of the RPE65 gene are distributed in different exon regions of the gene.

[0006] Therefore, there is an urgent need to provide an efficient, accurate and comprehensive method for detecting germline mutations of the RPE65 gene to achieve full-length gene coverage and detect unknown mutations. Summary of the Invention

[0007] In view of the deficiencies of the prior art and the actual needs, the present invention provides a primer and method for detecting full-length mutations of the RPE65 gene. The present invention provides a method for detecting point mutations and large fragment deletions in all exons and introns of the RPE65 gene, which can accurately detect variations at exon and intron positions, provide more molecular biological basic information for the occurrence of diseases, help to reveal complex genetic mechanisms, and improve the accuracy and comprehensiveness of diagnosis.

[0008] To achieve the object of the present invention, the present invention adopts the following technical solutions:

[0009] In the first aspect, the present invention provides a primer for detecting full-length mutations of the RPE65 gene, and the nucleic acid sequence of the primer includes the sequences shown in SEQ ID NO.1-SEQ ID NO.6.

[0010] The present invention provides a method for detecting large fragment deletions and point mutations in introns, which can accurately detect variations at intron positions, provide more molecular biological basic information for the occurrence of diseases, help to reveal complex genetic mechanisms, and improve the accuracy and comprehensiveness of diagnosis.

[0011] SEQ ID NO.1: CCCTGAATATCTTCCCATTGCTCTCA.

[0012] SEQ ID NO.2: AGGATTTGAAACTTAATGTGGCTC.

[0013] SEQ ID NO.3: ATGTTCAGGAATTTAGAATTTGGAACT.

[0014] SEQ ID NO.4: CAACATTCTAAGAAGAGAAGACAGGAGA.

[0015] SEQ ID NO.5: CTTGAGTCCAGGAGTTCAAAGTTACA.

[0016] SEQ ID NO.6: CAAGATTCAGCTGAATCTGTAGGT.

[0017] Among them, SEQ ID NO.1 and SEQ ID NO.2 are paired for amplification, SEQ ID NO.3 and SEQ ID NO.4 are paired for amplification, and SEQ ID NO.5 and SEQ ID NO.6 are paired for amplification.

[0018] Preferably, the base at the 3'-end of the primer contains a thiol modification.

[0019] Preferably, 1-2 bases at the 3'-end of the primer contain a thiol modification.

[0020] In the second aspect, the present invention provides the application of the primer for detecting full-length mutations of the RPE65 gene described in the first aspect in the preparation of a product for detecting full-length mutations of the RPE65 gene.

[0021] In a third aspect, the present invention provides a kit for detecting full-length mutations of the RPE65 gene, and the kit includes the primers for detecting full-length mutations of the RPE65 gene as described in the first aspect.

[0022] In a fourth aspect, the present invention provides the use of the primers for detecting full-length mutations of the RPE65 gene as described in the first aspect in detecting full-length mutations of the RPE65 gene.

[0023] In a fifth aspect, the present invention provides a method for detecting full-length mutations of the RPE65 gene for non-disease diagnosis and / or treatment purposes, and the method includes:

[0024] Extracting DNA from a sample to be tested as a template, using the primers for detecting full-length mutations of the RPE65 gene as described in the first aspect to perform PCR amplification on the 5'-UTR to 3'-UTR of the RPE65 gene, constructing a library and sequencing after amplification, and analyzing the sequencing data to obtain full-length mutation information of the RPE65 gene.

[0025] Preferably, the method for detecting full-length mutations of the RPE65 gene in the present invention further includes: when there is a potential large fragment deletion in the RPE65 gene (such as a 20 kb deletion), supplementing the primer pairs of SEQ ID NO.1 - SEQ ID NO.6 for re-amplification.

[0026] Preferably, the sample to be tested includes blood and / or oral swabs.

[0027] As a preferred technical solution, the method for detecting full-length mutations of the RPE65 gene in the present invention includes the following steps:

[0028] (1) Taking the sample to be tested, which is blood or oral swab, and performing genomic DNA extraction;

[0029] (2) Using the primers for detecting full-length mutations of the RPE65 gene as described in the first aspect, PrimeSTAR GXL DNA Polymerase, dNTPs, and buffer to perform three-fragment amplification on the 5'-UTR to 3'-UTR of the RPE65 gene, and the length of each fragment is 9 - 11 kb (such as 9 kb, 10 kb, 11 kb);

[0030] (3) Mixing the amplified DNA fragments in equimolar amounts, fragmenting them by ultrasonic waves, repairing the ends, adding A, ligating tag adapters, and performing PCR amplification to obtain the final library for sequencing;

[0031] (4) Sequencing the library for sequencing on an Illumina Novaseq 6000 high-throughput sequencer with paired-end 100 - 200 bp sequencing (such as 100 bp, 150 bp, 200 bp);

[0032] (5) Use bioinformatics tools to perform data quality control on the sequenced data, align it to the reference genome, detect variants, and annotate them.

[0033] The flow chart of the library preparation of the present invention is shown in Figure 3 .

[0034] Preferably, the reaction conditions for the PCR amplification include: pre-denaturation at 96°C - 98°C (such as 96°C, 97°C, 98°C) for 10 - 20 s (such as 10 s, 15 s, 20 s), 1 cycle; denaturation at 96°C - 98°C (such as 96°C, 97°C, 98°C) for 10 - 20 s (such as 10 s, 15 s, 20 s), annealing at 55°C - 60°C (such as 55°C, 58°C, 60°C) for 15 - 20 s (such as 15 s, 18 s, 20 s), extension at 66°C - 68°C (such as 66°C, 67°C, 68°C) for 100 - 150 s (such as 100 s, 120 s, 150 s), 25 - 30 cycles (such as 25 cycles, 28 cycles, 30 cycles); complete extension at 66°C - 68°C (such as 66°C, 67°C, 68°C) for 5 - 6 min (such as 5 min, 5.5 min, 6 min), 1 cycle, and hold at 4°C.

[0035] The present invention aligns the detected single nucleotide polymorphisms (SNPs) and insertions / deletions (Indels) of the RPE65 gene with known genetic variant databases (such as Clinvar, gnomAD, etc.) to identify the hereditary variant sites in the sample, and classifies and interprets the detected variant sites with reference to the ACMG / AMP guidelines, dividing them into five grades: pathogenic, likely pathogenic, of uncertain significance, likely benign, and benign.

[0036] The specific variant distribution of the RPE65 gene in the Clinvar database in the present invention is as follows: The Clinvar database has collected 436 variants of the RPE65 gene, including 45 frameshift mutations, 295 missense mutations, 37 nonsense mutations, 33 splicing mutations, and 26 UTR mutations.

[0037] In a sixth aspect, the present invention provides a device for detecting full-length mutations of the RPE65 gene, and the device for detecting full-length mutations of the RPE65 gene includes: an extraction module, an amplification module, and a loading module;

[0038] The extraction module is used to perform the following operations: take the blood sample or oral swab to be tested and extract genomic DNA;

[0039] The amplification module is used to perform the following steps: using the primers for detecting the full-length mutation of the RPE65 gene described in the first aspect, PrimeSTAR GXL DNA Polymerase, dNTPs and buffer, amplifying the 5'-UTR to 3'-UTR of the RPE65 gene in three fragments, each of which is 9-11 kb in length, mixing the amplified DNA fragments in equal moles, ultrasonically fragmenting, repairing the ends and adding A, connecting the label adapter and PCR amplification to obtain the final library for the machine;

[0040] The on-machine module is used to perform the following operations: performing double-end 100-200bp sequencing of the on-machine library on an Illumina Novasek 6000 high-throughput sequencer, and using bioinformatics tools to perform data quality control, alignment to a reference genome, variant detection, and annotation on the off-machine sequencing data.

[0041] Preferably, the reaction conditions of the PCR amplification include: pre-denaturation at 96°C-98°C for 10-20s, 1 cycle; denaturation at 96°C-98°C for 10-20s, annealing at 55°C-60°C for 15-20s, extension at 66°C-68°C for 100-150s, 25-30 cycles; full extension at 66°C-68°C for 5-6min, 1 cycle, and holding at 4°C.

[0042] In the seventh aspect, the present invention provides the use of the primers for detecting the full-length mutation of the RPE65 gene described in the first aspect, the method described in the fifth aspect, or the device for detecting the full-length mutation of the RPE65 gene described in the sixth aspect in detecting biallelic mutations of the RPE65 gene.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] (1) The present invention provides a method for detecting point mutations, i.e., large fragment deletions, located in all exons and introns of RPE65, which can accurately detect variations in exon and intron positions, provide more molecular biological basic information for the occurrence of the disease, help reveal complex genetic mechanisms, and improve the accuracy and comprehensiveness of diagnosis;

[0045] (2) In the method of the present invention, PCR enrichment of the RPE65 gene can be completed within only 2 h, and library construction can be completed within 1 day;

[0046] (3) The method of the present invention provides a possibility of haplotype analysis. By combining specific bioinformatics tools, single nucleotide polymorphisms (SNPs) of the entire length of the RPE65 gene are detected to construct haplotypes, which can further confirm the linkage relationship of mutations and conduct haplotype analysis;

[0047] (4) The present invention enriches all exons and intron sequences of the RPE65 gene, with a wide coverage range, a simple and rapid process, being suitable for popularization, and having a low cost. In addition to being able to perform RPE65 mutation screening, it can also combine pedigree segregation technology and haploid analysis technology to determine bi-allelic gene mutations, and is used to evaluate whether it is applicable to autosomal recessive genetic diseases related to the PRE65 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 It is the agarose gel electrophoresis result diagram showing non-specific amplification in fragment 3 in Example 1;

[0049] Figure 2 It is the agarose gel electrophoresis result diagram after primer pairing amplification of the present invention;

[0050] Figure 3 It is the flow chart of RPE65 mutation analysis library preparation;

[0051] Figure 4 It is the Agilent 4200 quality inspection result diagram. DETAILED DESCRIPTION OF THE INVENTION

[0052] To further elaborate on the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with examples and drawings. It can be understood that the specific embodiments described herein are only used to explain the present invention, rather than limiting the present invention.

[0053] For those not specifying specific techniques or conditions in the examples, they shall be carried out according to the techniques or conditions described in the literature in this field, or according to the product specifications. For reagents or instruments not specifying the manufacturer, they are all conventional products that can be obtained through regular commercial channels.

[0054] Example 1

[0055] In this example, primer design is carried out.

[0056] The total length of the RPE65 gene from exon1 to exon14 exceeds 21 kb, exceeding the amplification limit of the vast majority of PCR enzymes; also considering that the longer the PCR amplification product, the higher the requirement for DNA integrity, and the increase in the number of segments will lead to an increase in cost. Considering feasibility, success rate and cost, the present invention considers segmental amplification of the RPE65 gene, specifically, it is amplified in 3 segments.

[0057] Based on the SNP polymorphism information of the Chinese population in the RPE65 gene and its upstream and downstream regions in the ChinaMAP database, 1000Genomes Project, dbSNP, and gnomAD databases, the regions with Chinese population polymorphism sites were avoided for primer design and screening. The original primers for fragment 3 were: forward primer: GTTCAAAGTTACAGTGAGCT (SEQ ID NO.7); reverse primer: AGAAGCTAGTGTTTTGGTCAAG (SEQ ID NO.8). Nonspecific amplification of fragment 3 was found by agarose electrophoresis (see Figure 1 ). Therefore, the primers for fragment 3 were redesigned as SEQ ID NO.5 and SEQ ID NO.6.

[0058] The finally screened primers are shown in SEQ ID NO.1 - SEQ ID NO.6.

[0059] SEQ ID NO.1: CCCTGAATATCTTCCCATTGCTCTCA.

[0060] SEQ ID NO.2: AGGATTTGAAACTTAATGTGGCTC.

[0061] SEQ ID NO.3: ATGTTCAGGAATTTAGAATTTGGAACT.

[0062] SEQ ID NO.4: CAACATTCTAAGAAGAGAAGACAGGAGA.

[0063] SEQ ID NO.5: CTTGAGTCCAGGAGTTCAAAGTTACA.

[0064] SEQ ID NO.6: CAAGATTCAGCTGAATCTGTAGGT.

[0065] Among them, SEQ ID NO.1 and SEQ ID NO.2 are paired for amplification, SEQ ID NO.3 and SEQ ID NO.4 are paired for amplification, and SEQ ID NO.5 and SEQ ID NO.6 are paired for amplification. The last 2 bases of each primer have thiophosphate modification.

[0066] Primer - BLAST shows that no other genomic regions have 100% primer - binding sites, and UCSC In - SilicoPCR shows that the PCR product is single. The agarose electrophoresis results ( Figure 2 ) confirm that the product is single.

[0067] Example 2

[0068] In this example, RPE65 gene mutations will be detected in cell line standards and whole blood samples from patients with type 2 Leber's congenital amaurosis.

[0069] The cell lines in this example include DU145, LS180, and NA18909. The DNA of the DU145 cell line and the DNA of the LS180 cell line were purchased from ATCC, and their RPE65 mutation information comes from the DepMap database and Sanger results; the NA18909 DNA was purchased from Coriell, and its RPE65 mutation information comes from the Ensembl database and Sanger results. W001 and W002 are whole blood samples clinically suspected of having type 2 Leber's congenital amaurosis and need to be further judged according to the RPE65 gene mutation situation.

[0070] For whole blood samples, the QIAamp DNA Mini Kit (product number: 51304) from Qiagen was used for genomic DNA extraction.

[0071] (1) Long-chain PCR was performed using the primer pairs of SEQ ID NO.1 / SEQ ID NO.2, SEQ ID NO.3 / SEQ ID NO.4, and SEQ ID NO.5 / SEQ ID NO.6, and a total of 3 long-chain PCR reactions were carried out. The DNA input amount was 100 ng, and the PCR enzyme components were purchased from PrimeSTAR GXL DNA Polymerase (product number: R050Q) of TAKARA.

[0072] Prepare the long-chain PCR reaction system according to Table 1 below.

[0073] Table 1

[0074] Reagent Dosage 5×PrimeSTAR GXL Buffer 5 μL dNTP Mixture (2.5 mM) 2 μL Forward Primer (Final concentration 0.2 μM) 0.5 μL Reverse Primer (Final concentration 0.2 μM) 0.5 μL Genomic Template 100 ng PrimeSTAR GXL DNA Polymerase 1 μL Sterilized Water Make up to 25 μL

[0075] Use a pipette to gently pipette 10 times to mix well. The annealing temperature of SEQ ID NO.1 / SEQ ID NO.2 and SEQ ID NO.3 / SEQ ID NO.4 is 55 °C, and the annealing temperature of SEQ ID NO.5 / SEQ ID NO.6 is 60 °C.

[0076] Place the sample in a PCR instrument for reaction, and the reaction conditions are shown in Table 2.

[0077] Table 2

[0078]

[0079] (2) Purification of PCR fragment products

[0080] Take out the DNA purification magnetic beads 30 minutes in advance and let them return to room temperature. Vortex to mix well. Pipette 1× volume of magnetic beads into the sample from the previous step, and pipette 10 times with a pipette to mix thoroughly. Let it stand for 5 minutes to allow the DNA to bind to the magnetic beads. Discard the supernatant, wash twice with 200 μL of 80% ethanol, and dry at room temperature. Remove the sample from the magnetic stand, add 22.5 μL of water for elution, and take 20 μL and place it in a new PCR tube for later use. Quantify the purified product with Qubit. Mix 3 PCR products according to the same total concentration and proceed with the subsequent NGS library construction steps.

[0081] Use 0.1×TE to make the volume of the original sample of 10 ng - 1000 ng up to 50 μL. Transfer the sample to a 50 μL fragmentation tube and perform fragmentation on Covaris M220. The reaction conditions are shown in Table 3.

[0082] Table 3

[0083] Peak Incident Power (W) 75 Duty Cycle 10％ Interruption Period 200 Reaction Time (s) 28 Temperature (°C) 20 Sample Volume (μL) 50

[0084] Take out the fragmented sample from the fragmentation tube and transfer it to a PCR tube.

[0085] Use Novoprotein VAHTS Universal DNA Library Prep Kit for Illumina V3 (Cat. No.: ND607) and VAHTS DNA Adapters set3 - set6 for Illumina (Cat. No.: N805 / N806 / N807 / N808) to construct the library.

[0086] (3) End repair

[0087] Thaw the End Prep Mix 4 on ice and add it to the fragmented DNA. Pipette to mix well. The reaction system is shown in Table 4.

[0088] Table 4

[0089] Component Volume Input DNA 50 μL EndPrep Mix 4 15 μL Total Volume 65 μL

[0090] Gently pipette 10 times with a pipette to mix well. Place the sample in a PCR instrument for reaction. The reaction conditions are shown in Table 5.

[0091] Table 5

[0092]

[0093]

[0094] (4) Adapter ligation

[0095] Prepare the reaction solution as shown in Table 6 on ice and use DNA adapter ligation.

[0096] Table 6

[0097] Component Volume End Preparation Product 65 μL Rapid Ligation buffer 2 25 μL Rapid DNA ligase 5 μL DNA Adapter X 5 μL Total 100 μL

[0098] Use a pipette to gently pipette up and down 10 times to mix well. Place the sample in a PCR instrument for reaction. The reaction conditions are shown in Table 7.

[0099] Table 7

[0100] Temperature Time Thermal lid open, 105 °C -- 20℃ 15 min 4℃ Keep

[0101] (5) Purification of the ligation product

[0102] Take out the DNA purification magnetic beads 30 min in advance and let them return to room temperature. Vortex to mix well. Pipette 60 μL (0.6×) into the sample from the previous step. Use a pipette to blow and beat 10 times to mix thoroughly. Let it stand for 5 min to allow the DNA to bind to the magnetic beads. Discard the supernatant. Wash twice with 200 μL of 80% ethanol and dry at room temperature. Remove the sample from the magnetic stand, add 105 μL of water for elution, let it stand at room temperature for 2 min, place it in the magnetic stand and let it stand. After the solution becomes clear, carefully pipette 100 μL of the supernatant into a new PCR tube. Add 53 μL of DNA purification magnetic beads. Use a pipette to blow and beat 10 times to mix thoroughly. Let it stand for 5 min. Pipette 150 μL of the supernatant into a new PCR tube. Add 12 μL of DNA purification magnetic beads. Use a pipette to blow and beat 10 times to mix thoroughly. Let it stand for 5 min to allow the DNA to bind to the magnetic beads. Discard the supernatant. Wash twice with 200 μL of 80% ethanol and dry at room temperature. Remove the sample from the magnetic stand, add 22.5 μL of water for elution, let it stand at room temperature for 2 min, and take 20 μL and place it in a new PCR tube for use.

[0103] (6) Library amplification

[0104] Take out PCR PrimerMix 3 and VAHTS HiFi Amplification Mix from -20°C, thaw on ice and invert to mix well. Prepare the PCR reaction solution shown in Table 8 in a PCR tube.

[0105] Table 8

[0106] Component Volume Purified and sorted adapter-ligated product 20 μL PCR Primer Mix 3 5 μL VAHTS HiFi Amplification Mix 25 μL Total 50 μL

[0107] Place the sample in a PCR instrument for library amplification reaction. The reaction conditions are shown in Table 9.

[0108] Table 9

[0109]

[0110]

[0111] (7) PCR Enrichment Library Purification

[0112] Pre-warm the magnetic beads to room temperature. Vortex the magnetic beads well before use. Pipette 0.9× magnetic beads into the sample from the previous step, and pipette up and down 10 times to mix thoroughly. Let it stand for 5 min to allow the DNA to bind to the magnetic beads. Discard the supernatant. Keep the PCR tube on the magnetic stand, add 200 μL of freshly prepared 80% ethanol to the reaction tube, and wait for 30 s to wash the magnetic beads. After the solution becomes clear, discard the supernatant and retain the magnetic beads. Repeat the washing once, for a total of 2 washes. Remove as much residual ethanol as possible from the PCR tube and place it on the magnetic stand for 5 min until the magnetic beads are completely dry. Take the sample out of the magnetic stand, add 22.5 μL of water to resuspend the magnetic beads, and gently pipette up and down 10 times to mix well. Let it stand at room temperature for 2 min and then place it on the magnetic stand for 5 min. After the liquid becomes clear, take 20 μL of the supernatant as the final library.

[0113] (8) Library Quality Control and Sequencing

[0114] Qubit quantification and Agilent 4200 quality control of the library. The quality control results are shown in Figure 4 . The qualified library was sequenced on the Novaseq 6000 with paired-end 150 bp reads.

[0115] Bioinformatics analysis: Use bioinformatics tools to process and analyze the data after sequencing, including steps such as data quality control, alignment to the reference genome, variant detection, and annotation, and determine the potential pathogenicity of the detected variants according to the standard workflow of the ACMG guidelines.

[0116] Results:

[0117] The bioinformatics quality control results of the standards DU145, LS180, NA18909 and clinical samples W001, W002 are shown in Table 10.

[0118] Table 10

[0119]

[0120] The results of the standards DU145, LS180, NA18909 are as shown in Table 11 below, which are consistent with the expectations.

[0121] Table 11

[0122]

[0123]

[0124] The test results of clinical sample W001 are shown in Table 12 below: only pathogenic, suspected pathogenic sites and sites of unknown significance are shown. This sample has a homozygous mutation in NM_000329.3 (RPE65): c.1543C>T (p.R515W), and this mutation is a pathogenic variant. Some studies have shown that this variant is related to LCA2. Therefore, the disease status of this sample can be determined without family information.

[0125] Table 12

[0126] Exon Nucleotide Variation Amino Acid Variation Binding Variation Type Annotation Exon 14 c.1543C>T p.R515W Homozygous Missense Mutation Pathogenic Exon 14 c.*630C>T p.？ Heterozygous 3'-UTR Mutation Of Uncertain Significance

[0127] The test results of clinical sample W002 are shown in Table 13 below. Only pathogenic, suspected pathogenic sites and sites of unknown significance are shown. NM_000329.3 (RPE65): c.545A>G (p.H182R) is a pathogenic variant and is related to LCA2; NM_000329.3 (RPE65): c.1022T>C (p.L341S) is a pathogenic variant and is related to LCA2. This sample needs to be subjected to family segregation analysis to obtain the genotype information of the parents of this sample to determine whether it is a biallelic RPE65 variant.

[0128] Table 13

[0129]

[0130]

[0131] Since the existing information cannot determine whether it is a compound heterozygote, the same detection method of the present invention is used to detect the parents of W002, and the test results are shown in Table 14 (father) and Table 15 (mother) below.

[0132] Table 14

[0133] Exon Nucleotide Variation Amino Acid Variation Binding Variation Type Annotation exon10 c.1022T>C p.L341S Heterozygous Missense Mutation Pathogenic exon14 c.1454T>C p.V485A Homozygous Missense Mutation Of Uncertain Significance

[0134] Table 15

[0135] Exon Nucleotide Variation Amino Acid Variation Binding Variation Type Annotation exon6 c.545A>G p.H182R Heterozygous Missense Mutation Pathogenic exon14 c.1454T>C p.V485A Homozygous Missense Mutation Of Uncertain Significance

[0136] Combining the results of both parents, it is determined that the patient is a compound heterozygote and can be used for gene therapy.

[0137] In summary, the present invention provides a detection method for point mutations and large fragment deletions in all exons and introns of the RPE65 gene, which can accurately detect variants at exon and intron positions, provide more molecular biological basic information for the occurrence of diseases, help to reveal complex genetic mechanisms, and improve the accuracy and comprehensiveness of diagnosis.

[0138] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, the equivalent substitution of each raw material of the product of the present invention, the addition of auxiliary components, the selection of specific methods, etc. all fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A primer for detecting full-length mutations of the RPE65 gene, characterized in that, The nucleic acid sequence of the primer includes the sequences shown in SEQ ID NO.1 - SEQ ID NO.

6.

2. The primer according to claim 1, characterized in that, The base at the 3'-end of the primer contains a thiophosphate modification.

3. Use of the primer for detecting full-length mutations of the RPE65 gene according to claim 1 or 2 in the preparation of a product for detecting full-length mutations of the RPE65 gene.

4. A kit for detecting full-length mutations of the RPE65 gene, characterized in that, The kit includes the primer for detecting full-length mutations of the RPE65 gene according to claim 1 or 2.

5. Use of the primer for detecting full-length mutations of the RPE65 gene according to claim 1 or 2 in the detection of full-length mutations of the RPE65 gene.

6. A method for detecting full-length mutations of the RPE65 gene for non-disease diagnosis and / or treatment purposes, characterized in that, The method includes: extracting DNA from a sample to be tested as a template, and performing PCR amplification on the 5'-UTR to 3'-UTR of the RPE65 gene using the primer for detecting full-length mutations of the RPE65 gene according to claim 1 or 2, constructing a library and sequencing after amplification, and analyzing the sequencing data to obtain full-length mutation information of the RPE65 gene; Preferably, the sample to be tested includes blood and / or oral swabs.

7. The method according to claim 6, characterized in that, The method includes the following steps: (1) Taking a blood sample or oral swab to be tested and performing genomic DNA extraction; (2) Using the primer for detecting full-length mutations of the RPE65 gene according to claim 1 or 2, PrimeSTAR GXL DNA Polymerase, dNTPs, and buffer to perform three-fragment amplification on the 5'-UTR to 3'-UTR of the RPE65 gene, and the length of each fragment is 9 - 11 kb; (3) Mixing the amplified DNA fragments in equimolar amounts, fragmenting them by ultrasound, performing end repair, adding A, ligating tag adapters, and PCR amplification to obtain the final library for sequencing; (4) Sequencing the library for sequencing on an Illumina Novaseq 6000 high-throughput sequencer with paired-end 100 - 200 bp sequencing; (5) Using bioinformatics tools to perform data quality control, alignment to the reference genome, variant detection, and annotation on the sequencing data downloaded from the machine.

8. The method according to claim 6 or 7, characterized in that, The reaction conditions for the PCR amplification include: pre-denaturation at 96℃ - 98℃ for 10 - 20 s, 1 cycle; denaturation at 96℃ - 98℃ for 10 - 20 s, annealing at 55℃ - 60℃ for 15 - 20 s, extension at 66℃ - 68℃ for 100 - 150 s, 25 - 30 cycles; complete extension at 66℃ - 68℃ for 5 - 6 min, 1 cycle, and hold at 4℃.

9. An apparatus for detecting full-length mutations of the RPE65 gene, characterized in that, The device for detecting full-length mutations of the RPE65 gene includes: an extraction module, an amplification module, and a sequencing module; The extraction module is used to perform: taking a blood sample or oral swab to be tested and performing genomic DNA extraction; The amplification module is used to perform the following steps: using the primers for detecting full-length mutations of the RPE65 gene described in claim 1 or 2, PrimeSTAR GXL DNA Polymerase, dNTPs, and buffer, amplifying the 5'-UTR to 3'-UTR of the RPE65 gene in three fragments, each fragment having a length of 9-11 kb, mixing the amplified DNA fragments in equimolar amounts, fragmenting them by ultrasonic waves, repairing the ends, adding A, ligating tag adapters, and performing PCR amplification to obtain the final library for sequencing; The sequencing module is used to perform the following steps: performing paired-end 100-200 bp sequencing on the library for sequencing on an Illumina Novaseq 6000 high-throughput sequencer, and using bioinformatics tools to perform data quality control, alignment to the reference genome, variant detection, and annotation on the sequenced data obtained from the sequencer; Preferably, the reaction conditions for the PCR amplification include: pre-denaturation at 96°C - 98°C for 10 - 20 s, 1 cycle; denaturation at 96°C - 98°C for 10 - 20 s, annealing at 55°C - 60°C for 15 - 20 s, extension at 66°C - 68°C for 100 - 150 s, 25 - 30 cycles; complete extension at 66°C - 68°C for 5 - 6 min, 1 cycle, and hold at 4°C.

10. Use of the primers for detecting full-length mutations of the RPE65 gene described in claim 1 or 2, the method according to any one of claims 6 - 8, or the device for detecting full-length mutations of the RPE65 gene described in claim 9 in detecting bi-allelic mutations of the RPE65 gene.

Images