Breast cancer biomarker, PLBD2 inhibitor, MCM6 inhibitor, breast cancer drug and application

Abstract

The invention relates to the technical field of breast cancer, in particular to a breast cancer biomarker, a PLBD2 inhibitor, an MCM6 inhibitor, a breast cancer drug and application. The biomarker comprises PLBD2 (PLBD2) and MCM6 (MCM6). The PLBD2 inhibitor comprises a double-stranded RNA (Ribonucleic Acid) which interferes with the expression of PLBD2. The MCM6 inhibitor comprises a double-stranded RNA (Ribonucleic Acid) which interferes with the expression of MCM6. The breast cancer medicine comprises double-stranded RNA for interfering expression of PLBD2 and double-stranded RNA for interfering expression of MCM6. The inhibitors can inhibit proliferation, migration and invasion of breast cancer cells, can block the breast cancer cells in the G1 phase and promote apoptosis of the breast cancer cells, and have application prospects as breast cancer drugs.

Description

Technical Field

[0001] This application relates to the technical field of breast cancer, and specifically relates to breast cancer biomarkers, PLBD2 inhibitors, MCM6 inhibitors, breast cancer drugs and their applications. Background Art

[0002] Biomarkers of breast cancer refer to a class of substances produced by tumor cells or the body during the occurrence and development of breast cancer, which can reflect the existence and growth of tumors, and can be used for early diagnosis, prognosis evaluation and treatment monitoring of breast cancer. The main biomarkers of breast cancer include protein biomarkers, gene biomarkers and microRNA (miRNA) biomarkers, etc.

[0003] Among them, protein biomarkers include estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2) and Ki-67. ER is a nuclear receptor protein that can bind to estrogen and regulate gene transcription. Approximately 70% of breast cancer cells express ER, and breast cancer with ER positive is usually sensitive to endocrine therapy and has a relatively good prognosis. The expression of PR is closely related to ER and is also a nuclear receptor protein. Breast cancer cells with PR positive may also respond to endocrine therapy, and the PR status is also an important indicator for evaluating the prognosis of breast cancer and guiding treatment. HER2 is a transmembrane receptor tyrosine kinase, and approximately 20% - 30% of breast cancer patients have HER2 gene amplification or protein overexpression. Breast cancer with HER2 positive usually has a higher malignancy and active proliferation, but targeted therapies for HER2 such as trastuzumab can significantly improve the prognosis of patients. Ki-67 is a nuclear antigen related to cell proliferation, and its expression level reflects the proliferation activity of tumor cells. High expression of Ki-67 usually indicates active proliferation of tumor cells and may have a poor prognosis. When formulating a treatment plan, high Ki-67 expression may tend to a more aggressive treatment strategy.

[0004] These biomarkers usually need to be combined with clinical symptoms, imaging examinations, etc. to comprehensively judge the situation of breast cancer, and the significance of different biomarkers may vary in different individuals and tumor subtypes. Summary of the Invention

[0005] By analyzing normal breast tissue and breast cancer tissue through a database, this application found that there are expression differences in phospholipase B domain-containing protein 2 (PLBD2) and minichromosome maintenance complex component 6 (MCM6), suggesting that high expression of PLBD2 and MCM6 in breast cancer can be used as an indicator of shortened overall survival of breast cancer patients and poor prognosis. This application further found through experimental tests that PLBD2 and MCM6 can be used as indicators of poor prognosis in breast cancer and have the application prospect of being developed as biomarkers.

[0006] Moreover, it was found in this application that CKAP4 in breast cancer cells is closely related to its proliferation, migration, invasion and cell cycle, and it was found that CKAP4, together with PLBD2 and MCM6, co-regulates the proliferation, migration, invasion and cell cycle of breast cancer cells. For this reason, the examples provide inhibitors of PLBD2 and MCM6, which can not only knockdown the protein expression of CKAP4, but also knockdown the protein expressions of PLBD2 and MCM6. The PLBD2 inhibitor and MCM6 inhibitor provided in this application can inhibit the proliferation, migration and invasion of breast cancer cells, and can arrest breast cancer cells in the G1 phase, promoting the apoptosis of breast cancer cells, and have the application prospect as breast cancer drugs.

[0007] For this reason, the examples at least disclose the following technical solutions:

[0008] In the first aspect, the examples provide biomarkers associated with breast cancer prognosis, including at least one of PLBD2 and MCM6.

[0009] In the second aspect, the examples provide a kit for predicting breast cancer prognosis, which includes at least one of the RT-PCR reagents for detecting the relative expression level of CKAP4 mRNA, the RT-PCR reagents for detecting the relative expression level of PLBD2 mRNA, and the RT-PCR detection reagents for detecting the expression level of MCM6.

[0010] In the examples of the second aspect, the RT-PCR reagents for detecting the relative expression level of CKAP4 mRNA include the primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2.

[0011] In the examples of the second aspect, the RT-PCR reagents for detecting the relative expression level of PLBD2 mRNA include the primer pairs shown in SEQ ID NO:3 and SEQ ID NO:4.

[0012] In the examples of the second aspect, the RT-PCR reagents for detecting the relative expression level of MCM6 mRNA include the primer pairs shown in SEQ ID NO:5 and SEQ ID NO:6.

[0013] In the third aspect, the examples provide the application of at least one of the RT-PCR reagents for detecting the relative expression level of CKAP4 mRNA, the RT-PCR reagents for detecting the relative expression level of PLBD2 mRNA, and the RT-PCR detection reagents for detecting the relative expression level of MCM6 mRNA in the second aspect in the preparation of a kit for detecting breast cancer prognosis.

[0014] Fourthly, the embodiment provides a kit for predicting the prognosis of breast cancer, which comprises at least one of an antibody for detecting the expression level of CKAP4 protein, an antibody for detecting the expression level of PLBD2 protein, and an antibody for detecting the expression level of MCM6 protein.

[0015] Fifthly, the embodiment provides the use of at least one of an antibody for detecting the expression level of CKAP4 protein, an antibody for detecting the expression level of PLBD2 protein, and an antibody for detecting the expression level of MCM6 protein in the fourth aspect in the preparation of a kit for detecting the prognosis of breast cancer.

[0016] Sixthly, the embodiment provides a PLBD2 inhibitor, which comprises at least one of double-stranded RNA interfering with PLBD2 expression, recombinant lentivirus containing the double-stranded RNA, and recombinant lentiviral vector containing the double-stranded RNA.

[0017] Seventhly, the embodiment provides an MCM6 inhibitor, which comprises at least one of double-stranded RNA interfering with MCM6 expression, recombinant lentivirus containing the double-stranded RNA, and recombinant lentiviral vector containing the double-stranded RNA.

[0018] Eighthly, the embodiment provides a breast cancer drug, which uses at least one of double-stranded RNA interfering with PLBD2 expression, recombinant lentivirus containing the double-stranded RNA, and recombinant lentiviral vector containing the double-stranded RNA as an active ingredient.

[0019] Ninthly, the embodiment provides a breast cancer drug, which uses at least one of double-stranded RNA interfering with MCM6 expression, recombinant lentivirus containing the double-stranded RNA, and recombinant lentiviral vector containing the double-stranded RNA as an active ingredient.

[0020] In some embodiments of the sixth or eighth aspect, the sense strand of the double-stranded RNA interfering with PLBD2 expression is as shown in SEQ ID NO: 9, and the antisense strand is as shown in SEQ ID NO: 10.

[0021] In some embodiments of the sixth or eighth aspect, the sense strand of the double-stranded RNA interfering with PLBD2 expression is as shown in SEQ ID NO: 11, and the antisense strand is as shown in SEQ ID NO: 12.

[0022] In some embodiments of the seventh or ninth aspect, the sense strand of the double-stranded RNA interfering with MCM6 expression is as shown in SEQ ID NO: 13, and the antisense strand is as shown in SEQ ID NO: 14.

[0023] In some embodiments of the seventh or ninth aspect, the sense strand of the double-stranded RNA interfering with MCM6 expression is as shown in SEQ ID NO: 15, and the antisense strand is as shown in SEQ ID NO: 16. Brief Description of the Drawings

[0024] Figure 1 Statistical results of PLBD2 and MCM6 protein expression in breast cancer and normal breast tissues provided for the TCGA database test case. ***P < 0.001.

[0025] Figure 2 Statistical results of PLBD2 and MCM6 protein expression in breast cancer and normal breast tissues provided for the UALCAN protein data test case. ***P < 0.001.

[0026] Figure 3 Overall survival graphs of breast cancer patients with high expression of PLBD2 (A) and overall survival graphs of breast cancer patients with high expression of MCM6 (B) provided for the Kaplan-Meier Plotter analysis test case.

[0027] Figure 4 Statistical results of MCM6 (A) and PLBD2 (B) protein expression in breast cancer and normal breast tissues provided by the immunohistochemical staining test case. ***P < 0.001.

[0028] Figure 5 In vitro proliferation detection results of PLBD2-knockout breast cancer cells provided for the test case. Figure 5 A shows the SRB assay results of MDA-MB-231 cells with PLBD2 knockout (shPLBD2), MDA-MB-231 cells (shNC), HCC1806 cells with PLBD2 knockout (shPLBD2), and HCC1806 cells (shNC). ***P < 0.001. Figure 5 B shows the EdU assay results of MDA-MB-231 cells with PLBD2 knockout (shPLBD2), MDA-MB-231 cells (shNC), HCC1806 cells with PLBD2 knockout (shPLBD2), and HCC1806 cells (shNC). ***P < 0.001.

[0029] Figure 6 In vitro proliferation detection results of MCM6-knockout breast cancer cells provided for the test case. Figure 6 A shows the SRB assay results of MDA-MB-231 cells with MCM6 knockout (shMCM6), MDA-MB-231 cells (shNC), HCC1806 cells with MCM6 knockout (shMCM6), and HCC1806 cells (shNC). ***P < 0.001. Figure 6The results of the EdU assay for shMCM6 MDA-MB-231 cells (shMCM6), MDA-MB-231 cells (shNC), shMCM6 HCC1806 cells (shMCM6), and HCC1806 cells (shNC). ***P < 0.001.

[0030] Figure 7 Graph (A) showing the relationship between PLBD2 and immune cells analyzed from test cases in the TCGA database and graph (B) showing the results of analyzing the relationship between PLBD2 and immune cells by flow cytometry test cases.

[0031] Figure 8 Graph (A) showing the relationship between MCM6 and immune cells analyzed from test cases in the TCGA database and graph (B) showing the results of analyzing the relationship between MCM6 and immune cells by flow cytometry test cases.

[0032] Figure 9 Statistical graph (A) of the relative expression levels of PLBD2 mRNA and MCM6 mRNA in CKAP4-knockout breast cancer cells provided by the RT-PCR test case and graph (B) of the protein expression levels of PLBD2 and MCM6 in CKAP4-knockout breast cancer cells provided by the WB test case.

[0033] Figure 10 Results of the in vitro proliferation assay of CKAP4-knockout breast cancer cells provided by the test case. Figure 10 A shows the SRB assay results of shCKAP4-1 / shCKAP4-2 HCC1806 cells and shCKAP4-1 / shCKAP4-2 MDA-MB-231 cells with CKAP4 knockout. **P < 0.01, ***P < 0.001. Figure 10 A shows the EdU assay results of shCKAP4-1 / shCKAP4-2 HCC1806 cells and shCKAP4-1 / shCKAP4-2 MDA-MB-231 cells with CKAP4 knockout. **P < 0.01, ***P < 0.001.

[0034] Figure 11 Results of the cell cycle detection of shCKAP4-1 / shCKAP4-2 HCC1806 cells and shCKAP4-1 / shCKAP4-2 MDA-MB-231 cells with CKAP4 knockout provided by the flow cytometry test case. **P < 0.01, ***P < 0.001.

[0035] Figure 12Cell cycle detection results of CKAP4-knockout HCC1806 cells (shCKAP4-1 / shCKAP4-2) and CKAP4-knockout MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) provided for WB test examples. **P < 0.01, ***P < 0.001.

[0036] Figure 13 Apoptosis results of CKAP4-knockout HCC1806 cells (shCKAP4-1 / shCKAP4-2) and CKAP4-knockout MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) provided for flow cytometry test examples. **P < 0.01, ***P < 0.001.

[0037] Figure 14 Cell migration results of CKAP4-knockout HCC1806 cells (shCKAP4-1 / shCKAP4-2) and CKAP4-knockout MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) provided for cell scratch test examples. **P < 0.01, ***P < 0.001.. *P < 0.05, **P < 0.01, ***P < 0.001.

[0038] Figure 15 Cell invasion results of CKAP4-knockout HCC1806 cells (shCKAP4-1 / shCKAP4-2) and CKAP4-knockout MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) provided for Transwell test examples. **P < 0.01, ***P < 0.001.. *P < 0.05, **P < 0.01, ***P < 0.001.

[0039] Figure 16 Results of inhibiting the in vivo growth of breast cancer tissues by knocking out CKAP4 provided for in vivo transplantation test examples. Figure 16 Schematic diagram of establishing a nude mouse xenograft model with A cells. Figure 16 B is the curve of the change in the volume of the xenograft tumor. Figure 16 C is the entity diagram of the xenograft tumor. Figure 16 D is the statistical chart of the weight of the xenograft tumor. Figure 16 E is the result of immunohistochemical detection of the expression of the proliferation protein ki-67. **P < 0.01, ***P < 0.001. Detailed implementation manners

[0040] To make the objectives, technical solutions and advantages of this application more clear and understandable, the following further elaborates on this application in combination with embodiments. It should be understood that the specific embodiments described herein are merely used to explain this application and are not used to limit this application. Reagents not specifically described in detail in this application are all conventional reagents and can be obtained through commercial channels; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0041] The expressions of PLBD2 and MCM6 in human breast cancer tissues are higher than those in adjacent tissues

[0042] 1. Clinical samples

[0043] A total of 101 postoperative specimens of breast cancer patients who received surgical treatment in the hospital from January 2015 to January 2017 were collected. The tissues were routinely fixed with 4% neutral formalin, and tissue sections were prepared for hematoxylin-eosin staining. The pathological results were confirmed by two experienced pathologists above the attending physician level. Pathological histological typing was performed according to the WHO breast tumor pathological diagnosis (2019 edition), and the pathological diagnosis was non-special type invasive breast cancer. Histological grading was performed according to the Nottingham grading system score. The follow-up data of the patients were collected by telephone. This study was approved by the Ethics Committee.

[0044] 2. Database analysis

[0045] Transcriptome sequencing (RNA-seq) data and corresponding clinical information of 1104 breast cancer patients were obtained from TCGA (https: / / portal.gdc.cancer.gov / , 2020). According to the median expression of PLBD2 mRNA and MCM6 mRNA in each sample, the patients were divided into: PLBD2 high-expression group, PLBD2 low-expression group, MCM6 high-expression group, and MCM6 low-expression group. The follow-up time of all cases ranged from 90 days to 10 years, and cases with uncertain cancer type and unknown age were excluded. The collected clinicopathological data included age, TNM clinical stage (T: primary tumor, N: regional lymph nodes, M: distant metastasis), microarray 50 prediction analysis (PAM50), intrinsic molecular subtype (luminal A type, luminal B type, basal-like type, HER2-enriched type, normal-like type), and histological type.

[0046] As Figure 1 shown, compared with normal breast tissue, the expression levels of PLBD2 and MCM6 mRNA in breast cancer were significantly up-regulated.

[0047] As Figure 2 shown, UALCAN protein data analysis showed that compared with normal breast tissue, the protein expression levels of PLBD2 and MCM6 in breast cancer were significantly increased.

[0048] AsFigure 3 As shown, Kaplan-Meier Plotter analysis revealed that breast cancer patients with high PLBD2 expression had a shorter overall survival compared to those with low PLBD2 expression (HR = 1.41, p = 0.015). Breast cancer patients with high MCM6 expression had a shorter overall survival compared to those with low MCM6 expression (HR = 1.28, p = 0.013).

[0049] The above results suggest that high expression of PLBD2 and MCM6 in breast cancer can be used as an indicator of shortened overall survival in breast cancer patients and a poor prognosis, and PLBD2 and MCM6 are preferentially considered as subjects for subsequent research.

[0050] 3. Immunohistochemical staining (IHC) detection

[0051] Sections of paraffin blocks or tissue microarray paraffin blocks of breast cancer tissues were dewaxed, hydrated, antigen repaired, endogenous peroxidase blocked, and incubated with the primary antibody (PLBD2 antibody, ab138334, abcam; or MCM6 antibody, [EPR17686], ab201683, abcam) at 37°C for 1 hour. After washing, the secondary antibody (enzyme-labeled goat anti-mouse / rabbit IgG polymer) was added and incubated at 37°C for 20 minutes. After washing, color development, counterstaining, dehydration, clearing, and mounting were performed, and the total score was calculated by multiplying the proportion of positive tumor cells by the staining intensity score. The proportions of positive tumor cells were 0 (5%), 1 (6 - 25%), 2 (26 - 50%), 3 (51% - 75%), and 4 (76 - 100%) respectively. The staining intensity score was 0 (none), 1 (weak), 2 (medium), and 3 (strong). According to the final score, <5% of the cells were stained, regardless of the staining intensity, and it was determined to be negative (-); scores of 1 - 4 were recorded as weak (+); scores of 5 - 8 were moderate (++); scores of 9 - 12 were strong (+++). In the subsequent statistical analysis, negative and weak expression were determined as the low-expression group, and medium and strong expression were determined as the high-expression group.

[0052] As Figure 4 shown in Figure 4 A, MCM6 was localized in the nucleus, and compared with normal breast tissue, the expression level of MCM6 in breast cancer was significantly increased. As

[0053] shown in

[0054] Knockdown of PLBD2 and MCM6

[0055] B, PLBD2 was localized in the cytoplasm, and compared with normal breast tissue, the expression level of PLBD2 in breast cancer was significantly increased.

[0053] In summary, PLBD2 and MCM6 have the application prospect of developing into breast cancer biomarkers.

[0054] Knockdown of PLBD2 and MCM6

[0055] In addition, the embodiments also provide a method based on interfering RNA to achieve knockdown of PLBD2 and knockdown of MCM6 in breast cancer cells.

[0056] To this end, the embodiments also provide a PLBD2 inhibitor, and the inhibitor includes double-stranded RNA that interferes with PLBD2. The embodiments also provide an MCM6 inhibitor, and the inhibitor includes double-stranded RNA that interferes with MCM6. In these embodiments, these double-stranded RNAs can be synthesized by chemical or biological methods.

[0057] Among them, the sense strand of double-stranded RNA1 that interferes with PLBD2 is: 5’-GCAACAUCUUCGAGGAGUGUUUCAAGAGA-3’, SEQ ID NO:9, and the antisense strand is: 5’-ACACUCCUCGAAGAUGUUGC-3’, SEQ ID NO:10.

[0058] The sense strand of double-stranded RNA2 that interferes with PLBD2 is: 5’-GUGCUACAGCUGGUCAACUUUUCAAGAGA-3’, SEQ ID NO:11, and the antisense strand is: 5’-AAGUUGACCAGCUGUAGCAC-3’, SEQ ID NO:12.

[0059] The sense strand of double-stranded RNA1 that interferes with MCM6 is: 5’-GCUACAGCUUCGUCAACUACUUCAAGAGA-3’, SEQ ID NO:13, and the antisense strand is: 5’-GUAGUUGACGAAGCUGUAGC-3’, SEQ ID NO:14.

[0060] The sense strand of double-stranded RNA2 that interferes with MCM6 is: 5’-GUAGUCGACCUGGUCAAGAUUUCAAGAGA-3’, SEQ ID NO:15, and the antisense strand is: 5’-AUCUUGACCAGGUCGACUAC-3’, SEQ ID NO:16.

[0061] Based on this, the embodiments also provide a method for inhibiting PLBD2 in breast cancer cells. The method includes: mixing double-stranded RNA that interferes with PLBD2 with a transfection reagent to form a complex of double-stranded RNA and the transfection reagent; co-culturing the complex with breast cancer cells; harvesting and screening positive cells from the co-culture, and the positive cells are breast cancer cells in which PLBD2 is inhibited.

[0062] Based on this, the embodiment also provides a method for inhibiting MCM6 in breast cancer cells. The method includes: mixing double-stranded RNA interfering with MCM6 with a transfection reagent to form a complex of double-stranded RNA and the transfection reagent; co-culturing the complex with breast cancer cells; harvesting and screening positive cells from the co-culture, and the positive cells are breast cancer cells with inhibited MCM6.

[0063] In some embodiments, the method for inhibiting PLBD2 in breast cancer cells or the method for inhibiting MCM6 in breast cancer cells specifically includes:

[0064] 1) Chemically synthesize the above-mentioned double-stranded RNA interfering with PLBD2 or double-stranded RNA interfering with MCM6, and dissolve it in RNase-free water to 20 μM.

[0065] 2) Inoculate HCC1806 cells or MDA-MB-231 cells in the logarithmic growth phase at an appropriate density (such as 2×10 5 cells / well) into a 6-well plate, add 2 ml of complete medium to each well, and place it in an incubator for 24 h to allow the cells to adhere and reach a confluence of 30%-50%.

[0066] 3) Preparation of the transfection complex: Operate according to the instructions of Lipofectamine RNAiMAX transfection reagent. In a sterile centrifuge tube, dilute 50 pmol of double-stranded RNA and 5 μL of transfection reagent to 100 μL with Opti-MEM medium respectively, mix gently, and incubate at room temperature for 5 min. Then mix the diluted double-stranded RNA and transfection reagent, mix gently, and incubate at room temperature for 20 min to form a complex of double-stranded RNA and the transfection reagent.

[0067] 4) Cell transfection: Aspirate the original medium in the 6-well plate, and add 800 μL of Opti-MEM medium to each well. Then add the complex of double-stranded RNA and transfection reagent dropwise into the cell culture wells, shake the culture plate gently to make the complex evenly distributed. Put the culture plate back into the incubator and continue to culture for 4-6 h, then replace it with complete medium and continue to culture. Screen positive cells from the culture, and the positive cells are breast cancer cells with inhibited PLBD2 or inhibited MCM6.

[0068] The embodiment also provides a lentiviral vector carrying the above-mentioned interfering RNA, and uses this vector to mediate the interference of PLBD2 and MCM6. Based on this, the embodiment also provides a recombinant lentiviral vector. The recombinant lentiviral vector is a GV493 plasmid (GeneChem) carrying the nucleotide sequence shown in any one of SEQ ID NO: 9-16.

[0069] The embodiment also discloses a method for preparing the recombinant lentiviral vector. The method includes: obtaining a linearized GV493 fragment; ligating a DNA molecule as shown in any one of SEQ ID NOs: 9 to 16 with the linearized GV493 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0070] In some embodiments, the step of obtaining the linearized GV493 fragment includes: preparing a plasmid digestion reaction solution, digesting the plasmid digestion reaction solution at 37 °C for 3 h, and subjecting the digested solution to agarose gel recovery to obtain a target fragment of 10.9 kb. Among them, the plasmid digestion reaction solution contains 2 μg of lenti-CRISPRv2, 1 μL of 10 U / μL AgeI, 1 μL of 10 U / μL EcoRI, 5 μL of 10×CutSmart Buffer, and the balance of water in a volume of 50 μL.

[0071] In some embodiments, the step of ligating a DNA molecule as shown in any one of SEQ ID NOs: 9 to 16 with the linearized GV493 fragment to obtain a recombinant fragment includes: preparing a ligation reaction solution, and reacting the ligation reaction solution at 16 °C for 1 h. Among them, the ligation reaction solution contains 100 ng of the linearized GV493 fragment, 100 ng of a DNA molecule as shown in any one of SEQ ID NOs: 9 to 16, 2 μL of 10×T4 DNA Ligation Buffer, 1 μL of T4 DNA ligase, and the balance of water in a volume of 20 μL.

[0072] Based on the recombinant lentiviral vector obtained by the above method, when it is transfected into cells, it can synthesize recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NOs: 9 to 16 in vivo.

[0073] In some embodiments, the method for preparing the recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NOs: 9 to 16 specifically includes:

[0074] 1) Plant 4×10 6 HEK293T cells in a 10 cm dish until they reach a confluence of 70%-90%;

[0075] 2) Mix 20 μg of the recombinant lentiviral vector carrying any one of the nucleotide sequences of SEQ ID NOs: 9 to 16, 15 μg of pHelper1.0, and 10 μg of pHelper2.0 and add them to 1.5 mL of Opti-MEM to obtain a plasmid dilution;

[0076] 3) Add 60 μL of Lipo-2000 to 1.5 mL of Opti-MEM and incubate at room temperature for 5 min to obtain a Lipo-2000 dilution;

[0077] 4) Mix the plasmid dilution with the Lipo-2000 dilution, incubate at room temperature for 20 min to obtain a complex formed by the full binding of the plasmid and Lipo-2000.

[0078] 5) Remove the culture medium in the 10-cm dish, add the plasmid-liposome complex dropwise to the culture dish, gently shake the culture dish to evenly distribute the complex on the cell surface, add an appropriate amount of complete culture medium to 10 mL, and return it to the incubator for continued culture.

[0079] 6) At 48 - 72 hours after transfection, collect the supernatant containing virus particles. Transfer the supernatant to a sterile centrifuge tube, centrifuge at 3000 rpm for 10 - 15 min to remove cell debris. If a higher titer of virus is required, virus concentration can be performed. Common methods include ultracentrifugation, PEG precipitation method, etc. For example, when using the PEG 8000 precipitation method, add PEG 8000 with a final concentration of 8% - 10% and 0.5 M NaCl to the supernatant, incubate overnight at 4°C or at least for 2 - 4 hours. Then centrifuge at 4000 rpm for 30 - 60 min, discard the supernatant, and resuspend the precipitate with an appropriate amount of PBS to obtain the concentrated virus solution.

[0080] 7) The collected virus solution needs to be assayed for its titer. Common methods include fluorescence quantitative method (for lentiviruses with fluorescent labels), TCID 50 method, etc., to determine the infectivity of the virus and the amount of virus required for subsequent experiments.

[0081] Through the above examples, recombinant lentiviruses carrying any nucleotide sequence of SEQ ID NO: 9 - 16 were obtained. Transferring the recombinant lentiviruses into breast cancer cells can obtain breast cancer cells with PLBD2 knockdown and breast cancer cells with MCM6 knockdown.

[0082] Therefore, the examples disclose a method for preparing breast cancer cells with PLBD2 knockdown or breast cancer cells with MCM6 knockdown. The method includes: obtaining breast cancer cells and recombinant lentiviruses carrying any nucleotide sequence of SEQ ID NO: 9 - 16; mixing and transfecting the recombinant lentivirus solution with the culture medium of breast cancer cells, culturing the transfected solution, and screening breast cancer cells with PLBD2 knockdown or breast cancer cells with MCM6 knockdown.

[0083] In some examples, the method for preparing breast cancer cells with PLBD2 knockdown or breast cancer cells with MCM6 knockdown specifically includes: 1) One day before transfection, digest breast cancer cells in the logarithmic growth phase with trypsin and inoculate them into a cell culture plate at an appropriate density. For example, for a 24-well plate, inoculate about 2 - 5×10 4Cells were added with an appropriate amount of complete medium to reach a confluence of 30% - 50% at the time of transfection, and then the culture plates were returned to the incubator for continued culture.

[0084] 2) With an MOI of 10, and the number of cells per well being 5×10 4 cells, and the lentivirus titer being 1×10 8 TU / mL, then 5 μL of the lentivirus stock solution needed to be added to each well, and it was diluted to 200 μL with serum-free medium.

[0085] 3) Add 1 - 2 μL of 8 mg / mL polybrene solution to the 200 μL virus dilution, gently mix, and incubate at room temperature for 15 - 30 min, which can improve the infection efficiency of the lentivirus.

[0086] 4) Aspirate the original medium in the cell culture plate, gently wash the cells once with PBS, and then add the virus dilution containing polybrene to the cell culture wells, gently shake the culture plate to evenly distribute the virus solution. Return the culture plate to the incubator for continued culture.

[0087] 5) 12 - 24 hours after transfection, aspirate the medium containing the virus, add an appropriate amount of fresh complete medium, and continue to culture the cells to reduce the toxicity of the virus and polybrene to the cells.

[0088] 6) After 48 h of infection, add puromycin for screening to kill the cells that have not been successfully infected, and the cells that have been successfully infected will survive, and puromycin needs to be added to the subsequent medium all the time.

[0089] 7) After 2 days of puromycin screening, WB or Real-time PCR can be used to verify the knockdown or reduction of CKAP4. Among them, the detection methods of WB or Real-time PCR are the same as those in the above-mentioned examples.

[0090] Knockdown of PLBD2 and MCM6 inhibits the proliferation of breast cancer cells

[0091] In some test examples, the SRB staining method and the EdU staining method were used to test the proliferation of PLBD2-knockdown HCC1806 cells and PLBD2-knockdown MDA-MB-231 cells.

[0092] As Figure 5 shown, the proliferation ability of PLBD2-knockdown HCC1806 cells was significantly decreased compared with that of non-PLBD2-knockdown HCC1806 cells, and the proliferation ability of PLBD2-knockdown MDA-MB-231 cells was significantly decreased compared with that of non-PLBD2-knockdown MDA-MB-231 cells. This shows that knocking down the PLBD2 gene in breast cancer cells can inhibit their proliferation.

[0093] In some test cases, the SRB staining method and the EdU staining method were used to test the proliferation of HCC1806 cells with MCM6 knockdown and MDA-MB-231 cells with MCM6 knockdown.

[0094] As Figure 6 shown, the proliferation ability of HCC1806 cells with MCM6 knockdown was significantly decreased compared with that of HCC1806 cells without MCM6 knockdown, and the proliferation ability of MDA-MB-231 cells with MCM6 knockdown was significantly decreased compared with that of MDA-MB-231 cells without MCM6 knockdown. This indicates that knocking down the MCM6 gene in breast cancer cells can inhibit their proliferation.

[0095] PLBD2 and MCM6 are involved in the immune escape of tumor cells

[0096] In some test cases, the TCGA database and flow cytometry were used to analyze the relationships between PLBD2 and MCM6 and immune cells in the tumor microenvironment, respectively.

[0097] As Figure 7 shown in Figure 18A, the expression of PLBD2 was positively correlated with M2 macrophages, M0 macrophages, γδ T cells, CD4 memory-activated T cells, and CD4 memory-resting T cells; and negatively correlated with regulatory T cells, CD8+ T cells, monocytes, plasma cells, follicular helper T cells, and activated NK cells ( Figure 3 .18A).

[0098] As Figure 7 shown in Figure 18B, compared with the control group, the numbers of CD8+ T cells, CD4+ T cells, lymphocytes, and CD3+ T cells were increased in the PLBD2 knockdown group.

[0099] As Figure 8As shown in A, the expression of MCM6 was positively correlated with CD4 memory-activated T cells, follicular helper T cells, M1 macrophages, M0 macrophages, activated dendritic cells, and resting NK cells; and negatively correlated with activated mast cells, M2 macrophages, activated NK cells, monocytes, resting dendritic cells, and resting mast cells.

[0100] As Figure 8 As shown in B, compared with the control group, the proportion of CD56+ NK cells in MCM6 knockdown breast cancer cells increased.

[0101] These data indicate that the expression of PLBD2 and MCM6 is closely related to the body's immunity and may be involved in the immune escape of tumor cells.

[0102] Knockdown of CKAP4 in breast cancer downregulates PLBD2 and MCM6

[0103] The examples also provide a method based on interfering RNA to achieve knockdown of CKAP4 in breast cancer cells. In these examples, these double-stranded RNAs can be synthesized by chemical or biological methods.

[0104] Among them, the sense strand of double-stranded RNA1 interfering with CKAP4 is:

[0105] 5’-CAGCUGAAGAGGAGUGUGGGUUCAAGAGA-3’, SEQ ID NO:17, and the antisense strand is: 5’-CCCACACUCUCCUUCAGCUG-3’, SEQ ID NO:18.

[0106] Among them, the sense strand of double-stranded RNA2 interfering with CKAP4 is:

[0107] 5’-GCAUCGUCAAGAGGAGUACAUUUCAAGAGA-3’, SEQ ID NO:19, and the antisense strand is: 5’-AUGUACUCCUCUUGACGAUGC-3’, SEQ ID NO:20.

[0108] Based on this, the embodiment also provides a method for inhibiting CKAP4 in breast cancer cells. The method includes: mixing double-stranded RNA interfering with CKAP4 with a transfection reagent to form a complex of double-stranded RNA and the transfection reagent; co-culturing the complex with breast cancer cells; harvesting and screening positive cells from the co-culture, and the positive cells are breast cancer cells with inhibited CKAP4.

[0109] In some embodiments, the method for inhibiting CKAP4 in breast cancer cells specifically includes:

[0110] 1) Chemically synthesize the above double-stranded RNA interfering with CKAP4 and dissolve it in RNase-free water to 20 μM.

[0111] 2) Seed HCC1806 cells or MDA-MB-231 cells in the logarithmic growth phase at an appropriate density (such as 2×10 5 cells / well) in a 6-well plate, add 2 ml of complete medium to each well, and culture in an incubator for 24 h to allow the cells to adhere and reach a confluence of 30%-50%.

[0112] 3) Preparation of the transfection complex: Operate according to the instructions of Lipofectamine RNAi MAX transfection reagent. In a sterile centrifuge tube, dilute 50 pmol of double-stranded RNA and 5 μL of transfection reagent to 100 μL with Opti-MEM medium respectively, gently mix, and incubate at room temperature for 5 min. Then mix the diluted double-stranded RNA and transfection reagent, gently mix, and incubate at room temperature for 20 min to form a complex of double-stranded RNA and the transfection reagent.

[0113] 4) Cell transfection: Aspirate the original medium in the 6-well plate, and add 800 μL of Opti-MEM medium to each well. Then add the complex of double-stranded RNA and transfection reagent dropwise to the cell culture wells, gently shake the culture plate to make the complex evenly distributed. Put the culture plate back into the incubator and continue to culture for 4-6 h, then replace it with complete medium and continue to culture. Screen positive cells from the culture, and the positive cells are breast cancer cells with inhibited CKAP4.

[0114] The embodiment also provides a lentiviral vector carrying the above interfering RNA, and CKAP4 is interfered with by mediating with this vector. Based on this, the embodiment also provides a recombinant lentiviral vector. The recombinant lentiviral vector is a GV493 plasmid (GeneChem) carrying the nucleotide sequence shown in any one of SEQ ID NO: 17-20.

[0115] The embodiment also discloses a method for preparing the recombinant lentiviral vector. The method includes: obtaining a linearized GV493 fragment; ligating a DNA molecule as shown in any one of SEQ ID NOs: 17 to 20 with the linearized GV493 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0116] In some embodiments, the step of obtaining the linearized GV493 fragment includes: preparing a plasmid digestion reaction solution, digesting the plasmid digestion reaction solution at 37 °C for 3 h, and subjecting the digested solution to agarose gel recovery to obtain a target fragment of 10.9 kb. Among them, the plasmid digestion reaction solution contains 2 μg of lenti-CRISPRv2, 1 μL of 10 U / μL AgeI, 1 μL of 10 U / μL EcoRI, 5 μL of 10×CutSmart Buffer, and the balance of water in a volume of 50 μL.

[0117] In some embodiments, the step of ligating a DNA molecule as shown in any one of SEQ ID NOs: 17 to 20 with the linearized GV493 fragment to obtain a recombinant fragment includes: preparing a ligation reaction solution, and reacting the ligation reaction solution at 16 °C for 1 h. Among them, the ligation reaction solution contains 100 ng of the linearized GV493 fragment, 100 ng of a DNA molecule as shown in any one of SEQ ID NOs: 17 to 20, 2 μL of 10×T4 DNA Ligation Buffer, 1 μL of T4 DNA ligase, and the balance of water in a volume of 20 μL.

[0118] Based on the recombinant lentiviral vector obtained by the above method, when it is transfected into cells, it can synthesize recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NOs: 17 to 20 in vivo.

[0119] In some embodiments, the method for preparing recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NOs: 17 to 20 specifically includes:

[0120] 1) Culturing 4×10 6 HEK293T cells in a 10 cm dish until they reach 70%-90% confluence;

[0121] 2) Mixing 20 μg of the recombinant lentiviral vector carrying any one of the nucleotide sequences of SEQ ID NOs: 17 to 20, 15 μg of pHelper1.0, and 10 μg of pHelper2.0 and adding them to 1.5 mL of Opti-MEM to obtain a plasmid dilution solution;

[0122] 3) Add 60 μL of Lipo-2000 to 1.5 mL of Opti-MEM and incubate at room temperature for 5 min to obtain a Lipo-2000 dilution.

[0123] 4) Mix the plasmid dilution with the Lipo-2000 dilution and incubate at room temperature for 20 min to obtain a complex formed by the full binding of the plasmid and Lipo-2000.

[0124] 5) Remove the medium from the 10-cm dish, and add the plasmid-liposome complex dropwise to the dish. Gently shake the dish to evenly distribute the complex on the cell surface. Add an appropriate amount of complete medium to 10 mL and return it to the incubator for continued culture.

[0125] 6) At 48 - 72 hours after transfection, collect the supernatant containing virus particles. Transfer the supernatant to a sterile centrifuge tube and centrifuge at 3000 rpm for 10 - 15 min to remove cell debris. If a higher titer of virus is required, virus concentration can be performed. Commonly used methods include ultracentrifugation, PEG precipitation, etc. For example, when using the PEG 8000 precipitation method, add PEG 8000 with a final concentration of 8% - 10% and 0.5 M NaCl to the supernatant, and incubate at 4°C overnight or for at least 2 - 4 hours. Then centrifuge at 4000 rpm for 30 - 60 min, discard the supernatant, and resuspend the precipitate with an appropriate amount of PBS to obtain the concentrated virus solution.

[0126] 7) The collected virus solution needs to be assayed for its titer. Commonly used methods include fluorescence quantitative method (for lentiviruses with fluorescent labels), TCID 50 method, etc., to determine the infectivity of the virus and the amount of virus required for subsequent experiments.

[0127] Through the above examples, recombinant lentiviruses carrying any one of the nucleotide sequences of SEQ ID NO: 17 - 20 were obtained. Transfecting the recombinant lentiviruses into breast cancer cells can obtain breast cancer cells with CKAP4 knockdown.

[0128] Therefore, the examples disclose a method for preparing breast cancer cells with CKAP4 knockdown. The method includes: obtaining breast cancer cells and recombinant lentiviruses carrying any one of the nucleotide sequences of SEQ ID NO: 17 - 20; mixing and transfecting the recombinant lentivirus solution with the culture medium of breast cancer cells, culturing the transfected solution, and screening for breast cancer cells with CKAP4 knockdown.

[0129] In some examples, the method for preparing breast cancer cells with CKAP4 knockdown specifically includes:

[0130] 1) One day before transfection, digest breast cancer cells in the logarithmic growth phase with trypsin and inoculate them into a cell culture plate at an appropriate density. For example, for a 24-well plate, inoculate about 2 - 5×10 4 cells per well, add an appropriate amount of complete medium to make the cells reach 30% - 50% confluence at the time of transfection, and then place the culture plate back into the incubator for continued culture.

[0131] 2) With an MOI of 10, 5×10 4 cells per well, and a lentivirus titer of 1×10 8 TU / mL, 5 μL of the lentivirus stock solution needs to be added to each well, and then it is diluted to 200 μL with serum-free medium.

[0132] 3) Add 1 - 2 μL of 8 mg / mL polybrene solution to the 200 μL virus dilution, mix gently, and incubate at room temperature for 15 - 30 min to improve the infection efficiency of the lentivirus.

[0133] 4) Aspirate the original medium in the cell culture plate, gently wash the cells once with PBS, and then add the virus dilution containing polybrene to the cell culture wells. Gently shake the culture plate to evenly distribute the virus solution. Place the culture plate back into the incubator for continued culture.

[0134] 5) 12 - 24 hours after transfection, aspirate the medium containing the virus, add an appropriate amount of fresh complete medium, and continue to culture the cells to reduce the toxicity of the virus and polybrene to the cells.

[0135] 6) After 48 h of infection, add puromycin for screening to kill the cells that have not been successfully infected. The successfully infected cells will survive, and puromycin needs to be added to the subsequent medium all the time.

[0136] 7) After 2 days of puromycin screening, WB or Real-time PCR can be used to verify the knockdown or reduction of CKAP4.

[0137] In some test examples, RT-PCR and Western blot were used to detect the expression levels of CKAP4, PLBD2, and MCM6 in breast cancer cells transfected with double-stranded RNA interfering with CKAP4. The detection steps were the same as those in the above-mentioned examples.

[0138] Among them, the steps of RT-PCR specifically include:

[0139] Total RNA was extracted from fresh breast cancer tissues and adjacent breast tissues using Trizol reagent. The concentration of total RNA was measured using NANODROP2000, and the quality of RNA was analyzed by agarose gel electrophoresis. The total RNA with determined concentration and quality was reverse transcribed into cDNA. The reverse transcription system, calculated based on 10 μL, included 2 μL RT Master Mix (5×), 100 ng - 1 μg total RNA, and the remaining volume of Nuclease-free water.

[0140] The cDNA samples obtained by reverse transcription were subjected to qPCR. The qPCR reaction system, calculated based on 20 μL, included 1 μL cDNA, 0.8 μL 10 μM forward primer, 0.8 μL 10 μM reverse primer, 10 μL 1×TSING Master SYBR Green I qPCR Mix-UDG (WithoutROX), and the remaining volume of double-distilled water. The qPCR reaction steps included: 50 °C for 2 min; 95 °C for 2 min; 95 °C for 15 s; 40 cycles; 60 °C for 1 min. The expression of RNA was normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Data analysis was performed using Bio-Rad CFX96Manager software.

[0141] Among them, the forward primer for CKAP4 qPCR was: AAGCTGTGAAGCAAGGGGAG, shown as SEQ ID NO:1; the reverse primer was GGATTTGGTGAGCTCCGTCA, shown as SEQ ID NO:2.

[0142] The forward primer for PLBD2 qPCR was: GCTGGTCTTCTCCTCCTA, shown as SEQ ID NO:3; R7: GGTTCTTGTTGCCAATGG, shown as SEQ ID NO:4.

[0143] The forward primer for MCM6 qPCR was: TGTCAGTGGTGTTGATGGATATG, shown as SEQ ID NO:5, and the reverse primer was: GCTGTCTGTTCCTCATCTCTG, shown as SEQ ID NO:6.

[0144] The forward primer for GAPDH qPCR was: GAAAGCCTGCCGGTGACTAA, shown as SEQ ID NO:7, and the reverse primer was: GCCCAATACGACCAAATCAGAGA, shown as SEQ ID NO:8.

[0145] Among them, the steps of protein immunoblotting (western blotting, WB) specifically included:

[0146] Fresh breast cancer tissues and adjacent breast tissues were lysed with RIPA buffer, and total proteins were extracted. The protein concentration was detected by the BCA method. SDS-PAGE electrophoresis was performed, and the gel was transferred to a PVDF membrane using a membrane transfer instrument and blocked at room temperature for 1-2 h. The primary antibody (CKAP4 antibody, Proteintech, catalog number #14475-1-AP) was added at a dilution of 1:1000 and incubated at 4 °C for 12 h. After washing, the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG) was added and incubated at room temperature for 2 h. Color development was carried out, and the protein expression level was analyzed using ImageJ software. Among them, the primary antibodies used to detect the expression levels of PLBD2 and MCM6 were PLBD2 antibody (Proteintech, catalog number: #14475-1-AP, dilution 1:1000) and MCM6 antibody (Abcam, catalog number: #ab4459, dilution 1:1000), respectively.

[0147] As Figure 9 shown, the expression levels of CKAP4, PLBD2, and MCM6 in CKAP4-knockout HCC1806 cells were significantly lower than those in non-CKAP4-knockout HCC1806 cells.

[0148] This indicates that knocking down CKAP4 in breast cancer can downregulate the expression levels of PLBD2 and MCM6 in breast cancer cells.

[0149] Knockout of CKAP4 inhibits the proliferation of breast cancer cells

[0150] In some test cases, the SRB staining method and EdU staining method were used to test the proliferation of CKAP4-knockout HCC1806 cells and CKAP4-knockout MDA-MB-231 cells.

[0151] As Figure 10 shown, the proliferation ability of CKAP4-knockout HCC1806 cells was significantly decreased compared with that of non-CKAP4-knockout HCC1806 cells, and the proliferation ability of CKAP4-knockout MDA-MB-231 cells was significantly decreased compared with that of non-CKAP4-knockout MDA-MB-231 cells. This shows that knocking out the CKAP4 gene in breast cancer cells can inhibit their proliferation.

[0152] Knockout of CKAP4 arrests breast cancer cells in G1 phase

[0153] In some test cases, flow cytometry and WB were used to detect the cell cycle of CKAP4-knockout HCC1806 cells and CKAP4-knockout MDA-MB-231 cells.

[0154] As Figure 11As shown, the number of CKAP4-knockout HCC1806 cells in the G1 and G2 / M phases increased compared to that of non-CKAP4-knockout HCC1806 cells, while the total number of cells in the S phase decreased. The number of CKAP4-knockout MDA-MB-231 cells in the G1 and G2 / M phases increased compared to that of non-CKAP4-knockout MDA-MB-231 cells, while the total number of cells in the S phase decreased.

[0155] As Figure 12 shown, the protein expression levels of CDK4, CDK6, CyclinD1, and CyclinB1 in CKAP4-knockout HCC1806 cells were downregulated compared to those in non-CKAP4-knockout HCC1806 cells. The protein expression levels of CDK4, CDK6, CyclinD1, and CyclinB1 in CKAP4-knockout MDA-MB-231 cells were downregulated compared to those in non-CKAP4-knockout MDA-MB-231 cells.

[0156] This indicates that knocking out CKAP4 arrests breast cancer cells in the G1 phase.

[0157] Knockout of CKAP4 promotes apoptosis of breast cancer cells

[0158] In some test cases, flow cytometry was used to detect the apoptosis of CKAP4-knockout HCC1806 cells and CKAP4-knockout MDA-MB-231 cells.

[0159] As Figure 13 shown, the proportion of cell death and apoptosis in CKAP4-knockout HCC1806 cells increased compared to that in non-CKAP4-knockout HCC1806 cells. The proportion of cell death and apoptosis in CKAP4-knockout MDA-MB-231 cells increased compared to that in non-CKAP4-knockout MDA-MB-231 cells.

[0160] This shows that knocking out CKAP4 promotes the apoptosis of breast cancer cells.

[0161] Knockout of CKAP4 inhibits the migration of breast cancer cells

[0162] In some test cases, a cell scratch assay was used to detect the migration of CKAP4-knockout HCC1806 cells and CKAP4-knockout MDA-MB-231 cells.

[0163] As Figure 14As shown, the cell migration rates of CKAP4-knockout HCC1806 cells were decreased compared with those of non-CKAP4-knockout HCC1806 cells at 24 h, 48 h, and 72 h. The cell migration rates of CKAP4-knockout MDA-MB-231 cells were decreased compared with those of non-CKAP4-knockout MDA-MB-231 cells at 24 h, 48 h, and 72 h. This indicates that knocking out CKAP4 can inhibit the migration of breast cancer cells.

[0164] Knockout of CKAP4 inhibits the invasion of breast cancer cells

[0165] In some test cases, the invasion of CKAP4-knockout HCC1806 cells and CKAP4-knockout MDA-MB-231 cells was detected by Transwell assay.

[0166] As Figure 15 shown, the number of invasive cells of CKAP4-knockout HCC1806 cells was decreased compared with that of non-CKAP4-knockout HCC1806 cells. The number of invasive cells of CKAP4-knockout MDA-MB-231 cells was decreased compared with that of non-CKAP4-knockout MDA-MB-231 cells. This indicates that knocking out CKAP4 can inhibit the invasion of breast cancer cells.

[0167] Knockout of CKAP4 inhibits the proliferation of xenografts in vivo

[0168] In some test cases, CKAP4-knockout HCC1806 cells and CKAP4-knockout MDA-MB-231 cells were injected into the transplanted tumors of breast cancer model mice to test the proliferation of the transplanted tumors. The specific steps are as follows:

[0169] Six-week-old female BALB / c nude mice (Beijing) were raised under specific pathogen-free (SPF) conditions. All animal experiments were approved by the Animal Ethics Committee. As Figure 16 shown in A, 1×10 6 CKAP4-knockout HCC1806 breast cancer cells or CKAP4-knockout MDA-MB-231 cells were subcutaneously injected into the mammary fat pads of nude mice, and the size of subcutaneous tumors was observed every 4 days. The growth of tumors was dynamically observed with a vernier caliper, and the calculation formula was volume = 1 / 2 (width2 × length), to obtain breast cancer model mice (shCKAP4-1 group and shCKAP4-2 group). And 1×10 6 HCC1806 breast cancer cells or MDA-MB-231 cells were used as the control group (Ctrl). After 22 days of observation, at the end point of observation, euthanasia was performed by rapid cervical dislocation. The tumors were excised and weighed. The tumor tissues were sampled, dehydrated, embedded, sectioned, and stained with HE for histological morphology observation and immunohistochemical analysis. The specific methods were the same as described above.

[0170] As Figure 16 B, Figure 16 C and Figure 16 D show, compared with the control group, the tumor growth rates of the shCKAP4-1 group and the shCKAP4-2 group were significantly slowed down, and the volumes and weights of the transplanted tumors were significantly decreased. As Figure 16 E shows, the number of cells positive for the cell proliferation protein Ki-67 in the xenograft tumors of the shCKAP4-1 group and the shCKAP4-2 group was less than that of the control group. This indicates that CKAP4 knockdown effectively inhibits the growth of breast cancer tumors in vivo.

[0171] According to the above test examples, CKAP4 expression in breast cancer cells HCC1806 and MDA-MB-231 can be knocked down by double-stranded RNA, thereby inhibiting the proliferation, migration and invasion of breast cancer cells in vitro and in vivo, and can arrest breast cancer cells at the G1 phase and promote apoptosis of breast cancer cells. Therefore, the double-stranded RNA provided in the examples, the recombinant lentiviral vector containing the double-stranded RNA and the recombinant lentivirus all have the application prospect of developing into breast cancer drugs.

[0172] In addition, the test examples found that the expression of PLBD2 and MCM6 in breast cancer cells was inhibited by knocking down CKAP4. Based on this, the examples provide a PLBD2 inhibitor, which includes at least one of double-stranded RNA interfering with PLBD2 expression, a recombinant lentivirus containing the double-stranded RNA, and a recombinant lentiviral vector containing the double-stranded RNA. The examples also provide an MCM6 inhibitor, which includes at least one of double-stranded RNA interfering with MCM6 expression, a recombinant lentivirus containing the double-stranded RNA, and a recombinant lentiviral vector containing the double-stranded RNA.

[0173] In addition, the test examples also found that CKAP4 interacts with PLBD2 and MCM6 in breast cancer cells, and knocking down CKAP4 can down-regulate PLBD2 and MCM6. Down-regulating CKAP4 can inhibit the proliferation, migration and invasion of breast cancer cells in vitro and in vivo, and can arrest breast cancer cells at the G1 phase and promote apoptosis of breast cancer cells.

[0174] Therefore, the examples also provide a breast cancer drug, which uses at least one of double-stranded RNA interfering with PLBD2 expression, a recombinant lentivirus containing the double-stranded RNA, and a recombinant lentiviral vector containing the double-stranded RNA as an active ingredient.

[0175] The examples also provide a breast cancer drug, which uses at least one of double-stranded RNA interfering with MCM6 expression, a recombinant lentivirus containing the double-stranded RNA, and a recombinant lentiviral vector containing the double-stranded RNA as an active ingredient.

[0176] As described above, it is only the preferred specific implementation manner of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. Biomarkers associated with breast cancer prognosis, including at least one of PLBD2 and MCM6.

2. A kit for predicting breast cancer prognosis, comprising at least one of RT-PCR reagents for detecting the relative expression level of CKAP4 mRNA, RT-PCR reagents for detecting the relative expression level of PLBD2 mRNA, and RT-PCR detection reagents for detecting the expression level of MCM6.

3. The kit according to claim 2, wherein The RT-PCR reagents for detecting the relative expression level of CKAP4 mRNA include primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2; Optionally, the RT-PCR reagents for detecting the relative expression level of PLBD2 mRNA include primer pairs shown in SEQ ID NO:3 and SEQ ID NO:4; Optionally, the RT-PCR reagents for detecting the relative expression level of MCM6 mRNA include primer pairs shown in SEQ ID NO:5 and SEQ ID NO:

6.

4. Use of at least one of RT-PCR reagents for detecting the relative expression level of CKAP4 mRNA, RT-PCR reagents for detecting the relative expression level of PLBD2 mRNA, and RT-PCR detection reagents for detecting the expression level of MCM6 in the preparation of a kit for detecting breast cancer prognosis; Among them, The RT-PCR reagents for detecting the relative expression level of CKAP4 mRNA include primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2; The RT-PCR reagents for detecting the relative expression level of PLBD2 mRNA include primer pairs shown in SEQ ID NO:3 and SEQ ID NO:4; Optionally, the RT-PCR reagents for detecting the relative expression level of MCM6 mRNA include primer pairs shown in SEQ ID NO:5 and SEQ ID NO:

6.

5. A kit for predicting breast cancer prognosis, comprising at least one of antibodies for detecting the expression level of CKAP4 protein, antibodies for detecting the expression level of PLBD2 protein, and antibodies for detecting the expression level of MCM6 protein.

6. Use of at least one of antibodies for detecting the expression level of CKAP4 protein, antibodies for detecting the expression level of PLBD2 protein, and antibodies for detecting the expression level of MCM6 protein in the preparation of a kit for detecting breast cancer prognosis.

7. PLBD2 inhibitors, including at least one of double-stranded RNAs interfering with PLBD2 expression, recombinant lentiviruses containing the double-stranded RNAs, and recombinant lentiviral vectors containing the double-stranded RNAs.

8. MCM6 inhibitors, including at least one of double-stranded RNAs interfering with MCM6 expression, recombinant lentiviruses containing the double-stranded RNAs, and recombinant lentiviral vectors containing the double-stranded RNAs.

9. A breast cancer drug, which uses at least one of double-stranded RNAs interfering with PLBD2 expression, recombinant lentiviruses containing the double-stranded RNAs, and recombinant lentiviral vectors containing the double-stranded RNAs as active ingredients.

10. A breast cancer drug, which uses at least one of double-stranded RNA that interferes with MCM6 expression, recombinant lentivirus containing the double-stranded RNA, and recombinant lentiviral vector containing the double-stranded RNA as an active ingredient.

Images