Primer set and kit for detecting EWSR1 non-ETS fusion round cell sarcoma and their application

Abstract

The present invention relates to the field of biological detection, and specifically to a primer set, a kit and a method of use for detecting EWSR1 non-ETS fusion round cell sarcoma. The primer set for detecting EWSR1 non-ETS fusion round cell sarcoma of the present invention comprises 9 primer sequences in primer set A and primer set B. The present invention divides the variant types of EWSR1 non-ETS fusion sarcoma into 5 variant types, and divides the 5 fusion variant types into two groups, and specifically designs two sets of upstream and downstream amplification primer sets. Each fusion variant type can amplify a target product peak of 100-250 bp in size. Thus, the primers provided by the present invention can detect 5 variant types of 3 types of gene fusion at one time. By combining the primer set of the present invention with multiplex fluorescence PCR and high-resolution capillary electrophoresis, the minimum detection limit is 10 copies, providing a sensitive and efficient method for detecting EWSR1 non-ETS fusion round cell sarcoma, which is simple and convenient, has accurate results and is economical.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and particularly relates to an EWSR1 non-ETS fusion round cell sarcoma detection primer set, a kit and applications thereof. Background Art

[0002] EWSR1 non-ETS fusion round cell sarcoma is a type of Ewing sarcoma characterized by fusions of the EWSR1 gene with a non-ETS family gene. This type of sarcoma has been reclassified as "EWSR1 non-ETS fusion round cell sarcoma" in the 2020 WHO classification. These sarcomas possess characteristic fusion genes, primarily EWSR1::NFATC2, FUS::NFATC2, and EWSR1::PATZ1. Tumor cells in EWSR1::NFATC2 or FUS::NFATC2 fusion sarcomas are typically small to medium-sized, round or spindle-shaped, arranged in cords, small nests, trabeculae, or pseudoacinar patterns. Their cytoplasm may be eosinophilic or clear, with uniform or markedly pleomorphic nuclear morphology, dense, hyperchromatic or vacuolated chromatin, small or prominent nucleoli, and a hyalinized or myxoid matrix. Mitotic figures may be frequent or infrequent. In 50% of cases, CD99 is diffusely positive, AE1 / AE3 is punctately positive near the nucleus, and NKX2.2 and PAX7 may be expressed. CD138 is focally expressed, and Ki-67 is highly expressed. The tumor cells of EWSR1-PATZ1 fusion sarcomas are small round or spindle cells, often with a fibrous stroma. Necrosis and mitotic figures may or may not be evident.

[0003] EWSR1 non-ETS fusion round cell sarcomas are extremely rare and have complex and diverse histomorphology. They share certain histological and immunohistochemical similarities with various round cell and spindle cell bone and soft tissue sarcomas, including Ewing sarcoma, CIC-rearranged sarcomas, sarcomas with BCOR genetic alterations, myoepithelial tumors, extraskeletal myxoid chondrosarcomas, ossifying fibromyxoid tumors, and sclerosing epithelioid fibrosarcoma. These tumors are clinically differentiated from a variety of bone and soft tissue sarcomas. However, differential diagnosis based solely on histological morphology and immunohistochemical expression is difficult, and sensitive and efficient methods for detecting genetic mutations are urgently needed.

[0004] Clinical methods for detecting genetic mutations in these tumors primarily include fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR), and next-generation sequencing (NGS). FISH is suitable for detecting single fusion genes but not for screening multiple mutations. RNA / DNA-based NGS is expensive, complex, and time-consuming, making it difficult to implement in clinical practice. Summary of the Invention

[0005] To solve the above technical problems, the present application provides a detection primer set, a kit and its application for EWSR1 non-ETS fusion round cell sarcoma based on the combined application method of multiplex fluorescence PCR and high-resolution capillary electrophoresis, which is simple and convenient, has accurate results and is economical.

[0006] This study collated literature reports and local laboratory test samples, totaling more than 100 cases of EWSR1 non-ETS sarcoma fusion gene data, unified reference gene transcripts, and summarized five mutation combination types based on the three common types of gene fusions in EWSR1 non-ETS fusion sarcomas (EWSR1::NFATC2, FUS::NFATC2, and EWSR1::PATZ1):

[0007] T1:EWSR1 Exon5::NFATC2 Exon3;

[0008] T2:EWSR1 Exon6::NFATC2 Exon3;

[0009] T3: EWSR1 Exon8::NFATC2 Exon3;

[0010] T4:FUS Exon6::NFATC2 Exon3;

[0011] T5: EWSR1 Exon8:: PATZ1 Eoxn1 (11 breakaway fusion sites).

[0012] The five variant types were divided into channel A: NFATC2-related fusion genes and channel B: EWSR1::PATZ1-related fusion genes. Based on this division, upstream and downstream primers specific for each variant type were designed and combined for testing. Two sets of upstream and downstream amplification primer combinations were designed to amplify the target product peak of 100-250 bp for each fusion type.

[0013] According to a specific embodiment of the present invention, the EWSR1 non-ETS fusion round cell sarcoma detection primer set includes at least one of primer set A and primer set B, wherein

[0014] Primer set A: includes upstream primers SEQ ID NO.1-4 and downstream primer SEQ ID NO.5,

[0015] SEQ ID NO.1: 5'-TGATACCACCACTGCTACA-3';

[0016] SEQ ID NO.2: 5'-GGATATGGACAGAGTAACTACA-3';

[0017] SEQ ID NO.3: 5'-GCAGGAGTCTGGAGGATT-3';

[0018] SEQ ID NO.4: 5'-GGCAATCAAGACCAGAGT-3';

[0019] SEQ ID NO.5: 5'-GTAAGAGCCTGACTGACTG-3';

[0020] Primer set B: including upstream primers SEQ ID NO. 6, 7 and downstream primers SEQ ID NO. 8, 9,

[0021] SEQ ID NO.6: 5'-GCAGGAGTCTGGAGGATT-3';

[0022] SEQ ID NO.7: 5'-TGGAGGCATGAGCAGAG-3';

[0023] SEQ ID NO.8: 5'-TTCTCTTGAACCGCAACC-3';

[0024] SEQ ID NO.9: 5'-AGGAGGAAGGTCGATGTAG-3'.

[0025] Among them, primer set A detects EWSR1 Exon5 :: NFATC2 Exon3, EWSR1 Exon6 :: NFATC2Exon3, EWSR1 Exon8 :: NFATC2 Exon3 and FUS Exon6 :: NFATC2 Exon3.

[0026] Primer set B detects EWSR1 Exon8 :: PATZ1 Eoxn1 (11 break-fusion sites).

[0027] According to the EWSR1 non-ETS fusion round cell sarcoma detection primer set of a specific embodiment of the present invention, the upstream primer is further labeled with a fluorescent group.

[0028] According to the EWSR1 non-ETS fusion round cell sarcoma detection primer set in a specific embodiment of the present invention, the fluorescent group is selected from FAM, VIC or TAMRA.

[0029] Preferably, the combination of primer sequence and fluorescent group is as follows:

[0030] In primer set A,

[0031] Upstream EWSR1 fluorescent primer SEQ ID NO.1: 5'-TGATACCACCACTGCTACA - FAM-3'.

[0032] Upstream EWSR1 fluorescent primer SEQ ID NO.2: 5'- GGATATGGACAGAGTAACTACA - FAM-3'.

[0033] Upstream EWSR1 fluorescent primer SEQ ID NO.3: 5'- GCAGGAGTCTGGAGGATT - FAM-3'.

[0034] Upstream FUS fluorescent primer SEQ ID NO.4: 5'- GGCAATCAAGACCAGAGT - VIC-3'.

[0035] In primer set B,

[0036] Upstream EWSR1 fluorescent primer SEQ ID NO.6: 5'- GCAGGAGTCTGGAGGATT - FAM-3';

[0037] Upstream EWSR1 fluorescent primer SEQ ID NO.7: 5'-TGGAGGCATGAGCAGAG - VIC-3'.

[0038] The present invention provides an EWSR1 non-ETS fusion round cell sarcoma detection kit, which includes the above-mentioned EWSR1 non-ETS fusion round cell sarcoma detection primer set, wherein primer set A and primer set B are respectively arranged in two different tubes.

[0039] According to a specific embodiment of the present invention, the detection kit further includes a positive control, a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

[0040] Preferably, the negative control is pure water.

[0041] Preferably, the positive control is a plasmid containing a fusion gene, and the sequence of the fusion gene is SEQ ID NO.12-SEQ ID NO.16.

[0042] SEQ ID NO.12: T1 type EWSR1 Exon5:: NFATC2 Exon3 fusion gene:

[0043] 5’-gttatactactccaactgccccccaggcatacagccagcctgtccaggggtatggcactggtgcttatgataccaccactgctacagtcaccaccacccaggcctcctatgcagctcagtctgcatatggcactcagcctgcttatccagcctatgggcagcagccagcagccactgcacctacaagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcagctccatggctacatggaaaacaagcctctgggacttcagatcttcattgggacagctgatgagcggatc-3’。

[0044] SEQ ID NO.13: T2 type EWSR1 Exon6 :: NFATC2 Exon3 fusion gene:

[0045] 5’-ctgcttatccagcctatgggcagcagccagcagccactgcacctacaagAccgcaggatggaaacaagcccactgagactagtcaacctcaatctagcacagggggttacaaccagcccagcctaggatatggacagagtaactacagttatccccaggtacctgggagctaccccatgcagccagtcactgcacctccatcctaccctcctaccagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’。

[0046] SEQ ID NO.14: T3-type EWSR1 Exon8::NFATC2 Exon3 fusion gene:

[0047] 5’-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaagagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’.

[0048] SEQ ID NO.15, T4-type FUS Exon6::NFATC2 Exon3 fusion gene:

[0049] 5’-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’.

[0050] SEQ ID NO.16: T5 type EWSR1 Exon8:: PATZ1 Eoxn1 fusion gene:

[0051] 5'-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaa gagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggaggtgttcactgatgccaaccggctccggcagcacgaggcccagcacggtgtcacc agcctccagctgggctacatcgaccttcctcctccgaggctgggtgagaatgggctacccatctctgaagaccccgacggcccccgaaagaggagccggaccaggaagcaggtggcttgt gagatctgcggcaagatcttccgtgatgtgtatcatcttaaccggcacaagctgtcccactctggggagaagccctactcctgccctgtgtgtgggttgcggttcaagagaaaagac-3'.

[0052] The detection kit according to a specific embodiment of the present invention further includes primers for the internal reference gene HPRT1.

[0053] Preferably, the primer sequence of the internal reference gene HPRT1 is as follows:

[0054] SEQ ID NO.10: 5'-CCCTGGCGTCGTGATTAGTG-3';

[0055] SEQ ID NO. 11: 5'-GAGCACACAGAGGGCTACAA-3'.

[0056] Preferably, the downstream primer sequence of the internal reference gene is labeled with a fluorescent group.

[0057] More preferably, the combination of the downstream primer sequence of the internal reference gene and the fluorescent group is:

[0058] 5'-GAGCACACAGAGGGCTACAA-ROX-3'.

[0059] Beneficial effects of the present invention:

[0060] The present invention divides the variant types of EWSR1 non-ETS fusion round cell sarcoma into five variant types, and divides the five fusion variant types into two groups. Two sets of upstream and downstream amplification primers are designed specifically for this purpose. Each fusion variant type can amplify a target product peak of 100-250 bp in size. Therefore, the primers provided by the present invention can detect five variant types of three types of gene fusion at one time.

[0061] By combining the primer set of the present invention with multiplex fluorescent PCR and high-resolution capillary electrophoresis, the minimum detection limit is 10 copies, the kit detection results are completely consistent with the morphological diagnosis results, and the methodological consistency reaches 100%. Therefore, the present invention provides a sensitive and efficient method for detecting EWSR1 non-ETS fusion round cell sarcoma, which is simple, convenient, accurate and economical. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0063] Figure 1 The results showed that the kit had good detection effect for T1 type EWSR1 Exon5 :: NFATC2 Exon3 fusion gene in the range of 1-1000 copies, with the product being a 179 bp FAM peak and the minimum detection limit being 1 copy.

[0064] Figure 2 The results showed that the kit had good detection effect on the T2 type EWSR1 Exon6 :: NFATC2 Exon3 fusion gene in the range of 10-1000 copies, with the product being a 151 bp FAM peak and the minimum detection limit being 10 copies.

[0065] Figure 3 The results showed that the kit had good detection effect on the T3 type EWSR1 Exon8::NFATC2 Exon3 fusion gene in the range of 10-1000 copies, with the product being a 200 bp FAM peak and the minimum detection limit being 10 copies.

[0066] Figure 4 The results showed that the kit had good detection effect on the T4 type FUS Exon6 :: NFATC2 Exon3 fusion gene in the range of 10-1000 copies, with the product being a 243 bp VIC peak and a minimum detection limit of 10 copies.

[0067] Figure 5 The results showed that the kit has good detection effect for T5 type EWSR1 Exon8 :: PATZ1 Exon1 fusion gene in the range of 1-1000 copies, with the product being a 134bp VIC peak and the minimum detection limit being 1 copy.

[0068] Figure 6 The kit was used to detect the presence of T1-type EWSR1 Exon5::NFATC2 Exon3 fusion in 24 samples (a). The PCR amplification products of the positive samples were verified by Sanger sequencing (b). DETAILED DESCRIPTION

[0069] To make the objectives, technical solutions, and advantages of the present invention more apparent, the technical solutions of the present invention will be described in detail below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other implementations obtained by those of ordinary skill in the art without inventive effort are within the scope of protection of the present invention.

[0070] Example 1 Primer Design

[0071] This study collated data from literature reports and local laboratory testing samples, totaling over 100 EWSR1 non-ETS sarcoma fusion gene cases. Using a unified reference gene transcript, we identified five variant combination types (Table 1) based on the three common gene fusions seen in EWSR1 non-ETS fusion sarcomas (EWSR1::NFATC2, FUS::NFATC2, and EWSR1::PATZ1). These five variant types were divided into two categories: NFATC2-related fusion genes (A) and EWSR1::PATZ1-related fusion genes (B). Based on this division, specific upstream and downstream primers were designed for each variant type and tested in combination. The primer sets in each tube must meet the following requirements:

[0072] ① The primer combination in each tube can amplify all target fragments in the tube;

[0073] ②The total number of primers should be as small as possible to reduce unnecessary cross-reactions;

[0074] ③ The difference in the amplified products of each primer pair is greater than or equal to 2 bp to meet the resolution requirements of high-resolution capillary electrophoresis instrument;

[0075] ④ Each amplified fragment must be larger than 100 bp to avoid primer dimer interference and as small as possible to be equal to or smaller than 250 bp to accommodate the highly degraded nucleic acids found in the most common clinical paraffin tumor specimens;

[0076] ⑤The primer combinations in each tube did not produce specific amplification with genomic DNA.

[0077] At the same time, since the breakage and fusion points of the PATZ1 gene (NM_014323) in the B tube are scattered in the exon 1 region, the present invention simultaneously designed two sets of upstream and downstream amplification primer combinations to meet the purpose of amplifying the target product peak of 100-250bp in size for each fusion type.

[0078] Based on the above principles, multiple primer combinations were designed, optimized, and tested. The final primer set, specifically for EWSR1 non-ETS sarcoma variants, was selected. This multiplex primer set, combined with specific fluorophores, enables simultaneous detection of five variants across three gene fusion categories (Table 1), with a minimum detection limit of 10 copies and a minimum detection time of 240 minutes. Primer set A detects EWSR1::NFATC2 and FUS::NFATC2 fusions, primer set B detects EWSR1::PATZ1, and primer set C detects expression of the internal reference gene HPRT1, used for quality control of sample nucleic acid.

[0079] Table 1 Detection kit design and primer sequences used

[0080]

[0081] The reaction system in each tube is shown in Table 2:

[0082] Table 2 Reaction system for each tube (25 μL as an example)

[0083]

[0084] Note: 2×PCR reaction buffer contains Taq enzyme, Mg 2+ , PCR buffer, dNTPs, etc.

[0085] In addition to the reaction systems in tubes A, B, and C, the kit also includes positive and negative controls. The negative control consists of pure water, while the positive control consists of a plasmid standard containing the fusion gene fragment (1000 copies / μl). The corresponding gene variants and their inserted nucleotide sequences for each positive control tube are shown below:

[0086] Tube A, T1 type EWSR1 Exon5::NFATC2 Exon3 fusion:

[0087] 5’-gttatactactccaactgccccccaggcatacagccagcctgtccaggggtatggcactggtgcttatgataccaccactgctacagtcaccaccacccaggcctcctatgcagctcagtctgcatatggcactcagcctgcttatccagcctatgggcagcagccagcagccactgcacctacaagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcagctccatggctacatggaaaacaagcctctgggacttcagatcttcattgggacagctgatgagcggatc-3’。

[0088] Tube A, T2 type EWSR1 Exon6 :: NFATC2 Exon3 fusion:

[0089] 5’-ctgcttatccagcctatgggcagcagccagcagccactgcacctacaagAccgcaggatggaaacaagcccactgagactagtcaacctcaatctagcacagggggttacaaccagcccagcctaggatatggacagagtaactacagttatccccaggtacctgggagctaccccatgcagccagtcactgcacctccatcctaccctcctaccagcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’。

[0090] Tube A, T3 type EWSR1 Exon8 :: NFATC2 Exon3 fusion:

[0091] 5’-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaagagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’.

[0092] Tube A, T4-type FUS Exon6::NFATC2 Exon3 fusion:

[0093] 5’-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcatcccagtgactgcatccctccctccacttgagtggccgctgtccagtcagtcaggctcttacgagctgcggatcgaggtgcagcccaagccacatcaccgggcccactatgagacagaaggcagccgaggggctgtcaaagctccaactggaggccaccctgtggttcag-3’.

[0094] Tube B, T5-type EWSR1 Exon8::PATZ1 Eoxn1 fusion:

[0095] 5'-gttcattccgacaggaccaccccagtagcatgggtgtttatgggcaggagtctggaggattttccggaccaggagagaaccggagcatgagtggccctgataaccggggcaggggaa gagggggatttgatcgtggaggcatgagcagaggtgggcggggaggaggacgcggtggaatgggaggtgttcactgatgccaaccggctccggcagcacgaggcccagcacggtgtcacc agcctccagctgggctacatcgaccttcctcctccgaggctgggtgagaatgggctacccatctctgaagaccccgacggcccccgaaagaggagccggaccaggaagcaggtggcttgt gagatctgcggcaagatcttccgtgatgtgtatcatcttaaccggcacaagctgtcccactctggggagaagccctactcctgccctgtgtgtgggttgcggttcaagagaaaagac-3'.

[0096] The PCR amplification procedure used in the test is as follows:

[0097] Table 3 Amplification procedures

[0098]

[0099] The obtained PCR amplification products were added with HiDi and Liz600 molecular internal standards and electrophoresed on a high-resolution capillary electrophoresis instrument (ABI3500). The molecular weight of the amplified products was analyzed using Gene Mapper software.

[0100] The test results and their interpretation criteria are shown in Table 4 below.

[0101] Table 4 Results interpretation criteria

[0102]

[0103] First, check tube C for the presence of a 190 bp ROX amplification peak. If not, the nucleic acid quality control has failed and the nucleic acid needs to be re-extracted for the experiment. If present, the nucleic acid quality control has passed.

[0104] Next, check whether there is an amplification peak of corresponding fluorescent color and size in tube A or tube B:

[0105] The 179 / 151 / 200 product peaks of FAM fluorescence in tube A correspond to T1 / T2 / T3 type EWSR1 :: NFATC2 fusions, respectively, and the 243 bp product peak of VIC fluorescence corresponds to T4 type FUS :: NFATC2 fusions;

[0106] The product peaks between 100 and 250 bp in tube B's FAM or VIC fluorescence correspond to EWSR1 :: PATZ1 fusions at different fusion sites;

[0107] If there is no product peak in tubes A and B, it is judged as negative and no relevant gene fusion is detected.

[0108] Example 2 Performance Test

[0109] The performance of the above kit was tested. Plasmids with corresponding fusion gene fragments (T1-T5) were used as fusion gene detection standards. Gradient standard solutions of corresponding concentrations (1, 10, 100, 1000 copies / μl) were prepared as amplification templates. The kit of the present invention and its detection procedure were used. The detection results of T1-T5 type mutants were as follows: Figure 1-5 shown.

[0110] Figure 1 The results showed that the detection of T1-type EWSR1 Exon5::NFATC2 Exon3 fusion gene had a good detection effect in the range of 1-1000 copies, the product was a 179 bp FAM peak, and the minimum detection limit was 1 copy.

[0111] Figure 2 The results showed that the detection of T2-type EWSR1 Exon6 :: NFATC2 Exon3 fusion gene was effective in the range of 10-1000 copies, with the product being a 151 bp FAM peak and the minimum detection limit being 10 copies.

[0112] Figure 3 The results showed that the detection of T3 type EWSR1 Exon8 :: NFATC2 Exon3 fusion gene had a good detection effect in the range of 10-1000 copies, the product was a 200 bp FAM peak, and the minimum detection limit was 10 copies.

[0113] Figure 4 The results showed that the T4-type FUS Exon6::NFATC2 Exon3 fusion gene had a good detection effect in the range of 10-1000 copies, with the product being a 243 bp VIC peak and a minimum detection limit of 10 copies.

[0114] Figure 5The results showed that the detection of T5 type EWSR1 Exon8 :: PATZ1 Exon1 fusion gene had a good detection effect in the range of 1-1000 copies, the product was a 134bp VIC peak, and the minimum detection limit was 1 copy.

[0115] Example 3

[0116] The detection performance of the kit was tested using 24 real tumor samples (18 Ewing sarcomas, 6 Ewing-like sarcomas including 3 sarcomas with BCOR genetic abnormalities, 2 CIC rearranged sarcomas, and 1 EWSR1 non-ETS sarcoma).

[0117] All samples passed nucleic acid quality control, and only one EWSR1::NFATC2 fusion was detected. The PCR amplification products of the positive samples were subjected to Sanger sequencing, and the results were consistent with those of this kit. Figure 6 shown.

[0118] The histological types of the samples were analyzed. The histological diagnosis of the positive samples was consistent with EWSR1 non-ETS sarcoma. The results are shown in Table 5. The test results of the remaining cases were negative.

[0119] Table 5 Detection results of real tumor samples

[0120]

[0121] In summary, the test kit results of 24 tumor patient samples were all consistent with the morphological diagnosis results, and the methodological consistency reached 100%.

[0122] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in the present invention should be included in the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.

Claims

1. EWSR1 non-ETS fusion round cell sarcoma detection primer set, characterized by: The primer set includes primer set A and primer set B, wherein Primer set A: includes upstream primers SEQ ID NO.1-4 and downstream primer SEQ ID NO.5, SEQ ID NO.1: 5'-TGATACCACCACTGCTACA-3'; SEQ ID NO.2: 5'-GGATATGGACAGAGTAACTACA-3'; SEQ ID NO.3: 5'-GCAGGAGTCTGGAGGATT-3'; SEQ ID NO.4: 5'-GGCAATCAAGACCAGAGT-3'; SEQ ID NO.5: 5'-GTAAGAGCCTGACTGACTG-3'; Primer group B: including upstream primers SEQ ID NO.6, 7 and downstream primers SEQ ID NO.8, 9, SEQ ID NO.6: 5'-GCAGGAGTCTGGAGGATT-3'; SEQ ID NO.7: 5'-TGGAGGCATGAGCAGAG-3'; SEQ ID NO.8: 5'-TTCTCTTGAACCGCAACC-3'; SEQ ID NO.9: 5'-AGGAGGAAGGTCGATGTAG-3'; The upstream primer is further labeled with a fluorescent group; the fluorescent group is selected from FAM, VIC or TAMRA.

2. EWSR1 non-ETS fusion round cell sarcoma detection kit, characterized in that: The kit comprises the EWSR1 non-ETS fusion round cell sarcoma detection primer set according to claim 1.

3. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 2, characterized in that: The kit further comprises a positive control, a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

4. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 3, characterized in that The negative control was pure water.

5. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 3, characterized in that The positive control is a plasmid containing a fusion gene, and the sequence of the fusion gene is SEQ ID NO.12-SEQ ID NO.

16.

6. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 3, characterized in that The kit also includes primers for the internal reference gene HPRT1.

7. The detection kit for EWSR1 non-ETS fusion round cell sarcoma according to claim 6, characterized in that The primer sequences for the internal reference gene HPRT1 are as follows: SEQ ID NO.10: 5'-CCCTGGCGTCGTGATTAGTG-3'; SEQ ID NO. 11: 5'-GAGCACACAGAGGGCTACAA-3'.

Images