DNA methylation site marker related to photoperiod-induced oestrus of sheep and detection method of DNA methylation site marker

Abstract

The invention provides a DNA methylation site marker related to photoperiod-induced oestrus of sheep and a detection method of the DNA methylation site marker, and belongs to the technical field of animal breeding. The invention discloses a DNA (deoxyribonucleic acid) methylation site marker related to oestrus of sheep induced by a photoperiod. The DNA methylation site marker is composed of eight CG motifs in a chr 2: 58396975-58397144 region on a chromosome 2 on a oarv4.0 genome version of the sheep. The DNA methylation site marker provided by the invention is related to the oestrus state of the sheep, and the sites can be subjected to DNA methylation detection in the production process of the sheep, so that the oestrus state of the sheep is determined, and reference is provided for the production of the sheep.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal breeding, and particularly relates to a DNA methylation site marker related to photoperiod-induced estrus in sheep and a detection method thereof. Background Art

[0002] In order to improve the reproductive efficiency of sheep and optimize the flock structure, by screening estrus sheep, the breeding time can be arranged specifically, which can effectively improve the conception rate and the number of lambs born, and promote the breeding of the flock. Therefore, accurately judging the estrus period can significantly reduce the breeding failure rate and the non-pregnancy rate, and improve the conception rate, calving rate, etc. of animals. At present, the common identification methods for estrus sheep still mainly rely on traditional methods for the estrus identification of livestock. These methods mainly rely on the observation and perception ability of people. Therefore, the detection results are limited by the experience of breeding personnel and the intensity of the estrus performance of female livestock. Modern biological means and various automated monitoring devices may supplement or even replace traditional estrus identification methods in the future. By detecting parameters such as hormone levels, activity changes, temperature changes, cell changes, standing or lying time, and rumination time during animal estrus, and based on long-term tracking records of animal estrus, the estrus process of animals can be determined. However, these methods are cumbersome to detect and time-consuming, and cannot meet the requirements of rapid and accurate identification. Summary of the Invention

[0003] In view of this, the purpose of the present invention is to provide a DNA methylation site marker related to photoperiod-induced estrus in sheep, and by detecting the methylation level of specific sites, the estrus or anestrus situation of sheep can be accurately judged, so as to achieve the purpose of rapid screening of estrus sheep.

[0004] The present invention provides a DNA methylation site marker related to photoperiod-induced estrus in sheep, which is 8 CG motifs in the region of chr 2: 58396975-58397144 on chromosome 2 in the sheep oar_v4.0 genome version.

[0005] Preferably, there are 8 CG motifs on the DNA fragment shown in SEQ ID NO:1 or the complementary sequence of the DNA fragment.

[0006] The present invention provides the application of a reagent for detecting the DNA methylation site marker in sheep breeding or screening estrus sheep.

[0007] The present invention provides a primer for detecting the DNA methylation site marker, including a first primer pair and a second primer pair;

[0008] The first primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3;

[0009] The second primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:5.

[0010] Preferably, it further includes a first sequencing primer and a second sequencing primer;

[0011] The nucleotide sequence of the first sequencing primer is as shown in SEQ ID NO:4;

[0012] The nucleotide sequence of the second sequencing primer is as shown in SEQ ID NO:6.

[0013] The present invention provides a kit for detecting the estrus condition of sheep, including the primers.

[0014] Preferably, it further includes 2×Pyro Mark PCR Master Mix, 5×Q-solution and 10×PCR CoraLoad Concentrate.

[0015] The present invention provides the application of the primers or the kit in detecting the estrus cycle or anestrus cycle of sheep.

[0016] The present invention provides a method for detecting the estrus cycle or anestrus cycle of sheep, including the following steps: extracting the DNA of the sample to be tested;

[0017] obtaining the methylation level of the DNA methylation site marker from the DNA of the sample to be tested;

[0018] When the methylation level of the sample to be tested is significantly increased compared with the methylation level of non-estrus sheep, it indicates that the sample to be tested is in the estrus cycle, otherwise the sample to be tested is in the anestrus cycle.

[0019] Preferably, the method for obtaining the methylation level of the DNA methylation site marker includes amplifying using the primers, obtaining an amplification product, performing pyrosequencing using the first sequencing primer and the second sequencing primer in the primers, and analyzing the methylation levels of 8 sites.

[0020] The present invention provides a DNA methylation site marker related to photoperiod-induced estrus in sheep, which is 8 CG motifs in the region of chr2: 58396975-58397144 on chromosome 2 of the sheep oar_v4.0 genome version. The DNA methylation level of the DNA methylation site marker is closely related to the photoperiod-induced estrus situation in sheep. Therefore, it is possible to determine whether a sheep is in the estrus cycle or anestrus cycle by detecting the methylation level of the DNA methylation site marker. The present invention provides a simple and effective way for screening estrus sheep in the process of sheep breeding and has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 are the results of the DNA methylation levels of 8 GC sites in the DNA methylation site marker of sheep in estrus and anestrus; Figure 2 are the statistical results of the DNA methylation levels of 8 GC sites in the DNA methylation site marker of sheep after treatment with long photoperiod or short photoperiod. DETAILED DESCRIPTION OF THE INVENTION

[0022] The present invention provides a DNA methylation site marker related to photoperiod-induced estrus in sheep, which is 8 CG motifs in the region of chr2: 58396975-58397144 on chromosome 2 of the sheep oar_v4.0 genome version.

[0023] In the present invention, the DNA methylation site marker is located in the promoter region of the GNAQ gene on chromosome 2 of sheep, and the positions of the 8 CG motifs are the 58396975bp, 58397013bp, 58397030bp, 58397045bp, 58397102bp, 58397120bp, 58397127bp, and 58397144bp of chromosome 2 in sequence. The DNA methylation site marker is preferably in SEQ ID NO:1 (G CG GATAGTTTCACCTATTAAGTCTCCCTTGCCCCTCTG CG AGACAGTG ACAATTC CG TGTCCTCCCCAGT CG CACTGCACAGTTGAGTGTATATTATTT TCTACTACTCAACTTGGATCAGAGGTGA CG GGACATACTTTCTAAC CG AA TGG CG TTTTAGAAATAGGAA CG8 CG motifs present on the DNA fragment shown in (G) or on the complementary sequence of the said DNA fragment.

[0024] In the present invention, the GNAQ gene regulates GnRH gene expression and reproductive hormone secretion in the kisspeptin and its receptor (Kisspeptin / Gprotein-coupledreceptors 54, KISS1 / GPR54) signaling pathway and is a key regulatory factor in the intracellular signal transduction process. Research shows that the GNAQ gene is highly expressed in the hypothalamus of Kazakh sheep. Since the activity of the hypothalamic-pituitary-gonadal (HPG) axis is affected by photoperiod, hypothalamic neurons of Kazakh fetal sheep (Kazakh sheep) were treated with folic acid at different concentrations. The results confirmed that appropriate folic acid concentration can promote the methylation of the GANQ promoter and affect GnRH secretion, thereby affecting the estrus of sheep. And the present invention obtains that the DNA methylation site marker provided by the present invention is related to the estrus state of sheep by exploring the effect of DNA methylation sites in the promoter region of the GNAQ gene on sheep estrus behavior. Therefore, the present invention provides an application of a reagent for detecting the said DNA methylation site marker in sheep breeding or screening estrus sheep. During the sheep production process, DNA methylation detection can be carried out on the DNA methylation site marker to determine the estrus state of the sheep, providing a reference for sheep production or breeding.

[0025] The present invention provides a primer for detecting the said DNA methylation site marker, including a first primer pair and a second primer pair; the first primer pair includes a forward primer with a nucleotide sequence shown in SEQ ID NO:2 (GGTATAAAAAGTTGGAAGTTAGTAGG) and a reverse primer with a nucleotide sequence shown in SEQ ID NO:3 (AAATATATCCCCTCACCTCTAATCCAAATT); the second primer pair includes a forward primer with a nucleotide sequence shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence shown in SEQ ID NO:5 (ACTCTTCCCCTAATTCAATATTCTTTCC).

[0026] In the present invention, the first primer pair and the second primer pair are obtained by dividing the DNA fragment with a nucleotide sequence shown in SEQ ID NO:1 into two segments and respectively designing amplification primers by the Assay Design software in Pyro Mark Assay Design 2.0 (Qiagen).

[0027] In the present invention, the primers preferably further include a first sequencing primer and a second sequencing primer. The nucleotide sequence of the first sequencing primer is shown as SEQ ID NO:4 (ATAATATACACTCAACTATACAAT); the first sequencing primer is used for sequencing the amplification product obtained by the first primer pair. The nucleotide sequence of the second sequencing primer is shown as SEQ ID NO:6 (ATTATTTAATTTGGATTAGAGGT). The second sequencing primer is used for sequencing the amplification product obtained by the second primer pair. The sequencing is preferably pyrosequencing.

[0028] In the present invention, the method for detecting the DNA methylation level of the DNA methylation site marked by the primer in the above technical solution preferably includes the following steps:

[0029] Treat the genomic DNA of the sample to be tested with bisulfite to obtain pretreated genomic DNA;

[0030] Using the pretreated genomic DNA as a template, configure PCR reaction systems with the first primer pair and the second primer pair respectively;

[0031] Perform PCR amplification on the configured PCR reaction systems to obtain PCR products;

[0032] Configure a sequencing reaction system with the PCR product and the first sequencing primer or the second sequencing primer;

[0033] Perform pyrosequencing on the sequencing reaction system to analyze the DNA methylation levels of 8 GC sites in the DNA methylation site marker.

[0034] There is no special limitation on the method for extracting the genomic DNA of the sample to be tested in the present invention, and the well-known animal tissue genomic DNA extraction protocol in the art can be used. In the embodiments of the present invention, the genomic DNA of the sample to be tested is extracted by the phenol-chloroform method.

[0035] In the present invention, the bisulfite treatment refers to performing bisulfite conversion on the obtained genomic DNA sample using the EpiTect Bisulfite Kit (QIAGEN, Germany). The purpose of bisulfite converting genomic DNA is to completely convert unmethylated cytosine in the DNA sequence into uracil. Then recover the treated genomic DNA.

[0036] In the present invention, the PCR reaction system is preferably 25 μL, comprising 12.5 μL of 2×Pyro Mark PCR Master Mix, 5 μL of 5×Q-solution, 2.5 μL of 10×PCR Cora Load Concentrate, 0.5 μL (10 μM) of each of the upstream and downstream primers, and 50 ng of bisulfite-treated genomic DNA, with the balance being ddH2O. The reaction program for PCR amplification is preferably pre-denaturation at 95 °C for 15 min; denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, extension at 72 °C for 30 s, for 45 cycles. The present invention places no special restrictions on the instrument for PCR amplification, and it can be carried out using a well-known PCR instrument in the art. The present invention places no special restrictions on the method of the sequencing reaction system, and a well-known sequencing reaction system in the art can be used. In the examples of the present invention, the sequencing reaction system is preferably carried out in a PyroMark Q96 ID system (Qiagen), and according to the manufacturer's instructions, a PyroMark Gold Q96 kit (Qiagen, Valencia, USA) is used. The pyrosequencing is commissioned to Beijing Sino-gold Biotechnology Co., Ltd. to complete.

[0037] The present invention provides a kit for detecting the estrus condition of sheep, comprising the primers.

[0038] In the present invention, the kit preferably further comprises 2×Pyro Mark PCR Master Mix, 5×Q-solution and 10×PCR Cora Load Concentrate. The present invention places no special restrictions on the sources of 2×Pyro Mark PCR Master Mix, 5×Q-solution and 10×PCR Cora Load Concentrate, and they can be obtained through well-known commercial channels in the art.

[0039] In view of the fact that the DNA methylation site marker is related to the estrus state of sheep, the estrus condition of sheep is judged by detecting the DNA methylation level of the DNA methylation site marker. Therefore, the present invention provides the application of the primers or the kit in detecting the estrus cycle or anestrus cycle of sheep.

[0040] The present invention provides a method for detecting the estrus cycle or anestrus cycle of sheep, comprising the following steps: extracting the DNA of a sample to be tested;

[0041] obtaining the methylation level of the DNA methylation site marker from the DNA of the sample to be tested;

[0042] When the methylation level of the sample to be tested is significantly higher than that of the non-estrous sheep, it indicates that the sample to be tested is in the estrus cycle, and vice versa, the sample to be tested is in the anestrus cycle.

[0043] In the present invention, the breed of the sheep preferably includes Sunite. The sheep is preferably a female sheep. The sample to be tested preferably includes sheep hypothalamus tissue. The methylation level of the DNA methylation site marker is obtained from the DNA of the sample to be tested.

[0044] In the present invention, the method for obtaining the methylation level of the DNA methylation site marker preferably includes amplifying using the primer to obtain an amplification product, performing pyrosequencing using the first sequencing primer and the second sequencing primer in the primer, and analyzing the methylation levels of 8 sites. Specifically, it is the same as the detection method for the DNA methylation level of the DNA methylation site marker described in the above technical solution based on the primer, and will not be elaborated here.

[0045] In the present invention, among the 8 CG sites in the DNA methylation site marker, in the order from 5' to 3', the 1st site, the 2nd site, the 3rd site, the 4th site, the 5th site, the 6th site, the 7th site, and the 8th site are defined in sequence. The DNA methylation levels of the 1st site, the 3rd site, the 5th site, the 6th site, the 7th site, and the 8th site in the estrus cycle sheep (short-day treated sheep) are all significantly higher than those in the anestrus cycle sheep (long-day treated sheep), and the DNA methylation levels of the 2nd site and the 4th site are significantly higher in SP42 than in LP42 (P < 0.05).

[0046] The following is a detailed description of a DNA methylation site marker related to photoperiod-induced estrus in sheep and its detection method provided by the present invention in conjunction with examples, but they should not be construed as limiting the protection scope of the present invention.

[0047] Example 1

[0048] Estrus is the basis for sheep reproduction. Identifying the estrus traits of female sheep epigenetically can improve the reproductive efficiency of the female sheep population and increase economic benefits. Therefore, in this example, the above 8 DNA methylation sites in the hypothalamus tissue of Sunite sheep during the estrus period and the anestrus period were detected.

[0049] Select 10 healthy, in the same physical condition, full-sib or half-sib parous Small Tail Han ewes aged 3 - 4 years. Collect hypothalamus tissues from 5 ewes in July (summer, anestrus). In addition, use vaginal sponges to synchronize the estrus of the other 5 ewes, and collect hypothalamus tissues 50 h after sponge removal (estrus). Extract genomic DNA from the hypothalamus tissues using the phenol-chloroform method. Perform DNA methylation analysis on 8 "CG" sites (sequentially defined as the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, and 8th sites) of the DNA sequence shown in SEQ ID NO:1 according to the pyrosequencing method. The primers for amplification and sequencing are shown in Table 1.

[0050] GCGGATAGTTTCACCTATTAAGTCTCCCTTGCCCCTCTGCGAGACAGTGACAATTC CG TGTCCTCCCCAGT CG CACTGCACAGTTGAGTGTATATTATTTTCTACTACTCAACTTGGATCAGAGGTGA CG GGACATACTTTCTAAC CG AATGGCGTTTTAGAAATAGGAACGG(SEQ ID NO:1), where the underlined parts indicate 8 "CG" sites.

[0051] Table 1 Primer sequences for amplification and sequencing

[0052] Primer Name Primer Sequence GNAQ-F1 GGTATAAAAAGTTGGAAGTTAGTAGG(SEQ ID NO:2) GNAQ-R1 AAATATATCCCCTCACCTCTAATCCAAATT(SEQ ID NO:3) GNAQ-S1 ATAATATACACTCAACTATACAAT(SEQ ID NO:4) GNAQ-F2 GGTATAAAAAGTTGGAAGTTAGTAGG(SEQ ID NO:2) GNAQ-R2 ACTCTTCCCCTAATTCAATATTCTTTCC(SEQ ID NO:5) GNAQ-S2 ATTATTTAATTTGGATTAGAGGT(SEQ ID NO:6)

[0053] The results are as Figure 1 shown. The DNA methylation levels at the 1st, 3rd, 5th, and 8th sites of the "CG" motif on the DNA sequence shown in SEQ ID NO:1 are extremely significantly higher in estrus than in anestrus (P < 0.01), and the DNA methylation levels at the 2nd, 4th, 6th, and 7th sites are significantly higher in estrus than in anestrus (P < 0.05).

[0054] From the results of the above examples, it can be seen that the DNA methylation levels at the 8 sites are significantly correlated with the changes in photoperiod. By detecting the methylation levels at these 8 sites, it is possible to determine whether a sheep is in the estrous cycle or anestrus.

[0055] Example 2

[0056] Photoperiod can cause changes in the epigenetic regulation mode of the hypothalamus. Therefore, photoperiod can be used to regulate the seasonal estrus of sheep (He Xiaoyun, Study on the effect of photoperiod on the epigenetic regulation of the hypothalamus in sheep based on the OVX + E2 model, doctoral dissertation, 2020.). Therefore, in this example, a sheep model of estrous cycle and anestrous cycle is constructed using photoperiod.

[0057] Six Sunite ewes, aged 2 - 3 years old, healthy, of the same weight, and full or half siblings, were selected to form an experimental group. They were evenly divided into 2 groups (3 sheep in each group). All the sheep had the same feeding management and living environment, and had free access to food and water. According to the length of daylight hours in spring and autumn, the sheep shed used artificial light control to simulate the natural photoperiod change. The long photoperiod (LP) was set as 16 hours of light (6:30 - 22:30) and 8 hours of darkness (22:30 - 6:30) (simulating spring and summer when sheep are in the anestrus cycle); the short photoperiod (SP) was set as 8 hours of light (10:30 - 18:30) and 16 hours of darkness (18:30 - 10:30) (simulating autumn and winter when sheep are in the estrus cycle).

[0058] On the 42nd day of SP (SP42) and the 42nd day of LP (LP42) respectively, hypothalamus tissues of sheep were collected and genomic DNA was extracted by the phenol - chloroform method. According to the pyrosequencing method, DNA methylation analysis was performed on 8 "CG" sites (sequentially defined as the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, and 8th sites) of the DNA sequence shown in SEQ ID NO:1. The results are as Figure 2 shown. The DNA methylation levels at the 1st, 3rd, 5th, 6th, 7th, and 8th sites of the "CG" motif on the DNA sequence shown in SEQ ID NO:1 were extremely significantly higher at SP42 than at LP42 (P < 0.01), and the DNA methylation levels at the 2nd and 4th sites were significantly higher at SP42 than at LP42 (P < 0.05).

[0059] From the results of the above - mentioned examples, it can be seen that the DNA methylation levels at the 8 sites are significantly correlated with the photoperiod change. By detecting the methylation levels at these 8 sites, it is possible to determine whether the sheep is in the estrus cycle or the anestrus period.

[0060] The above - mentioned is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A DNA methylation site marker related to photoperiod-induced estrus in sheep, characterized in that, Eight CG motifs in the region of chr2: 58396975-58397144 on chromosome 2 of the sheep oar_v4.0 genome version.

2. The DNA methylation site marker according to claim 1, characterized in that, Eight CG motifs present on the DNA fragment shown in SEQ ID NO:1 or the complementary sequence of said DNA fragment.

3. Use of a reagent for detecting the DNA methylation site marker according to claim 1 or 2 in sheep breeding or screening for estrus sheep.

4. A primer for detecting the DNA methylation site marker according to claim 1 or 2, characterized in that, Comprising a first primer pair and a second primer pair; Said first primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:3; Said second primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO:2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

5.

5. The primer according to claim 4, characterized in that, Also comprising a first sequencing primer and a second sequencing primer; The nucleotide sequence of said first sequencing primer is as shown in SEQ ID NO:4; The nucleotide sequence of said second sequencing primer is as shown in SEQ ID NO:

6.

6. A kit for detecting the estrus condition of sheep, characterized in that, Comprising the primer according to claim 4 or 5.

7. The kit according to claim 6, wherein Also comprising 2×Pyro Mark PCR MasterMix, 5×Q-solution and 10×PCR CoraLoad Concentrate.

8. Use of the primer according to claim 4 or 5 or the kit according to claim 6 in detecting the estrus cycle or anestrus cycle of sheep.

9. A method for detecting the estrous cycle or anestrus cycle of sheep, characterized in that, Comprising the following steps: Extracting DNA from the sample to be tested; Obtaining the methylation level of the DNA methylation site marker according to claim 1 or 2 from the DNA of the sample to be tested; When compared with the methylation level of non-estrus sheep, if the methylation level of the sample to be tested is significantly increased, it indicates that the sample to be tested is in the estrus cycle, otherwise the sample to be tested is in the anestrus cycle.

10. The method according to claim 9, wherein The method for obtaining the methylation level of the DNA methylation site marker comprises amplifying using the primer according to claim 4 to obtain an amplification product, and performing pyrosequencing using the first sequencing primer and the second sequencing primer among the primers according to claim 5 to analyze the methylation levels of eight sites.

Images