Universal primer pair and kit for typical pathogenic bacteria group of shellfish and application of universal primer pair and kit

Through high-throughput sequencing technology, identifying the ASV00009 group of shellfish pathogenic bacteria and designing general primer pairs, the detection problems in the existing technology are solved, broad-spectrum detection and early warning of a variety of Vibrio, and improving the prevention and control efficiency of shellfish farming.

CN120249533AInactive Publication Date: 2025-07-04OCEAN UNIV OF CHINA
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510743050.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-05
Publication Date
2025-07-04
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The prior art is difficult to detect pathogenic bacteria species of Vibrio shellfish in a rapid and broad spectrum, resulting in low efficiency in precise prevention and control and early warning.

Method used

ASV00009 taxa, a typical pathogenic bacteria of shellfish, was identified through high-throughput sequencing technology, and a universal primer pair was designed to target the V4-V5 variable region of the 16S rRNA gene, for qPCR detection.

Benefits of technology

A broad-spectrum detection of a variety of potentially pathogenic Vibrio was achieved, early disease warning was provided, and the prevention and control efficiency of shellfish farming was improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249533A_ABST
    Figure CN120249533A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of microorganisms, and particularly relates to a universal primer pair of typical shellfish pathogenic bacterium groups, a kit and application. A typical shellfish pathogenic bacterium ASV00009 class group is identified for the first time through a high-throughput sequencing technology, a universal primer pair is provided aiming at a V4-V5 variable region sequence of a 16S rRNA gene shared by the class group, the sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, the limitation of'one strategy 'of a traditional shellfish pathogenic bacterium prevention and treatment means is broken through, and the method has the advantages of being high in specificity, high in specificity and high in specificity. And a solid theoretical basis is provided for establishing a broad-spectrum pathogenic bacterium detection technology based on the molecular marker.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microorganisms, and particularly relates to a universal primer pair, a kit and an application for a typical pathogenic bacterial group of shellfish. Background Art

[0002] As a core country in the global aquaculture industry, China's aquatic product output accounts for about 70% of the world's total output. Among them, the shellfish aquaculture industry occupies an important position in the fishery economy.

[0003] Epidemiological studies have shown that Vibrio Vibrio is the main pathogenic bacterium causing bacterial diseases in shellfish. Existing studies have successively reported multiple pathogenic Vibrio strains in shellfish. Although these studies have revealed the pathogenicity of various Vibrios to shellfish, due to the extremely complex diversity of Vibrio strains and the significant differences in the characteristics of different pathogenic strains, it faces huge challenges to quickly distinguish the core pathogenic bacteria in complex bacterial communities. This not only increases the difficulty of precise prevention and control but also severely restricts the efficiency of early warning. Existing technologies have also disclosed universal primers and kits for Vibrio detection, but the types of Vibrios detected are limited. For example, CN105400778B discloses a kit for simultaneously detecting 10 pathogenic Vibrios based on the fluorescence probe melting curve method for diarrhea prevention; CN102559889B discloses a multiplex virulence factor GeXP rapid detection kit for Vibrio parahaemolyticus, but it can only be used to detect Vibrio parahaemolyticus.

[0004] Therefore, there is still an urgent need for a more broad-spectrum Vibrio detection at present, which breaks through the limitations of traditional pathogen identification and prevention and control and realizes early warning and prevention and control. Summary of the Invention

[0005] In view of the above problems, in large-scale scallop disease and death events, the present invention systematically collected samples of dying scallops and healthy scallops, and for the first time identified a typical pathogenic bacterial group of shellfish, ASV00009 group, through high-throughput sequencing technology. The 16S rRNA sequences of this group are consistent with the sequences of important scallop pathogenic bacteria such as V. splendidus , V. cyclitrophicus etc. and are representative of the above pathogenic bacteria. The present invention provides a universal primer pair for the V4-V5 variable region sequence of the 16S rRNA gene shared by this group, which breaks through the limitation of "one strategy for one type" of traditional shellfish pathogenic bacteria prevention and control means and provides a solid theoretical basis for establishing a broad-spectrum pathogenic bacteria detection technology based on molecular markers.

[0006] The present invention provides a pair of universal primers for the typical pathogenic bacteria of shellfish, ASV00009 group. Among them, the sequence of the forward primer F is shown in SEQ ID NO. 1, and the sequence of the reverse primer R is shown in SEQ ID NO. 2. The primer pair can be used for qPCR primer detection.

[0007] SEQ ID NO. 1: GCGAGCGTTAATCGGAATTA.

[0008] SEQ ID NO. 2: CAGATGTCAGTGTCTGTCCA.

[0009] The present invention also provides the application of the above-mentioned universal primer pair for detecting the typical pathogenic bacteria of shellfish, ASV00009 group. The ASV00009 group has a 16S rRNA gene V4-V5 variable region sequence shown in SEQ ID NO. 3.

[0010] Furthermore, the ASV00009 group includes V. splendidus , V. cyclitrophicus , V. atlanticus and other important pathogenic species.

[0011] Furthermore, the bacterial strains of the ASV00009 group include the reported typical pathogenic bacteria V. atlanticus LGP32, and V. splendidus W13, V. splendidus W55, V. splendidus V3-1 and V. cyclitrophicus PY001 and other strains of the ASV00009 group.

[0012] The present invention also provides a detection kit for the typical pathogenic bacteria of shellfish, ASV00009 group, which contains the above-mentioned universal primer pair. The kit is used to extract DNA from scallop tissues for qPCR identification to provide early disease warning.

[0013] Furthermore, the ASV00009 group includes V. splendidus , V. cyclitrophicus , V. atlanticus and other important pathogenic species.

[0014] Furthermore, the bacterial strains of the ASV00009 group include the reported typical pathogenic bacteria V. atlanticusLGP32, and those isolated and purified by ourselves V. splendidus W13, V. splendidus W55, V. splendidus V3-1 and V. cyclitrophicus multiple strains of the ASV00009 group such as PY001.

[0015] Compared with the prior art, the beneficial effects of the present invention at least include: 1. The present invention integrates the genomic data of pathogenic bacteria in large-scale disease events of bivalves in major aquaculture areas at home and abroad, systematically analyzes the 16S rRNA gene sequence characteristics and genomic functional characteristics of multiple pathogenic bacteria, and innovatively discovers the typical pathogenic Vibrio ASV00009 group, which plays a key pathogenic role in large-scale death events of bivalve animals, and for the first time breaks through the limitation of the traditional "one pathogen, one strategy" pathogen identification mode.

[0016] 2. The universal primer pair provided by the present invention detects the V4-V5 variable region sequence of a 16S rRNA gene shared by the ASV00009 group, and can detect V. splendidus , V. cyclitrophicus , V. atlanticus and other various potential pathogenic Vibrios, and has important application value in the field of scallop health monitoring and disease prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is a diagram for analyzing the difference in the intestinal flora at the genus level between healthy and dying scallops.

[0018] Figure 2 It is a random forest analysis diagram of the intestinal flora at the ASV level between healthy and dying scallops.

[0019] Figure 3 It is a sequence alignment diagram of the 16S rRNA gene V4-V5 region between ASV00009 and bacterial isolates.

[0020] Figure 4 It is a comparison diagram of virulence factors and secretion systems between ASV00009 bacterial isolates and the model pathogenic bacterium LGP32.

[0021] Figure 5 It is a heat map of the difference in gene copy number between ASV00009 strains and non-ASV00009 strains.

[0022] Figure 6 It is a survival curve diagram of the pathogenic infection experiment of ASV00009 strains on bivalve mollusks. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] To make the objectives, technical solutions, and beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the present invention are only illustrative descriptions of the specific embodiments of the present invention, intended to explain the present invention, and do not constitute a limitation to the present invention. The endpoints and any values disclosed in this text are not limited to the exact ranges or values, and these ranges or values should be understood to include those close to these ranges.

[0024] Example 1: Amplicon sequencing analysis of scallop intestinal microbiota and identification of potential pathogenic ASV00009 taxa The research team collected samples of wild dying Zhikong scallops (wt_m), wild healthy Zhikong scallops (wt_h), and healthy Zhikong scallops of highly resistant varieties (plh_h) from scallop farming areas with large-scale mortalities of Zhikong scallops and carried out research through 16S rRNA gene amplicon sequencing analysis of the intestinal microbiota. The QIAamp PowerFecal Pro DNA Kit was used to extract total DNA of intestinal microorganisms. For the V4-V5 variable region of the 16S rRNA gene, specific primers with Barcode, 515F: (Barcode + GTGCCAGCMGCCGCGGTAA, SEQ ID NO. 4) and 907R: (Barcode + CCGTCAATTCCTTTGAGTTT, SEQ ID NO. 5), were used for PCR amplification. After the amplification products were separated by gel electrophoresis, a bacterial-specific band of about 400 bp was recovered through the MinElute QIAquick Gel Extraction Kit. Qualified samples were sequenced by PE 250 on the NovaSeq6000 platform.

[0025] The bioinformatics analysis process includes: (1) Using the fastp software to perform quality control on the raw data to remove low-quality reads; (2) Removing host genome contamination through bowtie2 alignment; (3) To avoid bias in analysis due to different sample data sizes, all host-removed files were randomly subsampled (data volume normalization) based on the sample with the least data volume to ensure that the data volume used for analysis of each sample was the same and a unified base number was obtained. Subsequently, the Qiime2 software was used for ASV clustering analysis; (4) Using the Parallel-META3 software for species annotation; (5) Using the vlookup and sumif functions in Excel to count the species abundances at each level for subsequent visualization analysis.

[0026] Based on the tidyverse, microeco, and magrittr packages in R language, the LEfSe differential analysis method was used to statistically analyze the composition of the sample bacterial genera. A total of 33 significantly different bacterial genera (LDA score > 3) were identified, as Figure 1 shown. In the wt_m group, genera such as Vibrio , Catenococcus , Photobacterium and Aliivibrio in the Vibrionaceae family showed highly enriched characteristics, among which the LDA score of Vibrio genus reached 5.4, indicating its significant enrichment advantage in the wt_m group. The above analysis results show that the Vibrionaceae family, especially Vibrio genus, may play a key role in the host's response to large-scale death events.

[0027] To further clarify the key ASV characteristics within Vibrio genus, a random forest analysis at the ASV level was performed using the randomForest package. Through a 10-fold cross-validation method, the prediction performance of the classification model was evaluated based on the mean decrease in accuracy (MDA) value, and the top 30 most important ASVs were selected. The results are as Figure 2 shown. Among them, there are 6 ASVs belonging to Vibrio genus. After analysis, it was found that ASV00009 had the highest explanatory power for sample variation, indicating its significant characteristic recognition value.

[0028] Example 2: Isolation, purification, and comparative genomic analysis of the potential pathogenic bacterium ASV00009 group Collect and isolate the fresh intestinal flora from scallops in the dying group. Use a sterile cotton swab to scrape the bacteria from the dissected intestine and resuspend them in liquid 2216E medium. Incubate the bacteria at 28 °C and 180 rpm overnight. Continuously dilute the bacteria by 10-fold serial dilution (10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 times dilution), and then evenly spread them on TCBS culture plates. Subsequently, incubate them statically in an incubator at 28 °C. Select the culture plate with appropriate colony density, use a sterilized toothpick to pick single colonies and streak them continuously on the TCBS plate, and purify the single colonies for 5 - 10 generations. Then use an equal volume of 50% glycerol to preserve the bacteria. After centrifuging the single colony bacterial solution, extract the strain DNA.

[0029] Subsequently, the 16S rRNA gene of each bacterial strain was subjected to Sanger sequencing using the universal primers 27F: (5′-AGAGTTTGATCMTGCCTCAG-3′, SEQ ID NO. 6) and 1492R (5′-TACGGYTACCTTGTTACGACTT-3′, SEQ ID NO. 7). Vibrio strains with 100% sequence identity of the 16S rRNA gene to the ASV00009 sequence were found, such as Figure 3 shown. The whole-genome sequencing of the strains was performed using the Illumina NovaSeq platform to predict the coding regions and protein sequences, and the protein sequences of each bacterium were annotated to databases such as KEGG to analyze its pathogenic-related genes.

[0030] The analysis results are as Figure 4 shown, indicating that the strains of the ASV00009 group mainly contain secretion systems related to pathogenesis, such as T2SS, T6SS, and Sec, and contain virulence factors such as hemolysin and RTX toxin, with significant potential pathogenic ability, but there are differences in virulence factors and secretion systems among the strains.

[0031] To deeply analyze the functional specificity of the ASV00009 group, we systematically collected the genomes of multiple reported bivalve pathogenic bacteria, including 10 strains belonging to the ASV00009 group Vibrio splendidus W13, V. splendidus W55, V. splendidus V3-1, V. atlanticus LGP32, V. cyclitrophicus PY001, V. splendidus A06, V. echinoideorum DSM_107264, V. syngnathi K08M4, V. splendidus ED144, and V. cyclitrophicus WXL032, and 13 strains not belonging to the ASV00009 group V. bivalvicida VPAP30, V. chagasii VPAP36, V. chagasii VPAP40, V. bivalvicida 605T, V. ulleungensis 188UL20-2, V. crassostreae J2-9, V. harveyi 94-17, V. tetraodonis A511, V. Hibernica B1.19, V. alginolyticus E110, V. nitrifigilis NFV-1, V.agarilyticus SM6, and V. aquimaris THAF100. Among them, V. atlanticus LGP32 has been used as a typical model strain for studying the interaction between pathogenic bacteria and bivalves.

[0032] As Figure 5 shown, through comparative genomics analysis, it was found that the ASV00009 group was significantly enriched with 107 characteristic genes (P<0.01). These genes can be systematically classified into three major functional modules: First, in terms of pathogenicity, this group has complete virulence regulatory protein genes ( lrp , rlpA etc.), diverse effector genes ( aceB / glcB , aqpZ etc.) and efficient secretion system genes ( tamA , lapC / lapE etc.); Second, in terms of environmental adaptation, it shows multiple antibiotic resistance genes ( catB , acpT etc.), optimized ion transport system genes (Zn, Mg, phosphate, etc.) and arginine metabolic pathway genes; In addition, the significant enrichment of its quorum sensing regulatory system (such as biofilm formation-related genes eptA , cdgK , quorum sensing-related genes luxN , cqsA etc.) further enhances its ecological adaptability. These molecular characteristics not only reveal the competitive advantages of the ASV00009 group in complex ecological environments, but also provide a new theoretical basis for explaining its unique and powerful pathogenic mechanism.

[0033] Example 3: Multi-species infection experiment of Vibrio ASV00009 group Collect healthy Chlamys farreri ( Chlamys farreri ), Argopecten irradians ( Argopecten irradians ), Patinopecten yessoensis ( Patinopecten yessoensis ) and Ruditapes philippinarum ( Ruditapes philippinarum ) from the farm for the infection experiment of ASV00009 strain. All bivalve animals were stably adapted for two days under laboratory conditions before the experiment.

[0034] Inoculate the ASV00009 group strains (PY001, V3-1, W13 and W55) into 2216E medium and shake culture at 28°C and 180 rpm until the logarithmic growth phase (OD 600= 0.8). The bacterial suspension was counted using the plate counting method. Subsequently, the bacteria were collected by centrifugation at 2,000 g for 10 minutes, washed twice with sterile seawater, and finally resuspended in sterile seawater.

[0035] Each type of bivalve was randomly divided into two groups (control group and infection group), with three replicates in each group. All animals were cultured in sterilized acrylic tanks of the same specification, filled with filtered seawater and continuously aerated. Thirty individuals of healthy Chlamys farreri, Argopecten irradians, Patinopecten yessoensis, and Ruditapes philippinarum were infected in each tank, and the final concentration of each bacterium for soaking was 10 8 CFU / mL. The control group was soaked in sterile seawater. The mortality was recorded daily until the mortality rate was stable and no more deaths were observed. The survival curves were statistically analyzed using GraphPad Prism software to evaluate the significance of differences between groups. The results are as Figure 6 shown.

[0036] Figure 6 shown that all tested ASV00009 strains caused the death of bivalves. None of the bivalves injected with filtered seawater in the control group died except for Ruditapes philippinarum ( Figure 6 in d). Specifically, all individuals of Chlamys farreri inoculated with the ASV00009 strain died within 6 days ( Figure 6 in a). For Argopecten irradians, the virulence of strains V3-1, W13, and W55 was similar, and the mortality rate reached 100% on the 8th day after inoculation ( Figure 6 in b). For Patinopecten yessoensis, the survival rates on the 11th day after inoculation with the four strains were 66.67%, 40.00%, 33.33%, and 26.67% respectively ( Figure 6 in c). Through the Gehan-Breslow-Wilcoxon test, the differences in survival rates between all infected groups and the control group were statistically significant (P value < 0.05). Combining the results of this study with previous literature reports, we draw a clear conclusion: Vibrio Strains in the ASV00009 group play a key pathogenic role in large-scale bivalve mortality events.

[0037] Example 4: Design qPCR primers to detect ASV00009 and provide early warning for scallop diseases Through the above analysis method, a typical shellfish pathogenic bacterium group ASV00009 was discovered and identified. The typical characteristic of this group is that they share the same V4-V5 variable region sequence of the 16S rRNA gene, and the sequence is shown in SEQ ID NO. 3.

[0038] TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTCATTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAACTGCATTTGAAACTGGTGAACTAGAGTGCTGTAGAGGGGGGTAGAATTTCAGGTGTAGCGGTGAAATGCGTAGAGATCTGAAGGAATACCAGTGGCGAAGGCGGCCCCCTGGACAGACACTGACACTCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTGTGGCCTTGAGCCGTGGCTTTCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGTCGCAAGATTA (SEQ ID NO. 3).

[0039] Based on the V4-V5 variable region sequences shared by the ASV00009 taxon, the universal primers designed are as follows: Forward primer F: 5'-GCGAGCGTTAATCGGAATTA-3' (SEQ ID NO. 1), located at positions 13 - 32; Reverse primer R: 5'-CAGATGTCAGTGTCTGTCCA-3' (SEQ ID NO. 2), located at positions 155 - 174.

[0040] Thus, DNA can be extracted from scallop tissues for qPCR identification to provide early disease warnings for all pathogenic bacteria of the ASV00009 taxon. For adult scallops, a small amount of gill filaments can be taken minimally invasively to extract DNA. For seedlings, a small number of seedlings can be fished from the pond to extract DNA for amplification and sequencing.

[0041] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and do not constitute a limitation to the content of the present invention. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A universal primer pair for typical pathogenic bacteria groups of shellfish, characterized in that, In the universal primer pair, the sequence of the forward primer is shown as SEQ ID NO. 1, and the sequence of the reverse primer is shown as SEQ ID NO.

2.

2. Use of the universal primer pair according to claim 1, characterized in that, For detecting the typical pathogenic bacteria ASV00009 group of shellfish, the ASV00009 group has a 16S rRNA gene V4-V5 variable region sequence shown as SEQ ID NO.

3.

3. The application according to claim 2, characterized in that The bacterial species of the ASV00009 group include V. splendidus , V. cyclitrophicus and V. atlanticus .

4. The application according to claim 3, wherein The bacterial strains of the ASV00009 group include V. atlanticus LGP32, V. splendidus W13, V. splendidus W55, V. splendidus V3-1 and V. cyclitrophicus PY001.

5. A detection kit for typical pathogenic bacteria groups of shellfish, characterized in that, Comprising the universal primer pair described in claim 1, for detecting the typical pathogenic bacteria ASV00009 group of shellfish.

6. The detection kit according to claim 5, characterized in that, The bacterial species of the ASV00009 group include V. splendidus , V. cyclitrophicus and V. atlanticus .

7. The detection kit according to claim 5, wherein The bacterial strains of the ASV00009 group include V. atlanticus LGP32, V. splendidus W13, V. splendidus W55, V. splendidus V3-1 and V. cyclitrophicus PY001.

Citation Information

Patent Citations

  • Rapid detection kit and detection method for v.parahaemolyticus multiple virulence factor GeXP

    CN102559889B

  • Kit and detection method for simultaneous detection of 10 pathogenic Vibrio species

    CN105400778B

  • Quick detection method for scallop pathogenic vibrio splendidus

    CN103468806A

  • Method for analyzing pathogenic bacteria in intestinal flora and quantifying regional characteristics of flora

    CN115331737A

  • Molecular biological quantitative detecting method for pathogenicity paratypic hemolytic vibrio in aquatic products

    CN1831139A