Primer combination for detecting monkey pox viruses and identifying monkey pox viruses Ia, Ib and II and application
Through the combination of multiple fluorescence PCR technology and specific primer probes, the problem of type detection of monkeypox virus Ia, type Ib, and type II was solved, and high sensitivity and strong specificity was achieved, supporting the precise type and prevention of monkeypox virus.
Patent Information
- Application Number
- CN202510385897.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-30
- Publication Date
- 2025-07-04
AI Technical Summary
The existing detection methods cannot accurately type test monkeypox virus type Ia, type Ib and type II, especially the detection of monkeypox virus sub-branches is insufficient, and cannot meet the needs of fast, high specificity, high sensitivity, simple and easy to use and low cost.
A multi-fluorescent PCR method was designed, using a specific primer probe composition to target the specific regions of monkeypox virus F3L region and different evolutionary branches, and the detection and typing of monkeypox virus is achieved through multiple fluorescence PCR technology. The primer combination includes specific primer probes of monkeypox virus universal, Clade Ia, Clade Ib and Clade II, and is distinguished by different fluorescence groups.
The high sensitivity detection of monkeypox virus (minimum detection limit of 200 copies/mL) is achieved, and it is highly specific, which can accurately distinguish different evolutionary branches, provide accurate typing results, and support differentiated prevention and control and treatment strategies of the disease.
Smart Images

Figure CN120249558A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular diagnostics, and specifically relates to a composition and application for detecting monkeypox virus and differentiating types Ia, Ib, and II, which can be applied to the rapid screening of monkey virus subtypes and epidemiological research. Technical Background
[0002] Monkeypox, also known as monkey smallpox, is a viral zoonosis caused by monkeypox virus (MPXV). The incubation period is 6 to 16 days, and it is transmitted from person to person through blood and body fluids. The main symptoms include fever, muscle soreness, rash, and lymphadenopathy. It was first discovered in green monkeys in 1958 and was first isolated from the specimen of a suspected smallpox patient in the Democratic Republic of the Congo in 1970, which is also the first confirmed human monkeypox case.
[0003] Currently, the known monkeypox viruses are divided into the Congo Basin clade (Clade Ⅰ) and the West African clade (Clade Ⅱ), and the West African clade (Clade Ⅱ) is further subdivided into two sub-clades, Ⅱa and Ⅱb. In September 2023, a new monkeypox strain was discovered in the monkeypox epidemic in South Kivu Province, Democratic Republic of the Congo, and it was named Clade Ⅰb. Subsequently, the original Congo Basin clade (Clade Ⅰ) was renamed Clade Ⅰa. Since the discovery of the monkeypox virus Clade Ⅰb sub-clade, 12 countries outside Africa, including Sweden, Thailand, India, the United Kingdom, Germany, the United States, Canada, Belgium, France, Pakistan, Oman, and China, have reported imported cases of monkeypox virus Clade Ⅰb sub-clade infection. It is worth noting that in the past, the prevention of monkeypox virus mainly emphasized direct contact or sexual contact transmission. However, the mutated strain of the monkeypox virus Clade Ⅰb sub-clade can not only be transmitted through animals, but also through human secretions (such as respiratory droplets), rashes, or contaminated items, etc., which is more threatening. Data shows that the mortality rate of patients infected with the monkeypox virus Clade Ⅰb sub-clade is 3 - 5%, significantly higher than the case fatality rate (<1%) of the 2022 monkeypox epidemic (Clade IIb), and women and children under 15 years old are the main populations infected. Children account for more than 70% of the case numbers and 85% of the death numbers, and the lethality rate of children is four times that of adults. Thus, it can be seen that there are obvious differences in the lethality of different branches of the monkeypox virus. Since the epidemiological and clinical characteristics of the diseases caused by the two evolutionary branch viruses of the West African clade and the Congo clade are different, it is very necessary to accurately type and detect the West African lineage and the Congo clade for disease prevention and control.
[0004] At present, the detection methods of MPXV include serological detection, virus isolation and culture, and molecular biology detection techniques, etc. Currently, the typing detection products or technologies for monkeypox virus at home and abroad mainly focus on distinguishing the Congo Basin clade (Clade Ⅰa) and the West African clade (Clade Ⅱ), and a few studies have carried out accurate typing of Clade Ⅱa and Clade Ⅱb. It is reported that there are no obvious differences in the infection routes and pathogenic characteristics between Clade Ⅱa and Clade Ⅱb, and the significance of accurate typing is not great. There have been patent reports on using multiplex qPCR methods to achieve the detection and typing of monkeypox virus nucleic acid in one tube, but the designed regions of its specific primer probes lack good discrimination ability for other viruses in the genus Orthopoxvirus, and there is a certain risk of false positives. To sum up, the existing detection methods cannot accurately type the monkeypox virus Clade Ⅰb sub-branch, and there is an urgent need to provide a rapid, highly specific, highly sensitive, easy-to-use and low-cost detection method for detecting monkeypox virus and differentiating monkeypox virus types Ⅰa, Ⅰb, and Ⅱ, which is of great significance for epidemic prevention and control. Summary of the Invention
[0005] In order to solve the technical problem that the existing detection methods cannot accurately type monkeypox virus types Ⅰa, Ⅰb, and Ⅱ, the present invention provides a primer combination for detecting monkeypox virus and differentiating monkeypox virus types Ⅰa, Ⅰb, and Ⅱ, and the composition includes:
[0006] The nucleotide sequences of the universal primers for monkeypox virus targeting the F3L region of monkeypox virus are shown as SEQ ID NO:1 - SEQ ID NO:2, and the nucleotide sequence of the probe is shown as SEQ ID NO:3;
[0007] The nucleotide sequences of the specific primers for monkeypox virus Clade Ia type are shown as SEQ ID NO:4 - SEQ ID NO:5, and the nucleotide sequence of the probe is shown as SEQ ID NO:6;
[0008] The nucleotide sequences of the specific primers for monkeypox virus Clade Ib type are shown as SEQ ID NO:7 - SEQ ID NO:8, and the nucleotide sequence of the probe is shown as SEQ ID NO:9;
[0009] The nucleotide sequences of the specific primers for monkeypox virus Clade II type are shown as SEQ ID NO:10 - SEQ ID NO:11, and the nucleotide sequence of the probe is shown as SEQ ID NO:12;
[0010] The primer combination of the present invention also includes the upstream primer, downstream primer, and probe of the internal reference gene ribonuclease P (RNase-P), and the nucleotide sequences are shown as SEQ ID NO:13 - SEQ ID NO:15.
[0011] The present invention utilizes a multiplex qPCR method to simultaneously detect monkeypox virus and distinguish between monkeypox virus genotypes Ia, Ib, and II by detecting different targets, providing targeted strategies for subsequent treatment and disease prevention. The primer combination of the present invention has high sensitivity, reaching 200 copies / mL, good specificity, and more accurate detection.
[0012] The fluorescent groups of the composition probes in the present invention are different from each other and do not interfere with each other.
[0013] In this context, "different from each other and do not interfere with each other" means that the fluorescent groups used for each probe in the composition are different and do not affect the detection of each other, that is, they can be detected using different channels. For example, FAM, HEX, ROX, and CY5 can be used. These groups have absorbance values that are not close, allowing different channels to be selected, and thus they do not interfere with each other.
[0014] In the present invention, the fluorescent reporter group of the monkeypox virus genotype Ia detection probe is FAM; the fluorescent reporter group of the monkeypox virus genotype Ib detection probe is HEX; the fluorescent reporter group of the monkeypox virus genotype II detection probe is ROX, and the fluorescent reporter group of the internal standard RNase-P detection probe is CY5; the 3' end of the probe also has a quenching group, such as BHQ1 or BHQ2, BHQ3.
[0015] Another object of the present invention is to apply the above primer combination in the preparation of a detection reagent or kit for simultaneously detecting monkeypox virus and monkeypox virus genotyping. The detection reagent or kit also includes other conventional reagents for multiplex fluorescence PCR, such as PCR reaction buffer, RT-PCR enzyme mixture, negative control, and positive control.
[0016] The negative control is at least one of DEPC H2O and physiological saline; the positive control is at least one of monkeypox virus, nucleic acid fragments of genotypes Ia, Ib, II, and RNase-P, pseudovirus, etc.
[0017] The method of using the above multiplex fluorescence quantitative PCR detection reagent is as follows:
[0018] (1) Extract or release the nucleic acid of the sample to be tested;
[0019] (2) Perform fluorescence quantitative PCR on the nucleic acid obtained in step (1) using the above primer composition;
[0020] (3) Obtain and analyze the results.
[0021] In the present invention, the sample for detection can be serum, vesicle fluid, oropharyngeal or nasopharyngeal secretions, etc., but is not limited thereto.
[0022] The reaction conditions for the fluorescence quantitative PCR are:
[0023] Pre-denaturation, at a temperature of 95°C for 30 s - 1 min, 1 cycle; denaturation, at a temperature of 95°C for 5 - 20 s, annealing, at a temperature of 55°C - 60°C for 10 - 60 s, 30 - 50 cycles, and fluorescence was collected.
[0024] Advantages and technical effects of the present invention:
[0025] (1) Based on multiplex fluorescence PCR technology, the present invention has developed a primer combination for detecting monkeypox virus and typing, and this composition has the advantages of being convenient and fast, and can simultaneously achieve the qualitative detection of monkeypox virus and the type differentiation of monkeypox virus type Ia, type Ib, and type II;
[0026] (2) The method of the present invention has the advantages of high sensitivity, strong specificity, and high accuracy, and the lowest detection limit can reach 200 copies / mL; in addition, a positive control is set to participate in the whole process quality control of nucleic acid extraction, PCR amplification, etc., to avoid the generation of false positive or false negative results and improve the detection accuracy;
[0027] (3) The precise typing technology of monkeypox virus type Ia, type Ib, and type II of the present invention realizes the rapid identification of the pathogenic risk and transmission chain of imported strains, providing key support for cross-border transmission blocking and differential prevention and control. Description of the Drawings
[0028] Figure 1 It is a schematic diagram of specific genomic regions of different evolutionary branches of monkeypox virus;
[0029] Figure 2 It is a diagram of the design region of universal primers and probes for monkeypox virus;
[0030] Figure 3 It is a diagram of the design region of type Ia-specific primers and probes for monkeypox virus;
[0031] Figure 4 It is a diagram of the design region of type Ib-specific primers and probes for monkeypox virus;
[0032] Figure 5 It is a diagram of the design region of type II-specific primers and probes for monkeypox virus;
[0033] Figure 6 Amplification curve of the universal positive control product for detecting monkeypox virus
[0034] Figure 7 It is the amplification curves for detecting positive control products of monkeypox virus type Ia, type Ib, and type II;
[0035] Figure 8 It is the sensitivity detection result of the universal positive control product for monkeypox virus;
[0036] Figure 9 The sensitivity test results of the positive control product for monkeypox virus type Ia;
[0037] Figure 10 The sensitivity test results of the positive control product for monkeypox virus type Ib;
[0038] Figure 11 The sensitivity test results of the positive control product for monkeypox virus type II. Specific implementation mode
[0039] The technical solution of the present invention will be further described in detail below through examples. However, the content of the present invention is not limited thereto. In the examples, the methods are conventional methods unless otherwise specified, and the materials, reagents, etc. are obtained from commercial channels or prepared according to conventional methods unless otherwise specified;
[0040] Example 1: Design of primers and probes and synthesis of positive control
[0041] 1. Design of specific primers and probes for monkeypox virus type Ia, type Ib, and type II
[0042] Download the genomic sequences of various evolutionary branches of monkeypox virus (including type Ia, type Ib, type IIa, type IIb), variola virus, vaccinia virus, and cowpox virus from NCBI, and then use the MAFFT v7.037b program for sequence alignment. After detailed analysis of the genomic sequence information, and draw a schematic diagram of the genomic regions of various evolutionary branches of monkeypox virus as shown in Figure 1 . It can be seen from the figure that the specific region of Clade Ia is 18952nt - 20904nt (NC_003310.1); there is a 19097nt - 20238nt deletion region in Clade Ib (NC_003310.1), and a specific probe is designed across the deletion region; the specific region of Clade II is 158782nt - 161027nt (DQ011156.1); the specific region of Clade IIa is 7047nt - 9357nt (DQ011156.1). We designed universal and typing primers and probes for monkeypox virus for the specific regions, and the regions for primer and probe sequence design are as shown in Figures 2 - 5 . The primer and probe sequences are shown in the following table:
[0043] Name Sequence (5’-3’) DL-MPXV-F CGCGGGATACATCATCTATTAT DL-MPXV-R CCGACGATACTCCTCCTCGTTG DL-MPXV-P FAM-TCAGCATCAGAATCTGTAGGCCGTG-BHQ1 DL-MPXV-Ⅰa-F GTTATCCTGGACATCGTACAA DL-MPXV-Ⅰa-R GTCACTGCCATTGTTTTTGAGC DL-MPXV-Ⅰa-P FAM-CATATATATGTTCGCTATTGTAG-BHQ1 DL-MPXV-Ⅰb-F GATATAGGATGTGGACATT DL-MPXV-Ⅰb-R GGAAAAGACTTCCAAACTTAATC DL-MPXV-Ⅰb-P HEX-CTAGATATTCAGGCGCATATCCA-BHQ1 DL-MPXV-Ⅱ-F GTGTAGTTTCGCAGTGACCGTCC DL-MPXV-Ⅱ-R GCTCTGGTATATCATATATCCAAG DL-MPXV-Ⅱ-P ROX-TGGGTGGATATGATCAGTCCCTGTATA-BHQ2 DL-RNase-P-F AGATTTGGACCTGCGAGC DL-RNase-P-R CAACTGAATAGCCAAGGTGAGC DL-RNase-P-P CY5-ACCTGAAGGCTCTGCGCGGAC-BHQ3 .
[0044] 2. Synthesis of positive control
[0045] In this embodiment, the specific segment nucleic acid sequences of monkeypox virus common type, type Ia, type Ib, type II, and RNase-P are obtained by chemical synthesis and cloned into the pUC57 vector. The vector synthesis is completed by Anhui General Biotech Co., Ltd. The nucleotide sequence of the monkeypox virus common type positive plasmid is shown in SEQ ID NO:16, the nucleotide sequence of the monkeypox virus type Ia positive plasmid is shown in SEQ ID NO:17, the nucleotide sequence of the monkeypox virus type Ib positive plasmid is shown in SEQ ID NO:18, the nucleotide sequence of the monkeypox virus type II positive plasmid is shown in SEQ ID NO:19; the nucleotide sequence of the ribonuclease P positive plasmid is shown in SEQ ID NO:20.
[0046] Extract plasmid DNA and determine the concentration by ultraviolet spectrophotometer. Calculate the copy number of DNA according to the detected target sequence and concentration. The calculation formula is as follows:
[0047]
[0048] Example 2: Preparation and method of a kit for detecting monkeypox virus and its typing
[0049] Prepare a kit for detecting monkeypox virus and its typing with the primer combination designed in Example 1. The kit includes a primer combination, a PCR reaction buffer, a negative control product, and a positive control product. Taking 48 tests / box as an example, the components of the kit are shown in the following table;
[0050]
[0051] The usage method of the kit for detecting monkeypox virus and its typing is as follows:
[0052] (1) Nucleic acid extraction
[0053] Take 200 μL of serum, vesicle fluid, oropharyngeal or nasopharyngeal secretions, etc., and use a viral DNA / RNA nucleic acid extraction kit to obtain viral DNA;
[0054] (2) Preparation of the detection reaction system
[0055] The kit of the present invention completes the detection and typing of monkeypox virus with 2 reaction tubes. Reaction tube A: Detection of monkeypox virus; Reaction tube B: Typing detection of monkeypox virus type Ia, type Ib, and type II.
[0056] The reaction system is prepared as follows:
[0057]
[0058]
[0059] (3) Load the sample onto the Shanghai Hongshi SLAN96-P fluorescence quantitative PCR instrument and set the qPCR reaction program as follows:
[0060]
[0061] (4) Result analysis and determination
[0062]
[0063] Note: The CY5 channels of Reaction Tube A and Reaction Tube B are both internal reference channels. The internal reference detection results need to meet the following conditions: (1) For any reaction tube, if all the detection targets of monkeypox virus are negative, the internal reference (CY5) channel must satisfy CT value ≤ 38; (2) If the detection result of any one or more pathogens in the reaction tube is positive, the CT value of the internal reference (CY5) channel is not limited; (3) If any one reaction tube does not meet the above two conditions, it is judged that the internal reference detection is unqualified, and this sample needs to be retested.
[0064] Example 3: Detection results of the primer combination test samples of the present invention
[0065] Using the primers and probes shown in Example 1, verify the plasmid samples of the general type, type Ia, type Ib, and type II genes of monkeypox virus (the positive plasmid in Step 2 of Example 1) according to the method of Example 2. The results show that a significant amplification curve can be detected in the FAM channel of Reaction Tube A, indicating that the composition of the present invention can accurately identify and diagnose monkeypox virus, as shown in Figure 6 shown.
[0066] At the same time, significant amplification curves pass through FAM, HEX, and ROX in Reaction Tube B, indicating that the typing primer combination of the present invention can also accurately type the virus of monkeypox virus type Ia, type Ib, and type II. The typing results are as shown in Figure 7 shown.
[0067] Example 4: Specificity and anti-interference test of the primer combination of the present invention
[0068] (1) Pathogen cross-reaction test
[0069] In this example, 10 pathogen samples with homologous nucleic acid sequences and likely to cause the same or similar clinical symptoms were selected as cross-reaction evaluation samples. The cross-reaction test was carried out using the detection method described in Example 2 to evaluate the specificity of the composition of the present invention; the detection results are shown in the following table:
[0070]
[0071] (2) Anti-interference test of the primer combination of the present invention
[0072] To investigate the influence of existing endogenous / exogenous interfering substances on the performance of the detection results, the additives were diluted to the tested concentration with a viral preservation solution (product number: VTM-a-01, Xi'an Tianlong), and mixed with 500 copies / mL of the universal type and type Ia positive plasmids of monkeypox virus; nucleic acid DNA was extracted, and the detection method in Example 2 was adopted to test common interfering substances. The experimental results showed that potential PCR inhibitors / interfering substances such as dexamethasone (50 μg / mL), cefmenoxime hydrochloride (50 μg / mL), zanamivir (100 μg / mL), ribavirin (100 μg / mL), clindamycin (50 μg / mL), tobramycin (50 μg / mL), heme (10 μg / mL), and hemoglobin (10%) had no obvious influence on this kit. The amplification results of the PCR reaction solution in the presence of infectious substances are shown in the following table;
[0073] Tube A (Monkeypox universal) Tube B (Type Ⅰa) Control 30.15 31.50 Dexamethasone 31.27 32.15 Cefmenoxime hydrochloride 30.55 30.94 Zanamivir 31.92 30.36 Ribavirin 30.03 31.29 Clindamycin 30.64 31.65 Tobramycin 31.32 30.86 Heme 31.1 31.61 Hemoglobin 30.75 32.41 。
[0074] Example 5: Sensitivity test of the primer combination of the present invention
[0075] In this example, pharyngeal swab samples of normal people were collected with a viral preservation solution (product number: VTM-a-01, Xi'an Tianlong), and mixed with 1×10 7 copies / mL of monkeypox virus positive control (including a mixture of universal type / type Ia / type Ib / type II positive plasmids of monkeypox virus), and it was serially diluted to 1×10 7 、1×10 6 、1×10 5 、1×10 4 、1×10 3 、500 and 200 copies / mL of templates, so as to simulate clinical samples and conduct a sensitivity detection test. The experimental results are as Figures 8 - 11 shown. The primer composition of the present invention has good amplification efficiency for the universal type, type Ia, type Ib and type II of monkeypox virus. When the input template amount is 200 copies / mL, it can be detected 100%. Therefore, the detection sensitivity of the composition of the present invention is set at 200 copies / mL.
[0076] In summary, based on the multiplex fluorescence quantitative PCR technology, the present invention designs specific primer-probes for the monkeypox virus and its different evolutionary branches. By targeting the specific region of the F3L gene of the monkeypox virus, the monkeypox virus can be distinguished from other viruses in the genus Orthopoxvirus, enabling rapid diagnosis of the monkeypox virus. Secondly, primer-probes are designed for the specific regions of type Ia, type Ib, and type II. On the basis of confirming the positivity of the monkeypox virus, gene typing is carried out. This has great value in the clinical accurate and rapid diagnosis, treatment, and prognosis of patients with the monkeypox virus, greatly improving the detection efficiency of the monkeypox virus and is a diagnostic technology with good prospects.
Claims
1. A primer combination for detecting monkeypox virus and differentiating monkeypox virus types Ia, Ib, and II, characterized in that: Comprising specific primers and probes for monkeypox virus, the nucleotide sequences of which are shown in SEQ ID NO:1 - SEQ ID NO:3; Specific primers and probes for monkeypox virus Clade Ⅰa type, the nucleotide sequences of which are shown in SEQ ID NO:4 - SEQ ID NO:6; Specific primers and probes for monkeypox virus Clade Ⅰb type, the nucleotide sequences of which are shown in SEQ ID NO:7 - SEQ ID NO:9; Specific primers and probes for monkeypox virus Clade Ⅱ type, the nucleotide sequences of which are shown in SEQ ID NO:10 - SEQ ID NO:
12.
2. The primer combination for detecting monkeypox virus and differentiating monkeypox virus types Ia, Ib, and II according to claim 1, characterized in that: Also comprising specific primers and probes for the internal reference gene ribonuclease P, the nucleotide sequences of which are shown in SEQ ID NO:13 - SEQ ID NO:
15.
3. Use of the primer combination for detecting monkeypox virus and differentiating monkeypox virus types Ⅰa, Ⅰb, and Ⅱ according to claim 2 in the preparation of a detection reagent for simultaneously detecting monkeypox virus and monkeypox virus typing.
4. Use of the primer combination for detecting monkeypox virus and differentiating monkeypox virus types Ⅰa, Ⅰb, and Ⅱ according to claim 2 in the preparation of a detection kit for simultaneously detecting monkeypox virus and monkeypox virus typing.
Citation Information
Cited By
Typing kit for on-site detection of monkey pox virus as well as application and product thereof
CN120536642A
A monkeypox virus typing kit for on-site detection, application and product thereof
CN120536642B
Primer probe combination for detecting monkey pox virus and branches thereof and application of primer probe combination
CN121183045A
Primer probe group and kit for specific detection of highly pathogenic monkey pox virus subtype
CN121472480A