Improved cancer immunotherapy

Through the combination of UAP1 inhibitor and immunotherapy, T cell activation and tumor cell killing are enhanced, the drug resistance mechanism problem in immunotherapy is solved and the effectiveness of cancer treatment is improved.

CN120265282APending Publication Date: 2025-07-04F HOFFMANN LA ROCHE & CO AG
View PDF 12 Cites 0 Cited by

Patent Information

Application Number
CN202380080804.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-11-29
Filing Date
2023-11-27
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

Existing immunotherapies have drug resistance mechanisms when treating cancer, resulting in no response or tumor recurrence in some patients. More effective cancer immunotherapies need to be developed to improve response rates and overcome drug resistance mechanisms.

Method used

T cell activation and tumor cell killing are enhanced by the administration of UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitors and immunotherapy by administering UAP1 inhibitors and immunotherapy such as adoptive cell transfer, monoclonal antibodies, cytokines, cancer vaccines or T cell conjugation therapy.

Benefits of technology

It enhances T cell activation and tumor cell killing, improves the effect of immunotherapy, and works synergistically in cancer treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005414103660000041
    Figure BDA0005414103660000041
  • Figure BDA0005414103660000491
    Figure BDA0005414103660000491
  • Figure BDA0005414103660000501
    Figure BDA0005414103660000501
Patent Text Reader

Abstract

The present invention relates to: a combination therapy with T cell activation and a UAP1 inhibitor; and the use of these combination therapies for the treatment of cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to: combination therapies employing T cell activation and UAP1 inhibitors; and the use of such combination therapies for treating cancer. Background Art

[0002] Harnessing a patient's own immune system to fight cancer is a clinically proven and promising approach to combat malignancies. Immunotherapies, such as immune checkpoint inhibitors, have been routinely used clinically for a decade and have brought great benefits to patients. However, many patients either do not respond or experience tumor recurrence after immunotherapy. This lack of efficacy is attributed to the emergence of innate or acquired resistance mechanisms, which pose an obstacle to current immunotherapy.

[0003] Therefore, there is a need to develop more effective cancer immunotherapeutic agents to improve the response rate of patients or overcome resistance mechanisms.

[0004] UAP1 is an enzyme involved in the hexosamine biosynthetic pathway (HBP). HBP integrates glucose and glutamine metabolism to produce UDP-GlucNAc and UDP-GalNAc, also known as UDP-HexNAc. These sugar nucleotides are used in a variety of biological processes, such as N- and O-linked protein glycosylation, glycosaminoglycan (GAG) and glycosphingolipid (GSL) biosynthesis. Due to the increased glucose uptake by tumor cells (Warburg effect), the HBP in malignant cells is generally more active compared to healthy cells (Akella et al. BMC Biol. 2019 Jul 4; 17(1):52). In addition, amplification and / or overexpression of different enzymes involved in this pathway have been observed in cancer (Akella et al. BMC Biol. 2019 Jul 4; 17(1):52). To date, the role of HBP in generally regulating the immune system and more specifically T cell function has not been widely explored. Detailed Description

[0005] The inventors have found that UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitors can be used to improve the efficacy of immunotherapy, particularly where the immunotherapy includes adoptive cell transfer, administration of monoclonal antibodies, administration of cytokines, administration of cancer vaccines, T cell engager therapies, administration of PD-1 axis-binding antagonists, or any combination thereof.

[0006] To unbiasedly identify new potential immunotherapy targets, a CRISPR / Cas9 knockout screen was performed in tumor cells using naïve T cells and the CEA-CD3 T cell bispecific antibody (CEA-TCB) Cibisatamab. The screen revealed genes with immunomodulatory functions. UAP1 was one of the top hits in the screen, and its role in regulating anti-cancer immune responses has been extensively evaluated and validated.

[0007] Using an in vitro model of cancer cell killing by human peripheral blood mononuclear cells, the inventors evaluated the effect of reduced UAP1 activity on treatment with three exemplary T cell bispecific (TCB) antibodies (CEA-TCB, Tyrp1-TCB, and EpCAM-TCB) (as examples of tumor surface-targeting TCBs) and target cells pulsed with a peptide (SIINFEKL) (as an example of TCR-mediated therapy for T cell activation and target cell killing). The results were confirmed in an in vivo cancer model, in which the combination of UAP1 gene knockout and CEA TCB led to complete tumor regression compared to the incomplete tumor growth control in mice treated with CEA-TCB alone.

[0008] Data in the examples of the present invention indicate that inhibition of UAP1 can act synergistically with immunotherapy to enhance T cell activation and tumor cell killing, which can be used as a combination for treating or preventing cancer.

[0009] Thus, in a first aspect, the present invention provides a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor for use in treating or preventing cancer in an individual, wherein the treatment comprises

[0010] (a) administering a UAP1 inhibitor to the individual, and

[0011] (b) administering an immunotherapy to the individual.

[0012] In another aspect, the present invention provides a method for treating or preventing cancer in an individual, wherein the method comprises

[0013] (a) administering a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor to the individual, and

[0014] (b) administering an immunotherapy to the individual.

[0015] In another aspect, the present invention provides the use of a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor in the manufacture of a medicament for treating cancer in an individual, wherein the treatment comprises

[0016] (a) Administering a UAP1 inhibitor to the individual, and

[0017] (b) Administering an immunotherapy to the individual.

[0018] In another aspect, the present invention provides an immunotherapy for use in treating a disease in an individual, wherein the treatment comprises

[0019] (a) Administering the immunotherapy to the individual, and

[0020] (b) Administering a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor to the individual.

[0021] Unless otherwise defined herein, the terms used herein are generally as used in the art.

[0022] In some aspects, the immunotherapy comprises adoptive cell transfer, administration of monoclonal antibodies, administration of cytokines, administration of cancer vaccines, T cell engager therapies, administration of PD-1 axis-binding antagonists, or any combination thereof.

[0023] As used herein, the term "UAP1 inhibitor" refers to a compound that targets, reduces, or inhibits UAP1 activity, and includes but is not limited to small molecule inhibitors. As used herein, the term UAP1 inhibitor also includes UAP1 degraders and modulators of UAP1 expression that result in a decrease in UAP1 activity (e.g., compared to UAP1 activity in the absence of administration of a UAP1 inhibitor).

[0024] There is further provided a UAP1 inhibitor for use in the methods described herein, wherein the UAP1 inhibitor has a molecular weight of from 200 to 900 daltons. There is further provided a UAP1 inhibitor for use in the methods described herein, wherein the UAP1 inhibitor has an IC50 value of less than 5 μM, 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, 2 nM, or less than 1 nM. There is further provided a UAP1 inhibitor for use in the methods described herein, wherein the UAP1 inhibitor comprises at least one heterocycle. There is further provided a UAP1 inhibitor for use in the methods described herein, wherein the heterocycle comprises at least two heteroatoms. In some aspects, inhibition of UAP1 (e.g., by administration of a UAP1 inhibitor) results in an increase in the activity of the immunotherapy.

[0025] An exemplary UAP1 inhibitor used as a tool compound in the appended examples is Ac4Glc2Bz (Compound B of WO2016025790):

[0026]

[0027] The "activity" of an immunotherapy refers to the response elicited by the immunotherapy in an individual. Such activity can include cellular responses of T cells, particularly CD4+ and / or CD8+ T cells, such as proliferation, differentiation, cytokine secretion, release of cytotoxic effector molecules, cytotoxic activity, and expression of activation markers, and / or the effect on target cells, particularly target cells (such as tumor cells) expressing the target cell antigen of a T cell bispecific antibody, such as lysis of the target cells.

[0028] In some aspects, administration of a UAP1 inhibitor causes an increase in T cell activation (induced by immunotherapy).

[0029] As used herein, "activation of T cells" or "T cell activation" refers to one or more cellular responses of T lymphocytes, particularly CD4+ or CD8+ T cells, selected from: proliferation, differentiation, cytokine secretion, release of cytotoxic effector molecules, cytotoxic activity, and expression of activation markers. Suitable assays for measuring T cell activation are known in the art and described herein. In certain aspects, T cell activation is determined by measuring the expression of CD25 and / or CD69 on T cells, for example by flow cytometry.

[0030] In some aspects, administration of a UAP1 inhibitor causes inhibition of T cell proliferation (induced by immunotherapy). In some aspects, administration of a UAP1 inhibitor causes inhibition of T cell cytotoxic activity (induced by immunotherapy).

[0031] The "cytotoxic activity" of T cells refers to the lysis (i.e., killing) of target cells induced by T lymphocytes, particularly CD4+ or CD8+ T cells. Cytotoxic activity typically involves degranulation of T lymphocytes and is associated with the release of cytotoxic effector molecules such as granzyme B and / or perforin from T lymphocytes.

[0032] In some aspects, administration of a UAP1 inhibitor causes inhibition of T cell receptor signaling in T cells (induced by immunotherapy).

[0033] "T cell receptor signaling" means the activity of the signaling pathway downstream of the T cell receptor (TCR) in T lymphocytes after TCR engagement (such as engagement of the CD3ε subunit of the TCR by a T cell bispecific antibody), involving signaling molecules, including tyrosine kinases such as Lck kinase.

[0034] In some aspects, administration of a UAP1 inhibitor causes an increase in cytokine secretion by T cells (induced by immunotherapy). In some aspects, the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, IFN-γ, IL-6, and IL-1β. In some aspects, the T cell is a CD8+ T cell or a CD4+ cell.

[0035] In some aspects, administration of a UAP1 inhibitor causes an increase in the levels of one or more cytokines in an individual (e.g., measured in the serum or tumor biopsy of the individual). In some aspects, the one or more cytokines are selected from the group consisting of IL-2, TNF-α, and IFN-γ. In some aspects, the increase persists after a given amount of time during which the UAP1 inhibitor has not been administered (to the individual). In some aspects, the amount of time is about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 16 hours, 20 hours, 24 hours, 36 hours, 48 hours, 72 hours, or 96 hours. In some aspects, the increase persists after subsequent administration of immunotherapy. In particular, the increase persists even after cessation of administration of the UAP1 inhibitor / after no further administration of the UAP1 inhibitor. The increase in cytokine levels is particularly compared to the levels in an individual (including the same individual) who has not received the UAP1 inhibitor (e.g., compared to the serum levels before administration of the UAP1 inhibitor / after administration of the UAP1 inhibitor, the serum levels are increased). The increase in cytokine levels is particularly compared to the levels in an individual (including the same individual) who has received (particularly the first administration) of immunotherapy but has not received the UAP1 inhibitor (i.e., in such cases, compared to the levels before administration of the UAP1 inhibitor / after administration of the UAP1 inhibitor but before administration of immunotherapy / after administration of immunotherapy, the cytokine levels are increased). The cytokine levels can also be measured in the tumor biopsy of the individual to compare the cytokine levels in an individual (including the same individual) who has received (particularly the first administration) of immunotherapy but has not received the UAP1 inhibitor (i.e., in such cases, compared to the levels before administration of the UAP1 inhibitor / after administration of the UAP1 inhibitor but before administration of immunotherapy / after administration of immunotherapy, the cytokine levels are increased). In some aspects, the increase has clinical significance and / or statistical significance.

[0036] In some aspects, the administration of the UAP1 inhibitor is before the administration of the immunotherapy. In some aspects, the administration of the UAP1 inhibitor is concurrent with the administration of the immunotherapy. In some aspects, the administration of the UAP1 inhibitor is after the administration of the immunotherapy. When the administration of the UAP1 inhibitor is before or after the administration of the immunotherapy, such administration of the UAP1 inhibitor can be, for example, about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours before or after the administration of the immunotherapy, respectively. The administration of the UAP1 inhibitor can be intermittent or continuous. In some aspects, the administration of the UAP1 inhibitor is oral.

[0037] In some aspects, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in the activity of the immunotherapy. In some aspects, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in the activation of T cells (induced by the immunotherapy). In some aspects, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in the proliferation of T cells (induced by the immunotherapy). In some aspects, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in the cytotoxic activity of T cells (induced by the immunotherapy). In some aspects, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in T cell receptor signaling in T cells (induced by the immunotherapy). In some aspects, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in cytokine secretion by T cells (induced by the immunotherapy). In some aspects, the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, and IFN-γ. In some aspects, the T cells are CD8+ T cells or CD4+ cells. In some aspects, the inhibition has clinical significance and / or statistical significance.

[0038] The increase in the cytokine level or cytokine secretion is in particular compared to the cytokine level or cytokine secretion in an individual (including the same individual) who has not received the UAP1 inhibitor (i.e., in such cases, the cytokine level is increased compared to the level before the administration of the UAP1 inhibitor / after the administration of the UAP1 inhibitor). The increase in the cytokine level or cytokine secretion is in particular compared to the cytokine level or cytokine secretion in an individual (including the same individual) who has received (in particular, the first administration) the immunotherapy but has not received the UAP1 inhibitor (i.e., in such cases, the cytokine level is increased compared to the level after the administration of the immunotherapy / after the administration of the immunotherapy but before the administration of the UAP1 inhibitor / after the administration of the UAP1 inhibitor). In the absence of such increase, the cytokine level and / or cytokine secretion may in particular be low / decreased relative to the immunotherapy (administration). In some aspects, the increase has clinical significance and / or statistical significance.

[0039] In some aspects, a UAP1 inhibitor is administered at an effective dose.

[0040] An "effective amount" or "effective dose" of an agent (e.g., a UAP1 inhibitor) or immunotherapy refers to the amount that is effective to achieve the desired therapeutic or prophylactic result at the required dosage and for the required period of time. As used herein, the terms IC50, IC80, IC90, and IC95 refer to the inhibitory concentrations at which 50%, 80%, 90%, and 95% of UAP1 activity is inhibited, respectively. In one embodiment, the effective dose is the IC50. In one embodiment, the effective dose is the IC80. In one embodiment, the effective dose is the IC90. In one embodiment, the effective dose is the IC95.

[0041] In some embodiments, the UAP1 inhibitor has an IC50 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor has an IC80 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor has an IC90 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor has an IC95 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor reduces UAP1 activity by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%. The IC50 value can be measured according to procedures and methods well known in the art.

[0042] In some aspects, the UAP1 inhibitor is administered at a dose of about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1000 mg, or more.

[0043] In some aspects, the UAP1 inhibitor is administered at a dose between about 1 mg and about 10 g, between about 10 mg and about 5000 mg, between about 50 mg and about 2000 mg, or between about 100 mg and about 1000 mg.

[0044] In some aspects, the administration of the UAP1 inhibitor is daily. In some aspects, the administration of the UAP1 inhibitor is once daily. In some aspects, the UAP1 inhibitor is administered one, two, three, four, five, six, seven, eight, nine, or ten times, particularly one, two, three, four, five, six, seven, eight, nine, or ten times during the treatment of an individual with immunotherapy. In some aspects, the administration of the UAP1 inhibitor lasts for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. In some aspects, the UAP1 inhibitor is administered once daily for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. In some aspects, the administration of the UAP1 inhibitor is associated with the first administration of immunotherapy. The first administration is particularly the first administration of immunotherapy during the treatment of an individual with immunotherapy. In some aspects, the administration of the UAP1 inhibitor is concurrent with the first administration of immunotherapy. In some aspects, the administration of the UAP1 inhibitor is before the first administration of immunotherapy. In some aspects, the administration of the UAP1 inhibitor is after the first administration of immunotherapy. In some aspects, the administration of the UAP1 inhibitor is after the first administration of immunotherapy and before the second administration of immunotherapy. When the administration of the UAP1 inhibitor is before or after the (first) administration of immunotherapy, such administration of the UAP1 inhibitor can be, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 20, or 24 hours before or after the administration of immunotherapy, respectively.

[0045] In some aspects, the administration of immunotherapy lasts for a longer period than the administration of the UAP1 inhibitor. In some aspects, the administration of immunotherapy is continued after the cessation of the administration of the UAP1 inhibitor. In some aspects, the administration of immunotherapy is a single administration or a repeated administration. During the treatment of an individual with immunotherapy, immunotherapy can be administered one or more times. For example, the treatment of an individual with immunotherapy can include multiple treatment cycles, each treatment cycle including one or more administrations of immunotherapy. In some aspects, the administration of immunotherapy includes a first administration and a second administration.

[0046] For use in the present invention, the immunotherapy will be formulated, administered, and dispensed in a manner consistent with good medical practice. Factors to be considered in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the timing of administration, and other factors known to the practicing physician.

[0047] In some aspects, the immunotherapy is administered at an effective dose. For systemic administration, the effective dose can initially be estimated based on in vitro assays (such as cell culture assays). The dose can then be formulated in an animal model to achieve an IC 50 circulating concentration range as measured, for example, in cell culture. Such information can be used to more accurately determine the useful dose for humans. The initial dose can also be estimated using techniques well known in the art based on in vivo data (such as animal models). The amount and interval of the dose can be adjusted individually to provide a plasma level of the immunotherapy sufficient to maintain the therapeutic effect. For example, for a T cell bispecific antibody, the typical patient dose range administered by injection is from about 0.1 to 50 mg / kg / day, typically from about 0.5 to 1 mg / kg / day. A therapeutically effective plasma level can be achieved by administering multiple doses per day. The level in plasma can be measured, for example, by HPLC.

[0048] An effective amount of the immunotherapy can be administered to prevent or treat a disease. The appropriate route of administration and dose of the immunotherapy can be determined based on the type of disease to be treated, the type of immunotherapy, the severity and course of the disease, the clinical condition of the individual, the clinical history of the individual and response to treatment, and the decision of the attending physician. Administration can be by any suitable route, for example by injection, such as intravenous or subcutaneous injection, depending in part on whether the administration is short-term or long-term. Various dosing schedules are contemplated herein, including but not limited to single or multiple administrations at various time points, bolus administration, and pulsed infusion.

[0049] The immunotherapy and the UAP1 inhibitor can be administered by any suitable route and can be administered by the same route of administration or by different routes of administration. In some aspects, the administration of the immunotherapy is parenteral, particularly intravenous.

[0050] In some aspects, the administration of the immunotherapy is the first administration of the immunotherapy to an individual, particularly the first administration of the immunotherapy in the course of treating an individual with the immunotherapy.

[0051] In some aspects, administration of immunotherapy induces (i.e., causes or increases) activation of T cells. In some aspects, administration of immunotherapy induces proliferation of T cells. In some aspects, administration of immunotherapy induces cytotoxic activity of T cells. In some aspects, administration of immunotherapy induces T cell receptor signaling in T cells. In some aspects, administration of immunotherapy induces T cell cytokine secretion. In some aspects, the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, and IFN-γ. In some aspects, the T cells are CD8+ T cells or CD4+ cells.

[0052] In some aspects, administration of immunotherapy results in activation of T cells, particularly cytotoxic T cells, especially at the cancer site (e.g., within a solid tumor cancer). The activation can include T cell proliferation, T cell differentiation, T cell cytokine secretion, release of cytotoxic effector molecules from T cells, cytotoxic activity of T cells, and expression of activation markers by T cells. In some aspects, administration of immunotherapy results in an increase in the number of cytotoxic T cells, especially at the cancer site (e.g., within a solid tumor cancer).

[0053] In some aspects, immunotherapy includes adoptive cell transfer, administration of monoclonal antibodies, administration of cytokines, administration of cancer vaccines, T cell engager therapy, administration of PD-1 axis-binding antagonists, or any combination thereof.

[0054] As described further below, T cell engager therapy, which can be used as immunotherapy in the present invention, is described.

[0055] In one aspect, the T cell engager therapy is a T cell bispecific antibody as described further below. In one aspect, the immunotherapy is a T cell bispecific antibody as described further below.

[0056] A "T cell bispecific antibody," abbreviated as "TCB," refers to an antibody capable of binding (including simultaneous binding) to a T cell (usually via an epitope expressed on the T cell, such as CD3) and to a target cell (usually via an epitope expressed on the target cell, such as CEA, TYRP1, or EpCAM).

[0057] In a preferred aspect according to the present invention, the T cell bispecific antibody is capable of simultaneously binding to an epitope on a T cell (i.e., a first antigen, such as CD3) and an epitope on a target cell (i.e., a second antigen, such as CEA, TYRP1, or EpCAM). In some aspects, the T cell bispecific antibody is capable of crosslinking T cells and target cells by simultaneous binding to CD3 and the target cell antigen. In an even more preferred aspect, such simultaneous binding results in lysis of the target cell, particularly a tumor cell expressing the target cell antigen (e.g., CEA, TYRP1, or EpCAM). In some aspects, such simultaneous binding results in activation of the T cell. In some aspects, such simultaneous binding results in a cellular response of the T cell selected from the group consisting of proliferation, differentiation, cytokine secretion, release of cytotoxic effector molecules, cytotoxic activity, and expression of activation markers. In some aspects, binding of the T cell bispecific antibody to CD3 without simultaneous binding to the target cell antigen does not result in T cell activation. In some aspects, the T cell bispecific antibody is capable of redirecting the cytotoxic activity of T cells to target cells. In a preferred aspect, such redirection is independent of MHC-mediated peptide antigen presentation by the target cell and / or the specificity of the T cell.

[0058] The term "bispecific" means that the antibody is capable of binding to at least two distinct epitopes. Typically, a bispecific antibody comprises two antigen-binding sites, each of which is specific for a different epitope. In certain aspects, the bispecific antibody is capable of simultaneously binding two epitopes, particularly two epitopes expressed on two distinct cells.

[0059] As used herein, the terms "epitope," "antigen," and "epitope" are synonymous and refer to a site on a polypeptide macromolecule (e.g., a stretch of contiguous amino acids or a conformational configuration consisting of different regions of non-contiguous amino acids) to which an antigen-binding moiety binds, thereby forming an antigen-binding moiety-antigen complex. Useful epitopes can be found, for example, on the surface of tumor cells, on the surface of virus-infected cells, on the surface of other diseased cells, on the surface of immune cells, in free substances in serum, and / or in the extracellular matrix (ECM).

[0060] As used herein, the term "antigen-binding portion" refers to a polypeptide molecule that binds to an epitope, including specifically binds. In some aspects, the antigen-binding portion is capable of directing an entity to which it is attached (e.g., a second antigen-binding portion) to a target site, such as to a particular type of tumor cell bearing an epitope. In other aspects, the antigen-binding portion is capable of activating signal transduction through its target antigen (e.g., a T cell receptor complex antigen). Antigen-binding portions include antibodies and fragments thereof as further defined herein. Particular antigen-binding portions include the antigen-binding domains of antibodies, which comprise the variable region of the antibody heavy chain and the variable region of the antibody light chain. In certain aspects, the antigen-binding portion may comprise antibody constant regions as further defined herein and known in the art. Available heavy chain constant regions include any of the following five isotypes: α, δ, ε, γ, or μ. Available light chain constant regions include any of the following two isotypes: κ and λ.

[0061] "Specifically binds" means binding is selective for an antigen and can be distinguished from unwanted or non-specific interactions. The term "bind / binding" herein generally refers to "specifically binds". The ability of an antigen-binding portion to bind to a particular epitope can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to those skilled in the art (e.g., surface plasmon resonance (SPR) techniques (e.g., analyzed on a BIAcore instrument) (Liljeblad et al., Glyco J 17, 323-329 (2000)) and traditional binding assays (Heeley, Endocr Res 28, 217-229 (2002)). In some aspects, the degree of binding of an antigen-binding portion to an unrelated protein is less than about 10% of the binding of the antigen-binding portion to the antigen, as measured, for example, by SPR. In certain aspects, an antigen-binding portion that binds to an antigen, or an antibody comprising the antigen-binding portion, has the following dissociation constant (K D ): ≤1 μM, ≤100 nM, ≤10 nM, ≤1 nM, ≤0.1 nM, ≤0.01 nM, or ≤0.001 nM (e.g., 10 -8 M or less, e.g., 10 -8 M to 10 -13 M, e.g., 10 -9 M to 10 -13 M).

[0062] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., a receptor) and its binding partner (e.g., a ligand). Unless otherwise specified, as used herein, "binding affinity" refers to the intrinsic binding affinity, which reflects the 1:1 interaction between the members of a binding pair (e.g., an antigen-binding portion and an antigen, or a receptor and its ligand). The affinity of molecule X for its partner Y can generally be expressed by the dissociation constant (K D ), which is the ratio of the dissociation rate constant to the association rate constant (k off and k on ). Thus, equivalent affinities can include different rate constants, so long as the ratio of the rate constants remains the same. Affinity can be measured by well-established methods known in the art, including those described herein. A particular method for measuring affinity is surface plasmon resonance (SPR).

[0063] Unless otherwise specified, "CD3" refers to any native CD3 from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses "full-length" unprocessed CD3, as well as any form of CD3 produced by processing in cells. The term also encompasses naturally occurring variants of CD3, such as splice variants or allelic variants. In some aspects, CD3 is human CD3, particularly the ε subunit of human CD3 (CD3ε). The amino acid sequence of human CD3ε is shown by UniProt (www.uniprot.org) accession number P07766 (version 144) or NCBI (www.ncbi.nlm.nih.gov / ) RefSeq NP_000724.1. See also SEQ ID NO:4.

[0064] As used herein, "target cell antigen" refers to an antigenic determinant present on the surface of a target cell, such as a cell in a tumor (such as a cancer cell or a cell of the tumor stroma) (in which case, "tumor cell antigen"). Preferably, the target cell antigen is not CD3, and / or is expressed on a cell different from CD3. In some aspects, the target cell antigen is CEA, particularly human CEA. In other aspects, the target cell antigen is TYRP1, particularly human TYRP1. In some aspects, the target cell antigen is EpCAM, particularly human EpCAM.

[0065] As used herein, terms such as "first", "second", or "third" with respect to antigen-binding portions, etc. are used for convenience of distinction when there is more than one of each type of portion. Unless expressly stated, the use of these terms is not intended to confer a particular order or orientation on the bispecific antibody.

[0066] As used herein, the term "valence" refers to the presence of a specified number of antigen-binding sites in an antibody. Thus, the term "monovalently binding to an antigen" refers to the presence of one (and no more than one) antigen-binding site specific for the antigen in the antibody.

[0067] The term "antibody" as used herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity.

[0068] The terms "full-length antibody", "intact antibody", and "whole antibody" are used interchangeably herein to refer to an antibody having a structure substantially similar to that of a native antibody.

[0069] "Antibody fragment" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds to an antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, diabodies, linear antibodies, single-chain antibody molecules (e.g., scFv), and single-domain antibodies. For a review of certain antibody fragments, see Hudson et al., Nat Med 9, 129-134 (2003). For a review of scFv fragments, see, e.g., Plückthun, in The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenberg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994); see also WO 93 / 16185; and U.S. Patent Nos. 5,571,894 and 5,587,458. For a discussion of Fab and F(ab')2 fragments that contain salvage receptor binding epitope residues and have extended in vivo half-lives, see U.S. Patent No. 5,869,046. Diabodies are antibody fragments that have two antigen-binding sites and can be bivalent or bispecific. See, e.g., EP 404,097; WO 1993 / 01161; Hudson et al., Nat Med 9, 129-134 (2003); and Hollinger et al., Proc Natl Acad Sci USA 90, 6444-6448 (1993). Triabodies and tetra-bodies are also described in Hudson et al., Nat Med 9, 129-134 (2003). Single-domain antibodies are antibody fragments that comprise all or a portion of the heavy-chain variable domain or all or a portion of the light-chain variable domain of an antibody. In certain aspects, single-domain antibodies are human single-domain antibodies (Domantis, Inc., Waltham, MA; see, e.g., U.S. Patent No. 6,248,516 B1). Antibody fragments can be prepared by a variety of techniques including, but not limited to, proteolytic digestion of intact antibodies, and production by recombinant host cells (e.g., E. coli or phage), as described herein.

[0070] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding of the antibody to an antigen. The variable domains (VH and VL, respectively) of the heavy and light chains of a native antibody generally have similar structures, each domain including four conserved framework regions (FRs) and three hypervariable regions (HVRs). See, e.g., Kindt et al., Kuby Immunology, 6th ed., W.H. Freeman and Co., p. 91 (2007). A single VH or VL domain may be sufficient to confer antigen-binding specificity. As used herein, "Kabat numbering" with respect to a variable region sequence refers to the numbering system set forth by Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991).

[0071] As used herein, the amino acid positions of all constant regions and constant domains of the heavy and light chains are numbered according to the Kabat numbering system described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991), and are referred to herein as "according to Kabat numbering" or "Kabat numbering." Specifically, the Kabat numbering system (see pages 647 to 660 of Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991)) is used for the light chain constant domain CL of κ and λ isotypes, and the Kabat EU index numbering system (see pages 661 to 723) is used for the heavy chain constant domains (CH1, hinge, CH2, and CH3), which is further clarified herein by referring to this case as "according to Kabat EU index numbering."

[0072] As used herein, the term "hypervariable region" or "HVR" refers to each region within an antibody variable domain that is highly variable in sequence and that defines antigen binding specificity, e.g., "complementary determining region" ("CDR"). Generally, an antibody comprises six CDRs; three in VH (HCDR1, HCDR2, HCDR3), and three in VL (LCDR1, LCDR2, LCDR3). Exemplary CDRs herein include:

[0073] (a) hypervariable loops present at amino acid residues 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2) and 96-101 (H3) (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987));

[0074] (b) CDRs present at amino acid residues 24-34 (L1), 50-56 (L2), 89-97 (L3), 31-35b (H1), 50-65 (H2) and 95-102 (H3) (Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed. Public Health Service, National Institutes of Health, Bethesda, MD (1991)); and

[0075] (c) antigen contact points that occur at the following amino acid residues: 27c to 36 (L1), 46 to 55 (L2), 89 to 96 (L3), 30 to 35b (H1), 47 to 58 (H2), and 93 to 101 (H3) (MacCallum et al., J. Mol. Biol. 262:732-745 (1996)).

[0076] Unless otherwise specified, CDRs are determined by the method described by Kabat et al., supra. Those skilled in the art will understand that CDR names may also be determined according to Chothia, supra, MacCallum, supra, or any other scientifically accepted naming system.

[0077] "Framework" or "FR" refers to the variable domain residues other than hypervariable region (HVR) residues. The FRs of a variable domain generally consist of the following four FR domains: FR1, FR2, FR3, and FR4. Thus, HVR sequences and FR sequences generally occur in the following order in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.

[0078] The "class" of an antibody or immunoglobulin refers to the type of constant domain or constant region that its heavy chain possesses. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and some of these antibodies can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are designated α, δ, ε, γ, and μ, respectively.

[0079] A "Fab molecule" refers to a protein composed of the VH and CH1 domains of the heavy chain of an immunoglobulin ("Fab heavy chain") and the VL and CL domains of the light chain ("Fab light chain").

[0080] The so-called "crossed" Fab molecule (also referred to as "Crossfab") means the following Fab molecule: in which the variable domains or constant domains of the Fab heavy chain and the light chain are exchanged (i.e., replaced with each other), that is, the crossed Fab molecule contains: a peptide chain containing the light chain variable domain VL and the heavy chain constant domain 1 CH1 (VL-CH1, in the N-terminal to C-terminal direction), and a peptide chain containing the heavy chain variable domain VH and the light chain constant domain CL (VH-CL, in the N-terminal to C-terminal direction). For clarity, in a crossed Fab molecule in which the variable domains of the Fab light chain and the Fab heavy chain are exchanged, the peptide chain containing the heavy chain constant domain 1 CH1 is referred to herein as the "heavy chain" of the (crossed) Fab molecule. Conversely, in a crossed Fab molecule in which the constant domains of the Fab light chain and the Fab heavy chain are exchanged, the peptide chain containing the heavy chain variable domain VH is referred to herein as the "heavy chain" of the (crossed) Fab molecule.

[0081] In contrast, the so-called "conventional" Fab molecule means a Fab molecule in its native form, that is, it contains: a heavy chain containing the heavy chain variable domain and the constant domain (VH-CH1, in the N-terminal to C-terminal direction), and a light chain containing the light chain variable domain and the constant domain (VL-CL, in the N-terminal to C-terminal direction).

[0082] The term "immunoglobulin molecule" refers to a protein having the structure of a naturally occurring antibody. For example, an immunoglobulin of the IgG class is a heterotetrameric glycoprotein of approximately 150,000 daltons, which contains two light chains and two heavy chains linked by disulfide bonds. From the N-terminus to the C-terminus, each heavy chain has a variable domain (VH) (also referred to as the variable heavy chain domain or heavy chain variable region), followed by three constant domains (CH1, CH2, and CH3) (also referred to as heavy chain constant regions). Similarly, from the N-terminus to the C-terminus, each light chain has a variable domain (VL) (also referred to as the variable light chain domain or light chain variable region), followed by a constant light chain (CL) domain (also referred to as the light chain constant region). The heavy chains of immunoglobulins can be assigned to one of five types: designated as α (IgA), δ (IgD), ε (IgE), γ (IgG), or μ (IgM), some of which can be further divided into subtypes, such as γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), γ4 (IgG4), α1 (IgA1), and α2 (IgA2). The light chains of immunoglobulins can be assigned to one of two types based on the amino acid sequence of their constant domains: designated as kappa (κ) and lambda (λ). An immunoglobulin consists essentially of two Fab molecules and an Fc domain linked by an immunoglobulin hinge region.

[0083] The term "Fc domain" or "Fc region" as used herein is used to define the C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the constant region. The term includes native sequence Fc regions and variant Fc regions. Although the boundaries of the IgG heavy chain Fc region may vary slightly, the human IgG heavy chain Fc region is generally defined as extending from Cys226 or from Pro230 to the carboxyl terminus of the heavy chain. However, antibodies produced by a host cell can undergo post-translational cleavage of one or more (especially one or two) amino acids from the C-terminus of the heavy chain. Thus, an antibody produced by a host cell by expressing a particular nucleic acid molecule encoding a full-length heavy chain can include the full-length heavy chain, or the antibody can include a cleaved variant of the full-length heavy chain. This can be the case where the last two C-terminal amino acids of the heavy chain are glycine (G446) and lysine (K447, according to the Kabat EU index numbering). Thus, the C-terminal lysine (Lys447) of the Fc region, or the C-terminal glycine (Gly446) and lysine (K447), may or may not be present. Unless otherwise specified herein, the numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system (also known as the EU index), as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991 (see also supra). As used herein, a "subunit" of an Fc domain refers to one of the two polypeptides that form a dimeric Fc domain, i.e., a polypeptide that contains the C-terminal constant region of an immunoglobulin heavy chain and that is capable of stable self-association. For example, a subunit of an IgG Fc domain contains the IgG CH2 and IgG CH3 constant domains.

[0084] "Modifications that promote the association of the first and second subunits of the Fc domain" are manipulations of the peptide backbone or post-translational modifications of the Fc domain subunits that reduce or prevent a polypeptide containing Fc domain subunits from associating with the same polypeptide to form a homodimer. As used herein, modifications that promote association specifically include individual modifications to each of the two Fc domain subunits (i.e., the first and second subunits of the Fc domain) that are desired to associate, wherein the modifications are complementary to each other to promote the association of the two Fc domain subunits. For example, modifications that promote association can alter the structure or charge of one or both of the Fc domain subunits so as to make their association spatially or electrostatically favorable, respectively. Thus, (hetero)dimerization occurs between a polypeptide containing the first Fc domain subunit and a polypeptide containing the second Fc domain subunit, which may be different in the sense that the additional components (e.g., antigen-binding portions) fused to each subunit are not the same. In some aspects, modifications that promote association include amino acid mutations, particularly amino acid substitutions, in the Fc domain. In certain aspects, modifications that promote association include individual amino acid mutations, particularly amino acid substitutions, in each of the two subunits of the Fc domain.

[0085] The term "effector function" refers to those biological activities that are attributable to the Fc region of an antibody and that vary with the antibody isotype. Examples of antibody effector functions include: C1q binding and complement-dependent cytotoxicity (CDC), Fc receptor binding, antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell phagocytosis (ADCP), cytokine secretion, antigen uptake by immune complex-mediated antigen-presenting cells, downregulation of cell surface receptors (e.g., B cell receptors), and B cell activation.

[0086] The “percent amino acid sequence identity (%)” relative to a reference polypeptide sequence is defined as the percentage of amino acid residues in the candidate sequence that are identical to the amino acid residues in the reference polypeptide sequence after aligning the candidate sequence with the reference polypeptide sequence and introducing gaps (if necessary) to achieve the maximum percent sequence identity, and without considering any conservative substitutions as part of the sequence identity. The alignment for determining the percent amino acid sequence identity can be achieved in various ways within the skill in the art, such as using publicly available computer software, such as BLAST, BLAST-2, ClustalW, Megalign (DNASTAR) software or the FASTA program package. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve the maximum alignment over the full length of the sequences being compared. However, for the purposes herein, the value of percent amino acid sequence identity is generated using the BLOSUM50 comparison matrix with the ggsearch program of the FASTA package version 36.3.8c or higher. The FASTA program package was written by W.R. Pearson and D.J. Lipman (1988), “Improved Tools for Biological Sequence Analysis”, PNAS 85:2444-2448; W.R. Pearson (1996) “Effective protein sequence comparison” Meth. Enzymol. 266:227-258; and Pearson et al. (1997) Genomics 46:24-36, and is publicly available from http: / / fasta.bioch.virginia.edu / fasta_www2 / fasta_down.shtml. Alternatively, the sequences can be compared using the public server accessible at http: / / fasta.bioch.virginia.edu / fasta_www2 / index.cgi, using the ggsearch (global protein:protein) program with default options (BLOSUM50; open: -10; ext: -2; Ktup = 2) to ensure a global rather than a local alignment. The percent amino acid identity is given in the output alignment header.

[0087] “Activating Fc receptor” is an Fc receptor that, upon engagement by the Fc domain of an antibody, initiates a signal transduction event that stimulates a cell carrying the receptor to perform an effector function. Human activating Fc receptors include FcγRIIIa (CD16a), FcγRI (CD64), FcγRIIa (CD32), and FcαRI (CD89).

[0088] "Reduced binding" (e.g., reduced binding to Fc receptors) refers to a decrease in the affinity for the corresponding interaction, as measured, for example, by SPR. For clarity, the term also includes reducing the affinity to zero (or below the detection limit of the analytical method), i.e., completely eliminating the interaction. Conversely, "increased binding" refers to an increase in the binding affinity for the corresponding interaction.

[0089] By "fusion" is meant that components (e.g., Fab molecules and Fc domain subunits) are linked by peptide bonds directly or via one or more peptide linkers.

[0090] In certain aspects, the T cell bispecific antibody binds to CD3 and a target cell antigen. Thus, in some aspects, the T cell bispecific antibody comprises an antigen-binding portion that binds to CD3 and an antigen-binding portion that binds to the target cell antigen.

[0091] In some aspects, the first antigen-binding portion and / or the second antigen-binding portion is a Fab molecule. In some aspects, the first antigen-binding portion is a crossed Fab molecule, wherein the variable or constant regions of the Fab light chain and the Fab heavy chain are exchanged. In such aspects, the second antigen-binding portion is preferably a conventional Fab molecule.

[0092] In some aspects in which both the first antigen-binding portion and the second antigen-binding portion of the T cell bispecific antibody are Fab molecules, and in one of the antigen-binding portions (particularly the first antigen-binding portion), the variable domains VL and VH of the Fab light chain and the Fab heavy chain are replaced with each other,

[0093] i) in the constant domain CL of the first antigen-binding portion, the amino acid at position 124 is replaced with a positively charged amino acid (according to Kabat numbering), and wherein in the constant domain CH1 of the first antigen-binding portion, the amino acid at position 147 or the amino acid at position 213 is replaced with a negatively charged amino acid (according to Kabat EU index numbering); or

[0094] ii) in the constant domain CL of the second antigen-binding portion, the amino acid at position 124 is replaced with a positively charged amino acid (according to Kabat numbering), and wherein in the constant domain CH1 of the second antigen-binding portion, the amino acid at position 147 or the amino acid at position 213 is replaced with a negatively charged amino acid (according to Kabat EU index numbering).

[0095] The T cell bispecific antibody does not contain both of the modifications mentioned in i) and ii). The constant domains CL and CH1 of the antigen-binding portion with VH / VL exchange are not replaced with each other (i.e., remain unexchanged).

[0096] In a more specific aspect,

[0097] i) in the constant domain CL of the first antigen-binding portion, the amino acid at position 124 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and in the constant domain CH1 of the first antigen-binding portion, the amino acid at position 147 or the amino acid at position 213 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering); or

[0098] ii) in the constant domain CL of the second antigen-binding portion, the amino acid at position 124 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and in the constant domain CH1 of the second antigen-binding portion, the amino acid at position 147 or the amino acid at position 213 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

[0099] In some aspects, in the constant domain CL of the second antigen-binding portion, the amino acid at position 124 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and in the constant domain CH1 of the second antigen-binding portion, the amino acid at position 147 or the amino acid at position 213 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

[0100] In other aspects, in the constant domain CL of the second antigen-binding portion, the amino acid at position 124 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and in the constant domain CH1 of the second antigen-binding portion, the amino acid at position 147 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

[0101] In a preferred aspect, in the constant domain CL of the second antigen-binding portion, the amino acid at position 124 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and the amino acid at position 123 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and in the constant domain CH1 of the second antigen-binding portion, the amino acid at position 147 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering), and the amino acid at position 213 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

[0102] In some aspects, in the constant domain CL of the second antigen-binding portion, the amino acid at position 124 is replaced with lysine (K) (according to Kabat numbering), and the amino acid at position 123 is replaced with lysine (K) (according to Kabat numbering), and in the constant domain CH1 of the second antigen-binding portion, the amino acid at position 147 is replaced with glutamic acid (E) (according to Kabat EU index numbering), and the amino acid at position 213 is replaced with glutamic acid (E) (according to Kabat EU index numbering).

[0103] In some aspects, in the constant domain CL of the second antigen-binding portion, the amino acid at position 124 is replaced with lysine (K) (according to Kabat numbering), and the amino acid at position 123 is replaced with arginine (R) (according to Kabat numbering), and in the constant domain CH1 of the second antigen-binding portion, the amino acid at position 147 is replaced with glutamic acid (E) (according to Kabat EU index numbering), and the amino acid at position 213 is replaced with glutamic acid (E) (according to Kabat EU index numbering).

[0104] In certain aspects, if the amino acid substitutions according to the above aspects are made in the constant domain CL and the constant domain CH1 of the second antigen-binding portion, the constant domain CL of the second antigen-binding portion is of the κ isotype.

[0105] In some aspects, the first antigen-binding portion and the second antigen-binding portion are fused to each other, optionally via a peptide linker.

[0106] In some aspects, the first antigen-binding portion and the second antigen-binding portion are each a Fab molecule and (i) the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, or (ii) the first antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the second antigen-binding portion at the C-terminus of the Fab heavy chain.

[0107] In some aspects, the T cell bispecific antibody provides monovalent binding to CD3.

[0108] In certain aspects, a T cell bispecific antibody comprises a single antigen-binding portion that binds to CD3, and two antigen-binding portions that bind to a target cell antigen. Thus, in some aspects, the T cell bispecific antibody comprises a third antigen-binding portion that binds to a target antigen, particularly a Fab molecule, more particularly a conventional Fab molecule. The third antigen-binding portion can be incorporated, alone or in combination, into all of the features described herein that are associated with the second antigen-binding portion (e.g., CDR sequences, variable region sequences, and / or amino acid substitutions in the constant region). In some aspects, the third antigen portion is the same as the first antigen-binding portion (e.g., is also a conventional Fab molecule and comprises the same amino acid sequence).

[0109] In certain aspects, the T cell bispecific antibody further comprises an Fc domain that comprises a first subunit and a second subunit. In some aspects, the Fc domain is an IgG Fc domain. In certain aspects, the Fc domain is an IgG1 Fc domain. In other aspects, the Fc domain is an IgG4 Fc domain. In more specific aspects, the Fc domain is an IgG4 Fc domain that comprises an amino acid substitution at position S228 (Kabat EU index number), particularly the amino acid substitution S228P. This amino acid substitution reduces in vivo Fab arm exchange of IgG4 antibodies (see Stubenrauch et al., Drug Metabolism and Disposition 38, 84-91 (2010)). In some other specific aspects, the Fc domain is a human Fc domain. In particularly preferred aspects, the Fc domain is a human IgG1 Fc domain. An exemplary sequence of the human IgG1 Fc region is given as SEQ ID NO:27.

[0110] In some aspects in which the first antigen-binding portion, the second antigen-binding portion, and (when present) the third antigen-binding portion are each a Fab molecule, (a) (i) the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, and the first antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain, or (ii) the first antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the second antigen-binding portion at the C-terminus of the Fab heavy chain, and the second antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain; and (b) (when present) the third antigen-binding portion is fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.

[0111] In some aspects, the T-cell bispecific antibody substantially comprises: a first, second, and third antigen-binding portion (particularly a Fab molecule), an Fc domain comprising a first subunit and a second subunit, and optionally one or more peptide linkers.

[0112] The components of the T-cell bispecific antibody can be fused directly to each other or, preferably, via one or more suitable peptide linkers. When the Fab molecule is fused to the N-terminus of the subunit of the Fc domain, the fusion is typically via the immunoglobulin hinge region.

[0113] The antigen-binding portion can be fused to the Fc domain (or to each other) directly or via a peptide linker, the peptide linker comprising one or more amino acids, typically about 2 - 20 amino acids. Peptide linkers are known in the art and are described herein. Suitable non-immunogenic peptide linkers include, for example, (G4S) n , (SG4) n , (G4S) n , G4(SG4) n or (G4S) n G5 peptide linkers. "n" is typically an integer from 1 to 10, usually 2 to 4. In some aspects, the peptide linker has a length of at least 5 amino acids, in some aspects a length of 5 to 100 amino acids, and in other aspects a length of 10 to 50 amino acids. In some aspects, the peptide linker is (GxS) n or (GxS) n G m , where G = glycine, S = serine, and (x = 3, n = 3, 4, 5, or 6, and m = 0, 1, 2, or 3) or (x = 4, n = 1, 2, 3, 4, or 5 and m = 0, 1, 2, 3, 4, or 5), in some aspects, x = 4 and n = 2 or 3, in other aspects, x = 4 and n = 2, and in yet other aspects, x = 4, n = 1, and m = 5. In some aspects, the peptide linker is (G4S)2. In other aspects, the peptide linker is G4SG5. Additionally, the linker can comprise (a portion of) the immunoglobulin hinge region. In particular, in the case where the Fab molecule is fused to the N-terminus of the Fc domain subunit, the fusion can be via the immunoglobulin hinge region or a portion thereof, with or without an additional peptide linker.

[0114] In certain aspects, the Fc domain comprises a modification that promotes the association of the first and second subunits of the Fc domain. The most extensive protein - protein interaction site between the two subunits of the human IgG Fc domain is in the CH3 domain. Thus, in some aspects, the modification is in the CH3 domain of the Fc domain.

[0115] In a specific aspect, the modification that promotes the association of the first and second subunits of the Fc domain is the so-called "knob-into-hole" modification, which includes a "knob" modification in one of the two subunits of the Fc domain and a "hole" modification in the other of the two subunits of the Fc domain. The knob-into-hole technology is described, for example, in US 5,731,168; US 7,695,936; Ridgway et al., Prot Eng 9, 617-621 (1996) and Carter, J Immunol Meth 248, 7-15 (2001). Generally, the method involves introducing a protrusion ("knob") at the interface of the first polypeptide and introducing a corresponding cavity ("hole") in the interface of the second polypeptide, such that the protrusion can be positioned in the cavity to promote the formation of heterodimers and hinder the formation of homodimers. The protrusion is constructed by replacing a small amino acid side chain from the interface of the first polypeptide with a larger side chain (such as tyrosine or tryptophan). A compensatory cavity of the same or similar size as the protrusion is created in the interface of the second polypeptide by replacing a large amino acid side chain with a smaller amino acid side chain (such as alanine or threonine).

[0116] Thus, in some aspects, the amino acid residues in the CH3 domain of the first subunit of the Fc domain are replaced with amino acid residues having a larger side chain volume, thereby generating a protrusion within the CH3 domain of the first subunit, which can be positioned in a cavity within the CH3 domain of the second subunit, and the amino acid residues in the CH3 domain of the second subunit of the Fc domain are replaced with amino acid residues having a smaller side chain volume, thereby generating a cavity within the CH3 domain of the second subunit, and the protrusion within the CH3 domain of the first subunit can be positioned within the cavity. Preferably, the amino acid residues having a larger side chain volume are selected from the group consisting of arginine (R), phenylalanine (F), tyrosine (Y), and tryptophan (W). Preferably, the amino acid residues having a smaller side chain volume are selected from the group consisting of alanine (A), serine (S), threonine (T), and valine (V). The protrusion and the cavity can be prepared by altering the nucleic acid encoding the polypeptide, for example, by site-directed mutagenesis or by peptide synthesis.

[0117] In certain such aspects, in the first subunit of the Fc domain, the threonine residue at position 366 is replaced with a tryptophan residue (T366W), and in the second subunit of the Fc domain, the tyrosine residue at position 407 is replaced with a valine residue (Y407V), and optionally, the threonine residue at position 366 is replaced with a serine residue (T366S), and the leucine residue at position 368 is replaced with an alanine residue (L368A) (according to Kabat EU index numbering). In other aspects, in the first subunit of the Fc domain, additionally, the serine residue at position 354 is replaced with a cysteine residue (S354C) or the glutamate residue at position 356 is replaced with a cysteine residue (E356C) (especially the serine residue at position 354 is replaced with a cysteine residue), and in the second subunit of the Fc domain, additionally, the tyrosine residue at position 349 is replaced with a cysteine residue (Y349C) (according to Kabat EU index numbering). In preferred aspects, the first subunit of the Fc domain comprises the amino acid substitutions S354C and T366W, and the second subunit of the Fc domain comprises the amino acid substitutions Y349C, T366S, L368A and Y407V (according to Kabat EU index numbering).

[0118] In some aspects, the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector functions.

[0119] In certain aspects, the Fc receptor is an Fcγ receptor. In some aspects, the Fc receptor is a human Fc receptor. In some aspects, the Fc receptor is an activating Fc receptor. In specific aspects, the Fc receptor is an activating human Fcγ receptor, more specifically human FcγRIIIa, FcγRI or FcγRIIa, and most specifically human FcγRIIIa. In some aspects, the effector function is one or more selected from the group consisting of: complement-dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell phagocytosis (ADCP) and cytokine secretion. In certain aspects, the effector function is ADCC.

[0120] Typically, the same one or more amino acid substitutions are present in each of the two subunits of the Fc domain. In some aspects, the one or more amino acid substitutions reduce the binding affinity of the Fc domain for Fc receptors. In some aspects, the one or more amino acid substitutions reduce the binding affinity of the Fc domain for Fc receptors by at least 2-fold, at least 5-fold or at least 10-fold.

[0121] In some aspects, the Fc domain contains amino acid substitutions at positions selected from the group consisting of E233, L234, L235, N297, P331, and P329 (according to Kabat EU index numbering). In more specific aspects, the Fc domain contains amino acid substitutions at positions selected from the group consisting of L234, L235, and P329 (according to Kabat EU index numbering). In some aspects, the Fc domain contains the amino acid substitutions L234A and L235A (according to Kabat EU index numbering). In some such aspects, the Fc domain is an IgG1 Fc domain, particularly a human IgG1 Fc domain. In some aspects, the Fc domain contains an amino acid substitution at position P329. In more specific aspects, the amino acid substitution is P329A or P329G, particularly P329G (according to Kabat EU index numbering). In some aspects, the Fc domain contains an amino acid substitution at position P329 and another amino acid substitution at a position selected from E233, L234, L235, N297, and P331 (according to Kabat EU index numbering). In more specific aspects, the another amino acid substitution is E233P, L234A, L235A, L235E, N297A, N297D, or P331S. In certain aspects, the Fc domain contains amino acid substitutions at positions P329, L234, and L235 (according to Kabat EU index numbering). In more specific aspects, the Fc domain contains the amino acid mutations L234A, L235A, and P329G (“P329G LALA”, “PGLALA”, or “LALAPG”). Specifically, in preferred aspects, each subunit of the Fc domain contains the amino acid substitutions L234A, L235A, and P329G (Kabat EU index numbering), i.e., in each of the first and second subunits of the Fc domain, the leucine residue at position 234 is replaced by an alanine residue (L234A), the leucine residue at position 235 is replaced by an alanine residue (L235A), and the proline residue at position 329 is replaced by a glycine residue (P329G) (according to Kabat EU index numbering). In some such aspects, the Fc domain is an IgG1 Fc domain, particularly a human IgG1 Fc domain.

[0122] In some aspects, the target cell antigen of the T cell bispecific antibody is carcinoembryonic antigen (CEA).

[0123] Unless otherwise specified, "carcinoembryonic antigen" or "CEA" (also known as carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5)) refers to any native CEA from any vertebrate source, which vertebrate sources include mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses "full-length" unprocessed CEA, as well as any form of CEA produced by processing in cells. The term also encompasses naturally occurring variants of CEA, such as splice variants or allelic variants. In some aspects, CEA is human CEA. The amino acid sequence of human CEA is shown by UniProt (www.uniprot.org) accession number P06731 or NCBI (www.ncbi.nlm.nih.gov / ) RefSeq NP_004354.2. See also SEQ ID NO:5. In some aspects, CEA is membrane-bound CEA. In some aspects, CEA is CEA expressed on the surface of cells (e.g., cancer cells).

[0124] Useful T cell bispecific antibodies that bind to CEA for use in the present invention are described, for example, in PCT Publication No. WO2014 / 131712, which is incorporated herein by reference in its entirety.

[0125] In some aspects, the T cell bispecific antibody comprises a first antigen-binding portion that binds to CD3 and a second antigen-binding portion that binds to CEA.

[0126] In some aspects, the first antigen-binding portion comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain CDR (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12, and the light chain variable region comprising light chain CDR (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18.

[0127] In some aspects, the second antigen-binding portion comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain CDR (HCDR) 1 of SEQ ID NO:36, HCDR2 of SEQ ID NO:37, and HCDR3 of SEQ ID NO:38, and the light chain variable region comprising light chain CDR (LCDR) 1 of SEQ ID NO:39, LCDR2 of SEQ ID NO:40, and LCDR3 of SEQ ID NO:41.

[0128] In some aspects, the CEA CD3 bispecific antibody comprises

[0129] (i) A first antigen-binding portion that binds to CD3 and comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO: 9, HCDR2 of SEQ ID NO: 11, and HCDR3 of SEQ ID NO: 12, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO: 16, LCDR2 of SEQ ID NO: 17, and LCDR3 of SEQ ID NO: 18; and

[0130] (ii) A second antigen-binding portion that binds to CEA and comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO: 36, HCDR2 of SEQ ID NO: 37, and HCDR3 of SEQ ID NO: 38, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO: 39, LCDR2 of SEQ ID NO: 40, and LCDR3 of SEQ ID NO: 41.

[0131] In some aspects, the first antigen-binding portion comprises a heavy-chain variable region sequence and a light-chain variable region sequence that are at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 14 and SEQ ID NO: 19, respectively. In some aspects, the first antigen-binding portion comprises the heavy-chain variable region sequence of SEQ ID NO: 14 and the light-chain variable region sequence of SEQ ID NO: 19.

[0132] In some aspects, the second antigen-binding portion comprises a heavy-chain variable region sequence and a light-chain variable region sequence that are at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 42 and SEQ ID NO: 43, respectively. In some aspects, the second antigen-binding portion comprises the heavy-chain variable region sequence of SEQ ID NO: 42 and the light-chain variable region sequence of SEQ ID NO: 43.

[0133] In some aspects, the T cell bispecific antibody comprises: a third antigen-binding portion that binds to CEA and / or an Fc domain comprising a first and a second subunit, as described herein.

[0134] In preferred aspects, the T cell bispecific antibody comprises

[0135] (i) A first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain CDR (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12, and the light-chain variable region comprising light-chain CDR (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18, wherein the first antigen-binding portion is a cross-Fab molecule, in which the variable or constant regions (especially the constant regions) of the Fab light chain and the Fab heavy chain are exchanged;

[0136] (ii) A second antigen-binding portion and a third antigen-binding portion that bind to CEA, the second antigen-binding portion and the third antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain CDR (HCDR) 1 of SEQ ID NO:36, HCDR2 of SEQ ID NO:37, and HCDR3 of SEQ ID NO:38, and the light-chain variable region comprising light-chain CDR (LCDR) 1 of SEQ ID NO:39, LCDR2 of SEQ ID NO:40, and LCDR3 of SEQ ID NO:41, wherein the second antigen-binding portion and the third antigen-binding portion are each a Fab molecule, especially a conventional Fab molecule;

[0137] (iii) An Fc domain, the Fc domain comprising a first subunit and a second subunit,

[0138] wherein the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, and the first antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain, and wherein the third antigen-binding portion is fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.

[0139] In some aspects, the first antigen-binding portion of the T cell bispecific antibody (that binds to CEA and CD3) comprises a heavy chain variable region sequence and a light chain variable region sequence, wherein the heavy chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:14, and the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:19. In some aspects, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO:14 and the light chain variable region sequence of SEQ ID NO:19.

[0140] In some aspects, the second antigen-binding portion and the third antigen-binding portion (when present) of the T cell bispecific antibody (that binds to CEA and CD3) comprise a heavy chain variable region sequence and a light chain variable region sequence, wherein the heavy chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:42, and the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:43. In some aspects, the second antigen-binding portion and the third antigen-binding portion (when present) comprise the heavy chain variable region of SEQ ID NO:42 and the light chain variable region of SEQ ID NO:43.

[0141] The Fc domain according to the above aspects can be incorporated, individually or in combination, with all the features described above regarding the Fc domain.

[0142] In some aspects, the Fc domain of the T cell bispecific antibody (that binds to CEA and CD3) comprises a modification that promotes the association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector functions.

[0143] In some aspects, the antigen-binding portion and the Fc region are fused to each other via a peptide linker, particularly the peptide linker as described above.

[0144] In some aspects, the T cell bispecific antibody (that binds to CEA and CD3) comprises the following polypeptides: a polypeptide (particularly two polypeptides) comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 44; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 45; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 46; and a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 47. In some aspects, the T cell bispecific antibody (that binds to CEA and CD3) comprises the following polypeptides: a polypeptide (particularly two polypeptides) comprising the sequence of SEQ ID NO: 44; a polypeptide comprising the sequence of SEQ ID NO: 45; a polypeptide comprising the sequence of SEQ ID NO: 46; and a polypeptide comprising the sequence of SEQ ID NO: 47.

[0145] In a preferred aspect, the T cell bispecific antibody is cetuximab (WHO Drug Information (International Nonproprietary Names for Pharmaceutical Substances), Recommended INN: List 80, 2018, Vol. 32, No. 3, p. 438).

[0146] The T cell bispecific antibody cetuximab (RG7802, RO6958688, CEA-TCB) is a novel T cell-activating bispecific antibody that targets carcinoembryonic antigen (CEA) on tumor cells and CD3 on T cells, redirecting T cells to tumor cells expressing CEA glycoprotein at the cell surface independent of their T cell receptor specificity (Bacac et al., Oncoimmunology. 2016;5(8):1-30). A major advantage of T cell-redirecting bispecific antibodies is that they mediate T cell recognition of cancer cells independent of neoantigen load. CEA is overexpressed on the cell surface of many colorectal cancers (CRCs), and thus cetuximab is a promising immunotherapy agent for non-highly mutated microsatellite-stable (MSS) CRC.

[0147] Cetuximab has a single binding site for the CD3ε chain on T cells and two CEA binding sites that modulate the binding affinity for cancer cells with medium to high CEA cell surface expression (Bacac et al., Clin Cancer Res. 2016;22(13):3286–97). This avoids targeting healthy epithelial cells with low CEA expression levels that are physiologically present in some tissues. Binding of cetuximab to CEA on the cancer cell surface and CD3 on T cells triggers T cell activation, cytokine secretion, and release of cytotoxic granules. A phase I trial of cetuximab in patients with metastatic CRC expressing CEA and failing in at least two previous chemotherapy regimens showed antitumor activity, with radiographic shrinkage occurring in 11% (4 / 36) and 50% (5 / 10) of patients treated with monotherapy or in combination with a PD-L1 inhibitory antibody, respectively (Argilés et al., Ann Oncol. June 1, 2017;28(suppl_3):mdx302.003-mdx302.003; Tabernero et al., J Clin Oncol. May 20, 2017;35(15_suppl):3002). Based on these results, CEA is one of the most promising target antigens for immunotherapy of MSS CRC. Although some patients in this dose escalation trial were treated with doses lower than the final recommended dose, the response rates still indicated that the tumor subgroup was resistant to treatment.

[0148] In some aspects, the target cell antigen of the T cell bispecific antibody is EpCAM.

[0149] Unless otherwise specified, “EpCAM” (also known as “epithelial cell adhesion molecule”) refers to any native EpCAM from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses “full-length,” unprocessed EpCAM and any form of EpCAM produced by processing in cells. The term also encompasses naturally occurring variants of EpCAM, such as splice variants or allelic variants. In some aspects, EpCAM is human EpCAM. Human EpCAM is described in UniProt (www.uniprot.org) accession number P16422 (entry version 207), and the amino acid sequence of human EpCAM is also shown in SEQ ID NO:6.

[0150] In some aspects, the T cell bispecific antibody comprises a first antigen-binding portion that binds to CD3 and a second antigen-binding portion that binds to EpCAM.

[0151] In some aspects, the first antigen-binding portion comprises a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain complementarity-determining region (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12, and the light-chain variable region comprising light-chain complementarity-determining region (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18.

[0152] In some aspects, the second antigen-binding portion comprises a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain complementarity-determining region (HCDR) 1 of SEQ ID NO:60, HCDR2 of SEQ ID NO:61, and HCDR3 of SEQ ID NO:62, and the light-chain variable region comprising light-chain complementarity-determining region (LCDR) 1 of SEQ ID NO:63, LCDR2 of SEQ ID NO:64, and LCDR3 of SEQ ID NO:65.

[0153] In some aspects, the T-cell bispecific antibody comprises

[0154] (i) a first antigen-binding portion that binds to CD3 and comprises a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain complementarity-determining region (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12, and the light-chain variable region comprising light-chain complementarity-determining region (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18; and

[0155] (ii) a second antigen-binding portion that binds to EpCAM and comprises a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain complementarity-determining region (HCDR) 1 of SEQ ID NO:60, HCDR2 of SEQ ID NO:61, and HCDR3 of SEQ ID NO:62, and the light-chain variable region comprising light-chain complementarity-determining region (LCDR) 1 of SEQ ID NO:63, LCDR2 of SEQ ID NO:64, and LCDR3 of SEQ ID NO:65.

[0156] In some aspects, the first antigen-binding portion comprises a heavy chain variable region sequence and a light chain variable region sequence, wherein the heavy chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, and the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some aspects, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO: 14 and the light chain variable region sequence of SEQ ID NO: 19.

[0157] In some aspects, the second antigen-binding portion comprises a heavy chain variable region sequence and a light chain variable region sequence, wherein the heavy chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 66, and the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 67. In some aspects, the second antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO: 66 and the light chain variable region sequence of SEQ ID NO: 67.

[0158] In some aspects, the T cell bispecific antibody comprises: a third antigen-binding portion that binds to EpCAM and / or an Fc domain comprising a first and a second subunit, as described herein.

[0159] In preferred aspects, the T cell bispecific antibody comprises

[0160] (i) a first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain CDR (HCDR) 1 of SEQ ID NO: 9, HCDR2 of SEQ ID NO: 11, and HCDR3 of SEQ ID NO: 12, and the light chain variable region comprising light chain CDR (LCDR) 1 of SEQ ID NO: 16, LCDR2 of SEQ ID NO: 17, and LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding portion is a cross-Fab molecule in which the variable regions or constant regions (especially the variable regions) of the Fab light chain and the Fab heavy chain are exchanged;

[0161] (ii) A second antigen-binding portion and a third antigen-binding portion that bind to EpCAM, wherein the second antigen-binding portion and the third antigen-binding portion comprise a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain CDR (HCDR) 1 of SEQ ID NO: 60, HCDR2 of SEQ ID NO: 61, and HCDR3 of SEQ ID NO: 62, and the light-chain variable region comprising light-chain CDR (LCDR) 1 of SEQ ID NO: 63, LCDR2 of SEQ ID NO: 64, and LCDR3 of SEQ ID NO: 65, wherein the second antigen-binding portion and the third antigen-binding portion are each a Fab molecule, particularly a conventional Fab molecule;

[0162] (iii) An Fc domain, the Fc domain comprising a first subunit and a second subunit,

[0163] wherein the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, and the first antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain, and wherein the third antigen-binding portion is fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.

[0164] In some aspects, the first antigen-binding portion of the T cell bispecific antibody (that binds to EpCAM and CD3) is a crossed Fab molecule, wherein the variable regions of the Fab light chain and the Fab heavy chain are exchanged, and wherein the second antigen-binding portion and (when present) the third antigen-binding portion of the T cell bispecific antibody are conventional Fab molecules, wherein in the constant domain CL, the amino acid at position 124 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and the amino acid at position 123 is independently substituted with lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and in the constant domain CH1, the amino acid at position 147 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering), and the amino acid at position 213 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

[0165] In particular, in the above aspects, in the constant domain CL of the second and third Fab molecules under (ii), the amino acid at position 124 can be replaced by lysine (K) (according to Kabat numbering), and the amino acid at position 123 can be replaced by lysine (K) or arginine (R) (especially by arginine (R)) (according to Kabat numbering), and in the constant domain CH1 of the second and third Fab molecules under (ii), the amino acid at position 147 can be replaced by glutamic acid (E) (according to Kabat EU index numbering), and the amino acid at position 213 can be replaced by glutamic acid (E) (according to Kabat EU index numbering).

[0166] In some aspects, the first antigen-binding portion of the T cell bispecific antibody (that binds to EpCAM and CD3) comprises a heavy chain variable region sequence and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, and the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some aspects, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO: 14 and the light chain variable region sequence of SEQ ID NO: 19.

[0167] In some aspects, the second antigen-binding portion of the T cell bispecific antibody (that binds to EpCAM and CD3) and the third antigen-binding portion (when present) comprise a heavy chain variable region sequence and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 66, and the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 67. In some aspects, the second antigen-binding portion and the third antigen-binding portion (when present) comprise the heavy chain variable region of SEQ ID NO: 66 and the light chain variable region of SEQ ID NO: 67.

[0168] The Fc domain according to the above aspects can be incorporated, individually or in combination, with all the features described above regarding the Fc domain.

[0169] In some aspects, the Fc domain of the T cell bispecific antibody (that binds to EpCAM and CD3) comprises a modification that promotes the association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector functions.

[0170] In some aspects, the antigen-binding portion and the Fc region are fused to each other via a peptide linker, particularly a peptide linker as described above.

[0171] In some aspects, a T cell bispecific antibody (that binds to EpCAM and CD3) comprises the following polypeptides: a polypeptide (particularly two polypeptides) comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:68; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:69; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:70; and a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:71. In some aspects, a T cell bispecific antibody (that binds to EpCAM and CD3) comprises the following polypeptides: a polypeptide (particularly two polypeptides) comprising the sequence of SEQ ID NO:68; a polypeptide comprising the sequence of SEQ ID NO:69; a polypeptide comprising the sequence of SEQ ID NO:70; and a polypeptide comprising the sequence of SEQID NO:71.

[0172] In some aspects, the target cell antigen of the T cell bispecific antibody is TYRP1.

[0173] Unless otherwise specified, "TYRP1" refers to tyrosinase-related protein 1 and means any native TYRP1 from any vertebrate source, which vertebrate sources include mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses "full-length" unprocessed TYRP1, as well as any form of TYRP1 produced by processing in cells. The term also encompasses naturally occurring variants of TYRP1, such as splice variants or allelic variants. In some aspects, TYRP1 is human TYRP1. See Human Protein UniProt (www.uniprot.org) accession number P17643 (version 207). An exemplary sequence of human TYRP1 is given in SEQ ID NO:7.

[0174] In some aspects, the T cell bispecific antibody comprises a first antigen-binding portion that binds to CD3 and a second antigen-binding portion that binds to TYRP1.

[0175] In some aspects, the first antigen-binding portion comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain complementarity determining region (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12, and the light chain variable region comprising light chain complementarity determining region (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18.

[0176] In preferred aspects, the first antigen-binding portion comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain complementarity determining region (HCDR) 1 of SEQ ID NO:10, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:13, and the light chain variable region comprising light chain complementarity determining region (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18.

[0177] In some aspects, the second antigen-binding portion comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain complementarity determining region (HCDR) 1 of SEQ ID NO:23, HCDR2 of SEQ ID NO:24, and HCDR3 of SEQ ID NO:25, and the light chain variable region comprising light chain complementarity determining region (LCDR) 1 of SEQ ID NO:27, LCDR2 of SEQ ID NO:28, and LCDR3 of SEQ ID NO:29.

[0178] In some aspects, the T cell bispecific antibody comprises

[0179] (i) a first antigen-binding portion that binds to CD3 and comprises a heavy chain variable region and a light chain variable region: a heavy chain variable region comprising heavy chain complementarity determining region (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12 or a heavy chain variable region comprising HCDR1 of SEQ ID NO:10, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:13; a light chain variable region comprising light chain complementarity determining region (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18; and

[0180] (ii) A second antigen-binding portion that binds to TYRP1 and comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO: 23, HCDR2 of SEQ ID NO: 24, and HCDR3 of SEQ ID NO: 25, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO: 27, LCDR2 of SEQ ID NO: 28, and LCDR3 of SEQ ID NO: 29.

[0181] In some aspects, the first antigen-binding portion comprises a heavy-chain variable region sequence and a light-chain variable region sequence as follows: a heavy-chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 14 or a heavy-chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 15; a light-chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some aspects, the first antigen-binding portion comprises the heavy-chain variable region sequence of SEQ ID NO: 14 or the heavy-chain variable region sequence of SEQ ID NO: 15 and the light-chain variable region sequence of SEQ ID NO: 19.

[0182] In some aspects, the second antigen-binding portion comprises a heavy-chain variable region sequence and a light-chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 26, and a light-chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 30. In some aspects, the second antigen-binding portion comprises the heavy-chain variable region sequence of SEQ ID NO: 26 and the light-chain variable region sequence of SEQ ID NO: 30.

[0183] In some aspects, the T cell bispecific antibody comprises: a third antigen-binding portion that binds to TYRP1 and / or an Fc domain comprising a first and a second subunit, as described herein.

[0184] In a preferred aspect, the T cell bispecific antibody comprises

[0185] (i) A first antigen-binding portion that binds to CD3 and comprises a heavy-chain variable region and a light-chain variable region as follows: a heavy-chain variable region comprising a heavy-chain CDR (HCDR) 1 of SEQ ID NO:9, an HCDR2 of SEQ ID NO:11, and an HCDR3 of SEQ ID NO:12, or a heavy-chain variable region comprising an HCDR1 of SEQ ID NO:10, an HCDR2 of SEQ ID NO:11, and an HCDR3 of SEQ ID NO:13; a light-chain variable region comprising a light-chain CDR (LCDR) 1 of SEQ ID NO:16, an LCDR2 of SEQ ID NO:17, and an LCDR3 of SEQ ID NO:18, wherein the first antigen-binding portion is a cross-Fab molecule in which the variable regions or constant regions (especially the variable regions) of the Fab light chain and the Fab heavy chain are exchanged;

[0186] (ii) A second antigen-binding portion and a third antigen-binding portion that bind to TYRP1, the second antigen-binding portion and the third antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising a heavy-chain CDR (HCDR) 1 of SEQ ID NO:23, an HCDR2 of SEQ ID NO:24, and an HCDR3 of SEQ ID NO:25, the light-chain variable region comprising a light-chain CDR (LCDR) 1 of SEQ ID NO:27, an LCDR2 of SEQ ID NO:28, and an LCDR3 of SEQ ID NO:29, wherein the second antigen-binding portion and the third antigen-binding portion are each a Fab molecule, especially a conventional Fab molecule;

[0187] (iii) An Fc domain that comprises a first subunit and a second subunit,

[0188] wherein the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, and the first antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain, and wherein the third antigen-binding portion is fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.

[0189] In some aspects, the first antigen-binding portion of a T cell bispecific antibody (which binds to TYRP1 and CD3) is a cross-Fab molecule in which the variable regions of the Fab light chain and the Fab heavy chain are exchanged, and in which the second antigen-binding portion and, when present, the third antigen-binding portion of the T cell bispecific antibody are conventional Fab molecules, in which in the constant domain CL, the amino acid at position 124 is independently replaced by lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and the amino acid at position 123 is independently replaced by lysine (K), arginine (R), or histidine (H) (according to Kabat numbering), and in the constant domain CH1, the amino acid at position 147 is independently replaced by glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering), and the amino acid at position 213 is independently replaced by glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

[0190] In particular, in the above aspects, in the constant domain CL of the second and third Fab molecules under (ii), the amino acid at position 124 can be replaced by lysine (K) (according to Kabat numbering), and the amino acid at position 123 can be replaced by lysine (K) or arginine (R) (especially by arginine (R)) (according to Kabat numbering), and in the constant domain CH1 of the second and third Fab molecules under (ii), the amino acid at position 147 can be replaced by glutamic acid (E) (according to Kabat EU index numbering), and the amino acid at position 213 can be replaced by glutamic acid (E) (according to Kabat EU index numbering).

[0191] In some aspects, the first antigen-binding portion of a T cell bispecific antibody (which binds to TYRP1 and CD3) comprises a heavy chain variable region sequence and a light chain variable region sequence as follows: a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:14 or a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:15; a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:19. In some aspects, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO:14 or the heavy chain variable region sequence of SEQ ID NO:15 and the light chain variable region sequence of SEQ ID NO:19.

[0192] In some aspects, the second antigen-binding portion and (when present) the third antigen-binding portion of a T cell bispecific antibody (that binds to TYRP1 and CD3) comprise a heavy chain variable region sequence and a light chain variable region sequence, the heavy chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:26, and the light chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:30. In some aspects, the second antigen-binding portion and (when present) the third antigen-binding portion comprise the heavy chain variable region of SEQ ID NO:26 and the light chain variable region of SEQ ID NO:30.

[0193] The Fc domain according to the above aspects can be incorporated, individually or in combination, with all the features described above for the Fc domain.

[0194] In some aspects, the Fc domain of a T cell bispecific antibody (that binds to TYRP1 and CD3) comprises a modification that promotes the association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector functions.

[0195] In some aspects, the antigen-binding portion and the Fc region are fused to each other via a peptide linker, particularly a peptide linker as described above.

[0196] In some aspects, a T cell bispecific antibody (that binds to TYRP1 and CD3) comprises the following polypeptides: polypeptides (particularly two polypeptides) comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:33; polypeptides comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:31; polypeptides comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:32; and polypeptides comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:34. In some aspects, a T cell bispecific antibody (that binds to TYRP1 and CD3) comprises the following polypeptides: polypeptides comprising the sequence of SEQ ID NO:33 (particularly two polypeptides); polypeptides comprising the sequence of SEQ ID NO:31; polypeptides comprising the sequence of SEQ ID NO:32; and polypeptides comprising the sequence of SEQ ID NO:34.

[0197] In a preferred aspect, the T cell bispecific antibody (that binds to TYRP1 and CD3) comprises the following polypeptides: a polypeptide (in particular, two polypeptides) comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:33; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:31; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:32; and a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:35. In some aspects, the T cell bispecific antibody (that binds to TYRP1 and CD3) comprises the following polypeptides: a polypeptide (in particular, two polypeptides) comprising the sequence of SEQ ID NO:33; a polypeptide comprising the sequence of SEQ ID NO:31; a polypeptide comprising the sequence of SEQ ID NO:32; and a polypeptide comprising the sequence of SEQID NO:35.

[0198] Hereinafter, PD-1 axis-binding antagonists useful as immunotherapies in the present invention are further described. In some embodiments, the immunotherapy comprises administration of a PD-1 axis-binding antagonist.

[0199] In some embodiments, the PD-1 axis-binding antagonist is selected from the group consisting of a PD-1-binding antagonist, a PDL1-binding antagonist, and a PDL2-binding antagonist. In some embodiments, the PD-1 axis-binding antagonist is a PD-1-binding antagonist. In some embodiments, the PD-1-binding antagonist inhibits the binding of PD-1 to its ligand-binding partner. In some embodiments, the PD-1-binding antagonist inhibits the binding of PD-1 to PDL1. In some embodiments, the PD-1-binding antagonist inhibits the binding of PD-1 to PDL2. In some embodiments, the PD-1-binding antagonist inhibits the binding of PD-1 to both PDL1 and PDL2. In some embodiments, the PD-1-binding antagonist is an antibody. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody. In some embodiments, the anti-PD-1 antibody is an antibody fragment selected from the group consisting of Fab, Fab'-SH, Fv, scFv, and (Fab')2 fragments. In some embodiments, the PD-1-binding antagonist is ipilimumab, nivolumab, pembrolizumab, pidilizumab, or AMP-224. In a preferred embodiment, the PD-1-binding antagonist is ipilimumab, nivolumab, or pembrolizumab.

[0200] In some embodiments, the PD-1 axis binding antagonist is a PDL1 binding antagonist. In some embodiments, the PDL1 binding antagonist inhibits the binding of PDL1 to PD-1. In some embodiments, the PDL1 binding antagonist inhibits the binding of PDL1 to B7-1. In some embodiments, the PDL1 binding antagonist inhibits the binding of PDL1 to both PD-1 and B7-1. In some embodiments, the PDL1 binding antagonist is an anti-PDL1 antibody. In some embodiments, the anti-PDL1 antibody is a monoclonal antibody. In some embodiments, the anti-PDL1 antibody is an antibody fragment selected from the group consisting of Fab, Fab'-SH, Fv, scFv, and (Fab')2 fragments. In some embodiments, the anti-PDL1 antibody is a humanized antibody or a human antibody. In some embodiments, the PDL1 binding antagonist is atezolizumab, durvalumab, or avelumab. In a preferred embodiment, the PDL1 binding antagonist is atezolizumab.

[0201] In some embodiments, the anti-PDL1 antibody comprises a heavy chain and a light chain, the heavy chain comprising the HVR-H1 sequence of SEQ ID NO:72, the HVR-H2 sequence of SEQ ID NO:73, and the HVR-H3 sequence of SEQ ID NO:74; the light chain comprising the HVR-L1 sequence of SEQ IDNO:75, the HVR-L2 sequence of SEQ ID NO:76, and the HVR-L3 sequence of SEQ ID NO:77. In some embodiments, the anti-PDL1 antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising the amino acid sequence of SEQ ID NO:78, and the light chain variable region comprising the amino acid sequence of SEQ ID NO:79. In some embodiments, the anti-PDL1 antibody comprises a heavy chain and / or a light chain, the heavy chain comprising the amino acid sequence of SEQ ID NO:80, and the light chain comprising the amino acid sequence of SEQ ID NO:81.

[0202] In some embodiments, the PD-1 axis binding antagonist is a PDL2 binding antagonist. In some embodiments, the PDL2 binding antagonist is an antibody. In some embodiments, the anti-PDL2 antibody is a monoclonal antibody. In some embodiments, the anti-PDL2 antibody is an antibody fragment selected from the group consisting of Fab, Fab'-SH, Fv, scFv, and (Fab')2 fragments. In some embodiments, the PDL2 binding antagonist is an immunoadhesin.

[0203] In one embodiment, the cancer is selected from the group consisting of ovarian cancer, lung cancer, breast cancer, kidney cancer, colorectal cancer, and endometrial cancer.

[0204] Described below is adoptive cell transfer, which can be used as an immunotherapy in the present invention. In some embodiments, the immunotherapy includes adoptive cell transfer.

[0205] In some embodiments, adoptive cell transfer includes administering T cells expressing a chimeric antigen receptor (CAR T cells). Those skilled in the art will understand that a CAR is an antigen-targeting receptor that comprises an intracellular T cell signaling domain fused to an extracellular tumor-binding portion (most commonly a single-chain variable fragment (scFv) from a monoclonal antibody).

[0206] The CAR directly recognizes cell surface antigens, independent of MHC-mediated presentation, allowing the use of a single receptor construct against any given antigen in all patients. The initial CARs fused the antigen recognition domain to the CD3 activation chain of the T cell receptor (TCR) complex. While these first-generation CARs induced T cell effector functions in vitro, they were largely limited by poor anti-tumor efficacy in vivo. Subsequent CAR iterations included secondary co-stimulatory signals in tandem with CD3, including the intracellular domain from CD28 or various TNF receptor family molecules such as 4-1BB (CD137) and OX40 (CD134). In addition, third-generation receptors include two co-stimulatory signals in addition to CD3, most commonly CD28 and 4-1BB. Second-generation and third-generation CARs have significantly improved anti-tumor efficacy, inducing complete remission in some patients with advanced cancer in certain cases. In one embodiment, a CAR T cell is an immune-responsive cell modified to express a CAR, which is activated when the CAR binds to its antigen.

[0207] In one embodiment, a CAR T cell is an immune-responsive cell comprising an antigen receptor, which is activated when its receptor binds to its antigen. In one embodiment, the CAR T cells used in the compositions and methods disclosed herein are first-generation CAR T cells. In another embodiment, the CAR T cells used in the compositions and methods disclosed herein are second-generation CAR T cells. In another embodiment, the CAR T cells used in the compositions and methods disclosed herein are third-generation CAR T cells. In another embodiment, the CAR T cells used in the compositions and methods disclosed herein are fourth-generation CAR T cells.

[0208] In some embodiments, adoptive cell transfer involves the administration of T cell receptor (TCR)-modified T cells. Those skilled in the art will understand that TCR-modified T cells can be generated by isolating T cells from tumor tissue and isolating their TCRα and TCRβ chains. These TCRα and TCRβ can be cloned and transfected into T cells isolated from peripheral blood, and then the T cells express TCRα and TCRβ from tumor-recognizing T cells. For example, T cells derived from the OT-1 transgenic mice used in the examples contain transgenic T cell receptors designed to recognize ovalbumin residues 257-264 in the context of H2Kb. Further strategies aim to add or replace the antigen specificity of the native TCR complex. Different methods for achieving this have been described. By adding antibody variable domains to the CD3ε domain of the TCR, a TCR complex with a second antigen specificity can be generated (Nolan et al., Clin. Cancer Res. (1999) 5:3928–3941; Baeuerle et al., Nat. Comms. (2019) 10:2087). This additional specificity can mediate peptide-human leukocyte antigen (pHLA)-independent T cell activation via the TCR complex. Another approach aims to replace the variable α and β domains of the TCR with antibody-derived variable light and variable heavy chain domains (Kuwana et al., Biochem. Biophys. Res. Commun. (1987) 149:960–968; Liu et al., Sci. Transl. Med. (2021) 13:1–16; Mansilla-Soto et al., Nat. Med. (2022) 28:345–352). This is combined with an enzyme-mediated gene knockout of the endogenous TCRα and β chain-encoding genes, resulting in the loss of native T cell specificity and the acquisition of a new antigen specificity of interest.

[0209] In some embodiments, adoptive cell transfer involves the administration of tumor-infiltrating lymphocytes (TILs). In some embodiments, adoptive cell transfer involves the administration of chimeric antigen receptor (CAR)-modified NK cells. Those skilled in the art will understand that CAR-modified NK cells comprise NK cells isolated from a patient or commercially available NK cells engineered to express a CAR that recognizes a tumor-specific protein.

[0210] In some embodiments, adoptive cell transfer involves the administration of dendritic cells.

[0211] Hereinafter, cancer vaccines that can be used as immunotherapies in the present invention are further described.

[0212] In some embodiments, immunotherapy involves the administration of a cancer vaccine.

[0213] Those skilled in the art will understand that cancer vaccines expose the immune system to cancer-specific antigens and adjuvants. In some embodiments, the cancer vaccine is selected from the group consisting of: sipuleucel-T, GVAX, ADXS11-001, ADXS31-001, ADXS31-164, ALVAC-CEA vaccine, AC vaccine, talimogene laherparepvec, BiovaxID, Prostvac, CDX110, CDX1307, CDX1401, CimaVax-EGF, CV9104, DNDN, NeuVax, Ae-37, GRNVAC, tarmogens, GI-4000, GI-6207, GI-6301, ImPACT therapy, IMA901, hepcortespenlisimut-L, Stimuvax, DCVax-L, DCVax-Direct, DCVax prostate, CBLI, Cvac, RGSH4K, SCIB1, NCT01758328, and PVX-410.

[0214] As used herein, "treatment" (and its grammatical variants such as treat or treating) refers to an attempt to alter the natural course of a disease in an individual being treated and can be performed prophylactically or as a clinical intervention during a clinical pathological process. Desired effects of treatment include, but are not limited to, preventing the occurrence or recurrence of disease, alleviating symptoms, attenuating any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, improving or alleviating the disease state, and remitting or improving the prognosis.

[0215] The term "cancer" refers to a physiological condition in a mammal that is typically characterized by unregulated cell proliferation. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More non-limiting examples of cancer include hematological cancers (such as leukemia), bladder cancer, brain cancer, head and neck cancer, pancreatic cancer, bile duct cancer, thyroid cancer, lung cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, endometrial cancer, esophageal cancer, colon cancer, colorectal cancer, rectal cancer, gastric cancer, prostate cancer, skin cancer, squamous cell carcinoma, sarcoma, bone cancer, and kidney cancer. Other cell proliferation disorders include, but are not limited to, tumors located in the following sites: abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testis, ovary, thymus, thyroid), eyes, head and neck, nervous system (central and peripheral nervous systems), lymphatic system, pelvis, skin, soft tissue, spleen, chest, and urogenital system. Also included are pre-cancerous conditions or lesions and cancer metastases.

[0216] In some aspects, the cancer is a cancer expressing a target cell antigen of a T cell bispecific antibody.

[0217] In some aspects, the cancer is a cancer expressing carcinoembryonic antigen (CEA) (particularly in aspects where the target cell antigen of the T cell bispecific antibody is CEA). "CEA-positive cancer" or "cancer expressing CEA" means a cancer characterized by expression or overexpression of CEA on cancer cells. Expression of CEA can be determined, for example, by immunohistochemistry (IHC) or flow cytometry assays. In some aspects, the cancer expresses CEA. In some aspects, as determined by immunohistochemistry (IHC) using an antibody specific for CEA, the cancer expresses CEA in at least 20%, preferably at least 50% or at least 80% of tumor cells.

[0218] In some aspects, the cancer is colon cancer, lung cancer, ovarian cancer, gastric cancer, bladder cancer, pancreatic cancer, endometrial cancer, breast cancer, kidney cancer, esophageal cancer, prostate cancer or other cancers described herein.

[0219] In certain aspects, the cancer is a cancer selected from the group consisting of colorectal cancer, lung cancer, pancreatic cancer, breast cancer and gastric cancer. In a preferred aspect, the cancer is colorectal cancer (CRC). In some aspects, the colorectal cancer is metastatic colorectal cancer (mCRC). In some aspects, the colorectal cancer is microsatellite stable (MSS) colorectal cancer. In some aspects, the colorectal cancer is microsatellite stable metastatic colorectal cancer (MSS mCRC).

[0220] In some aspects, the cancer is a cancer expressing Tyrp1 (particularly in aspects where the target cell antigen of the T cell bispecific antibody is Tyrp1). "Tyrp1-positive cancer" or "cancer expressing Tyrp1" means a cancer characterized by expression or overexpression of Tyrp1 on cancer cells. Expression of Tyrp1 can be determined by, for example, quantitative real-time PCR (measuring Tyrp1 mRNA levels), flow cytometry, immunohistochemistry (IHC) or Western blot assays. In some aspects, the cancer expresses Tyrp1. In some aspects, as determined by immunohistochemistry (IHC) using an antibody specific for Tyrp1, the cancer expresses Tyrp1 in at least 20%, preferably at least 50% or at least 80% of tumor cells. In some aspects, the cancer is selected from the group consisting of: kidney cancer, bladder cancer, skin cancer, lung cancer, colorectal cancer, breast cancer, brain cancer, head and neck cancer and prostate cancer.

[0221] In some aspects, the cancer is an EpCAM-expressing cancer (particularly in aspects where the target cell antigen of the T cell bispecific antibody is EpCAM). "EpCAM-positive cancer" or "EpCAM-expressing cancer" means a cancer characterized by the expression or overexpression of EpCAM on cancer cells. The expression of EpCAM can be determined by, for example, quantitative real-time PCR (measuring EpCAM mRNA levels), flow cytometry, immunohistochemistry (IHC), or Western blot assays. In some aspects, the cancer expresses EpCAM. In some aspects, as determined by immunohistochemistry (IHC) using an antibody specific for EpCAM, the cancer expresses EpCAM in at least 20%, preferably at least 50%, or at least 80% of the tumor cells. In some aspects, the cancer is selected from the group consisting of colorectal cancer, breast cancer, gastric cancer, prostate cancer, ovarian cancer, and lung cancer.

[0222] In some aspects, the cancer is a solid tumor cancer. By "solid tumor cancer" is meant a malignant tumor that forms discrete tumor masses (including also tumor metastases) at specific locations within the patient's body, such as sarcomas or carcinomas (as opposed to, for example, blood cancers such as leukemia, which generally do not form solid tumors). Non-limiting examples of solid tumor cancers include bladder cancer, brain cancer, head and neck cancer, pancreatic cancer, lung cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, endometrial cancer, esophageal cancer, colon cancer, colorectal cancer, rectal cancer, gastric cancer, prostate cancer, skin cancer, squamous cell carcinoma, bone cancer, liver cancer, and kidney cancer. Other solid tumor cancers contemplated in the context of the present invention include, but are not limited to, neoplasms located in the following sites: abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testis, ovary, thymus, thyroid), eye, head and neck, nervous system (central and peripheral nervous systems), lymphatic system, pelvis, skin, soft tissue, muscle, spleen, thoracic region, and urogenital system. Also included are pre-cancerous conditions or lesions and cancer metastases.

[0223] As used herein, "individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (such as cows, sheep, cats, dogs, and horses), primates (such as humans and non-human primates, such as monkeys), rabbits, and rodents (such as mice and rats). In certain aspects, the individual or subject is a human. In some aspects, the individual has a disease, particularly a disease that can be treated or is to be treated by immunotherapy. In some aspects, the individual has cancer, particularly a cancer that can be treated or is to be treated by immunotherapy. In particular, an individual herein is any single human subject who is eligible to receive treatment and who is experiencing or has experienced one or more signs, symptoms, or other indicators of cancer. In some aspects, the individual has cancer or has been diagnosed with cancer, particularly any cancer described above. In some aspects, the individual has locally advanced or metastatic cancer, or has been diagnosed with locally advanced or metastatic cancer. The individual may have been previously treated with immunotherapy or another drug, or may not have been so treated. In certain aspects, the patient has not been previously treated with immunotherapy. Prior to initiating immunotherapy, the patient may have been treated with a therapy that includes one or more drugs other than immunotherapy.

[0224] Preferably, the T cells according to any aspect of the invention are cytotoxic T cells. In some aspects, the T cells are CD4 + or CD8 + T cells. In some aspects, the T cells are CD4 + T cells.

[0225] In some aspects, treatment with immunotherapy or administration of immunotherapy can produce a response in an individual. In some aspects, the response can be a complete response. In some aspects, the response can be a sustained response after treatment cessation. In some aspects, the response can be a complete sustained response after treatment cessation. In other aspects, the response can be a partial response. In some aspects, the response can be a partial sustained response after treatment cessation. In some aspects, treatment with immunotherapy and a UAP1 inhibitor or administration of immunotherapy and a UAP1 inhibitor can improve the response compared to treatment with immunotherapy alone or administration of immunotherapy alone (i.e., without a UAP1 inhibitor). In some aspects, treatment with immunotherapy and a UAP1 inhibitor or administration of immunotherapy and a UAP1 inhibitor can increase the response rate in a patient population compared to a corresponding patient population treated with immunotherapy alone (i.e., without a UAP1 inhibitor).

[0226] Immunotherapy can be used alone or in combination with other agents in a therapy. For example, immunotherapy can be co-administered with at least one additional therapeutic agent. In certain aspects, the additional therapeutic agent is an anti-cancer agent, such as a chemotherapeutic agent, a tumor cell proliferation inhibitor, or a tumor cell apoptosis activator.

[0227] Amino acid sequence

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238] Brief Description of the Drawings

[0239] Figure 1. CRISPR / Cas9 screening for new immunomodulatory targets. (1A) Schematic diagram of the screening process. (1B) Volcano plot showing enrichment (LogFC > 1) and depletion (LogFC < -1) in the comparison between CEA TCB and DP47 control TCB. Significant hits: P value < 0.05.

[0240] Figure 2. Validation of UAP1 knockout. (2A) Western blot samples of MKN45 wt and UAP1 knockout cells, probed for UAP1 expression and using vinculin as a loading control. (2B) LC-MS analysis of UDP-HExNAc levels in MKN45 wt and UAP1 knockout cells. The graph shows mean ± SEM. P values were calculated using a two-tailed unpaired Student's t-test. *P < 0.05, **P < 0.01

[0241] Figure 3. Tumor-intrinsic UAP1 regulates TCB-mediated cytotoxicity in vitro. T cell-mediated killing assay. UAP1 knockout cells and wt cells were used against (3A) MKN45 when using CEA-TCB, (3B) MKN45 when using EpCAM-TCB, (3C) A549 when using CEA-TCB, and (3D) B16F10 when using Tyrp1-TCB, and the cell count of tumor cells over time in the incucyte was measured. The graphs show mean ± SEM. P values were calculated using a two-tailed paired Student's t-test. *P < 0.05, **P < 0.01

[0242] Figure 4 . Tumor-intrinsic UAP1 regulates antigen-specific T cell-mediated cytotoxicity in vitro. Tumor cell killing by antigen-specific T cells. B16F10 wt and UAP1 KO cells were pulsed with SIINFEKL peptide and co-cultured with OT-1 T cells. Depicted is the tumor cell count over time collected using an incucyte machine. The graphs show mean ± SEM. P values were calculated using a two-tailed paired Student's t-test. *P < 0.05, **P < 0.01

[0243] Figure 5. UAP1 expression in cancer cells affects T cell activation. Shown is the T cell activation status after co-culture with tumor cells within a certain range of TCB concentrations. The expression of CD25 and CD69 of T cells from co-culture with (5A) MKN45 when using CEA TCB, (5B) MKN45 when using EPCAM TCB, and (5C) A549 when using CEA TCB was analyzed by FACS. The graphs show mean ± SEM. P values were calculated using a two-tailed paired Student's t-test. *P < 0.05, **P < 0.01

[0244] Figure 6 . UAP1 expression in cancer cells affects T cell proliferation. T cell proliferation after co-culture of T cells with tumor cells in the presence of TCB. MKN45 wt and UAP1 KO cells were co-cultured with CFSE-labeled T cells in the presence of CEA TCB. The CFSE fluorescence intensity, as a surrogate for proliferation, was measured by FACS.

[0245] Figure 7. Ablation of UAP1 sensitizes B16F10 tumors to immunotherapy. (7A) Tumor volumes of B16F10 wt and UAP1-depleted cells treated with vehicle control or Tyrp1 TCB in immunocompetent C57BL / 6 mice. Tumor volumes were measured every other day using calipers. n = 10 mice per group. (7B) Ratio of tumor volumes over time for the TCB therapy group and vehicle control group for both B16F10 wt and UAP1 tumors. Two-way ANOVA statistical analysis was performed using Graphpad Prism software.

[0246] Figure 8. Ablation of UAP1 sensitizes MKN45 tumors to immunotherapy. (8A) Tumor growth curves of MKN45 wt and UAP1 KO cells in stem cell humanized NSG mice (huNSG). Animals were given vehicle control, 0.2 mg / kg or 0.4 mg / kg CEA-TCB. The time point of the first administration was day 15 as shown. Tumor volumes were measured using calipers. n = 10 mice per group. (8B) Ratio of tumor volumes for the TCB therapy group and vehicle control group at each time point after the first TCB treatment. (8C) Tumor growth curves of individual mice. Two-way ANOVA statistical analysis was performed using Graphpad Prism software.

[0247] Figure 9. UAP1 inhibition with Ac4Glc2Bz in tumor cells improves T cell-mediated killing and T cell activation. (9A) Detection of UDP-HexNAc in MKN45 cell lysates after treatment with Ac4Glc2Bz for 2 hours. (9B) MKN45 was pretreated with the indicated concentrations of Ac4Glc2Bz for 2 hours. Then, the compound was removed from the culture, and T cells were added together with the indicated concentration of TCB. The graph shows the percentage (%) of remaining tumor cells after 105 hours of co-culture. DP47TCB was used as a negative control. (9C) Flow cytometry of CD3+ T cells from the experiment in (B). T cell activation was evaluated as described previously.

[0248] Figure 10. Rescue experiment. (10A) Real-time live-cell microscopy for evaluating T cell-mediated killing. Three UAP1 isoforms were re-introduced into A549-hCEA-NLR UAP1 KO clones. Then, in the presence of cetuximab at the indicated concentrations, tumor cells were co-cultured with PBMCs from healthy donors and incubated in an Incucyte instrument. Specific lysis was calculated by counting the remaining red fluorescence intensity from tumor cells and subsequently normalizing to the DP47 control TCB. Wt and UAP1 KO cells were used as reference controls. (10B) Tumor and T cell co-culture was performed as in (A). After 5 days of incubation, T cell activation was evaluated by measuring the percentage (%) of CD25 and / or CD69 in CD3+ T cells by FACS. Graphs show mean ± SEM. P values were calculated using a two-tailed paired Student's t test. *P < 0.05, **P < 0.01

[0249] Figure 11. Cytokine detection assay. MKN45-NLR wt or UAP1 KO were co-cultured in the presence of different concentrations of cetuximab. After 72 hours, the indicated cytokines were measured via ELISA.

[0250] Figure 12. At 32 days after tumor injection, a scout was performed for intratumoral T cell activation marker analysis. An increased expression of the T cell activation / exhaustion marker Tim3 was observed in CD8 + and CD4 + T cells from UAP1 KO transplanted mice, but not in wt transplanted mice. Data were obtained using flow cytometry. P values were calculated using a two-tailed paired Student's t test. *P < 0.05, **P < 0.01

[0251] Figure 13. (13A) KPC WT or UAP1 KO tumor cells were transplanted into the mammary fat pads of immunocompetent C57BL / 6 mice. Tumor volume was measured 3 times a week using calipers (n = 10 / group). (13B) Growth curves from individual mice relative to (13A). (13C) Statistical analysis relative to (13A). Bar graphs show TGI at day 38. P values were calculated using the Dunn test. (13D) At 42 days after tumor injection, a scout was performed to measure the intratumoral abundance of CD8 + and CD4 + T cells. Data were obtained using flow cytometry and normalized to tumor weight. (13E) Tumor growth curves of KPC wt or UAP1 KO tumor cells subcutaneously injected into the flanks of NSG mice (n = 6). Data show mean ± SEM.

[0252] Figure 14. Partial UAP1 KO results in substantial depletion of hyaluronic acid (HA) in tumor cells. HA levels in MKN45 wt or UAP1 KO tumor cells were determined via ELISA. Representative data from 2 independent experiments. Plots show mean ± SEM. P values were calculated using two-tailed paired Student's t test. *P < 0.05, **P < 0.01.

[0253] Figure 15. UAP1 KO does not impair T cell function. (15A) T cells were polyclonally activated and subsequently electroporated with UAP1-specific gRNA:rCas9 RNP. KO efficiency was evaluated as described previously. (15B) Wt or UAP1 KO T cells were used as effectors in a T cell-mediated killing assay using MKN45-NLR as target cells and different concentrations of cetuximab as indicated. Data were measured using real-time live cell imaging and normalized to DP47 control TCB. (15C) Wt or UAP1 KO T cells were co-cultured as in (15A) and then CD25 and CD69 expression was evaluated by flow cytometry. (15D) Wt or UAP1 KO T cells were activated using dynabeads at different bead:T cell ratios. Then, T cell activation (CD25 + and / or CD69 + ) was measured by flow cytometry.

[0254] Examples

[0255] The following are examples of the methods and compositions of the present invention. It should be understood that various other aspects can be practiced given the general description provided above.

[0256] Example 1. Method

[0257] 1.1 CRISPR / Cas9 Screening for New Cancer Immunotherapy Targets

[0258] The human gastric adenocarcinoma cell line MKN45 was transduced with lentiviral particles encoding the Cas9 gene from Staphylococcus aureus (Cellecta - catalog number SVC9 - PS) at a multiplicity of infection (MOI) of 3 for bats and selected with 5 μg / ml blasticidin. After selection, the cells were transduced with a three - module single - guide (sg) RNA library (catalog numbers KOHGW - M1, KOHGW - M2, and KOHGW - M3) at an MOI of 0.3. The cells were selected with 0.5 μg / ml puromycin for one week. Next, the tumor cells were co - cultured with three different PBMCs from healthy donors in the presence of CEA TCB (final concentration = 400 pM) or CEA TCB (final concentration = 10 pM) or DP47 negative control TCB (final concentration = 400 pM). On the day of co - culture setup, the library coverage was 200 - fold, and the experiments were performed using biological replicates. After incubation at 37 °C and 5% CO2 for 72 hours, the T cells were removed and the tumor cells were harvested for DNA isolation. Genomic DNA isolation was performed using the NucleoBond AXG 500 column (Macherey - Nagel), and then the samples were subjected to two rounds of PCR using the NGS Prep kit for the sgRNA library in pRSG16 / 17 (KOHGW - Cellecta - catalog number LNGS120). The samples were sequenced on an Illumina HiSeq4000 sequencer with dual indexing according to the manufacturer's instructions.

[0259] Data analysis was performed as follows: The demultiplexed reads were mapped to the gRNA library using STAR (v 2.7.9a), allowing zero mismatches, and sgRNA counts were estimated from the bam file using Samtools. The counts were filtered and normalized using quantile normalization (using all sgRNAs, regardless of their type: control or targeting). The count matrix between conditions was compared in the following three contrasts: CEA TCB versus DP47 control TCB and CEA TCB versus DP47 control TCB. The fold - change for each gene and gRNA was calculated using MAGeCK (Lit et al. 2015) and the traditional differential gene expression analysis (voom - limma approach Law et al. 2014) applied to the sgRNA counts, and combined with enrichment tests to aggregate gene - level p - values (Ritchie et al. 2016). Genes were reported to be significantly depleted and enriched with a threshold p - value < 0.05 and absolute logFC > 1.

[0260] 1.2.1 Generation of UAP1 Knockout (KO) Cells:

[0261] UAP1 KO cells were generated by electroporating recombinant Cas9 and UAP1-specific gRNA ribonucleoprotein (RNP) complexes using 4D-Nucleofector (Lonza). For tumor cells, 200,000 MKN45 or A549 hCEA cells were resuspended in 20 μl of SF solution (Lonza) and incubated with RNP made from 10 μg Cas9 (TrueCut - Thermo Scientific) and 300 pmol of a 1:1 UAP1-specific tracrRNA( CRISPR-Cas9 tracrRNA):crRNA (ACGAACCCTACAGAACCAGTTGG) complex. Then, the cells were nucleofected using the nucleofection program DS137 according to the manufacturer's instructions and incubated for at least 72 h to ensure successful protein KO. UAP1 KO in T cells was obtained by pre-activating T cells from healthy donors with CD3 / 28 / 2 tetramers (Stemcell) for 24 h and then subjecting them to nucleofection as described above using 4 × 10^6 cells in 20 μl of P3 solution (Lonza) and the nucleofection program EO115. Similar to human tumor cells, B16 mouse melanoma cells were nucleofected using Uap1 - mouse cRNA (GAAAAGGTGGACGCACGAA) and the nucleofection program EN138.

[0262] 1.2.2 Generation of Isotype-Specific Overexpression Cell Lines

[0263] Single cell clones were obtained from A549 hCEA UAP1 KO cells. Then, a complete UAP1 KO clone was selected to re-introduce different UAP1 isoforms: AGX1, AGX2, or isoform 3. Isoform re-introduction was achieved via viral transduction.

[0264] 1.3 Western Blot

[0265] Harvest 3 × 10 6MKN45 wt or UAP1 KO, and the cell pellet was lysed in one volume of RIPA buffer containing protease inhibitor (Roche - catalog number 04693132001) for 20 minutes at 4°C. Then, the cell lysate was centrifuged at 10000 x g for 15 minutes at 4°C. The supernatant was collected in a new vial, and the protein concentration was determined by BCA assay (Thermo Scientific - catalog number 23225). 30 μg of protein lysate was loaded onto a 4 - 20% precast protein gel (Biorad - catalog number 4561094) and run by SDS - PAGE electrophoresis method (Biorad). Then, the protein was transferred onto a PVDF membrane using the Trans - Blot Turbo Transfer System (Biorad - catalog number 17001919). The following primary antibodies were used for blotting: anti - human UAP1 antibody (Sigma - aldrich - catalog number HPA0146459), anti - vinculin antibody (CST - catalog number 18799S), and anti - rabbit IgG, HRP - linked antibody (CST - catalog number 7074). The membrane was incubated with Clarity Western ECL substrate (Biorad - catalog number 1705060), and the image was acquired using Gel Doc XR+ (Biorad).

[0266] 1.4 LC-MS Detection of UDP-HexNAc

[0267] Preparation of standard solutions:

[0268] To prepare calibration samples, uridine - 5'-diphosphate - N - acetylglucosamine sodium salt was dissolved in an 80 / 20 mixture of water / methanol (v / v) to a concentration of 1.00 mg / ml. Stock solutions for preparing QC samples were prepared separately using the same procedure, and the reference substances were weighed separately. Further dilutions were made in water. For calibration and quality control samples, eight and three different concentrations of uridine - 5'-diphosphate - N - acetylglucosamine (UDP HExNAc) were added to phosphate - buffered saline (PBS), respectively. Two different calibration ranges were applied. For the high calibration range, the concentrations were in the range of 100 to 50000 ng / mL (calibration samples were 100, 200, 500, 2500, 12500, 25000, 37500, and 50000 ng / mL, and QC samples were 300, 2500, and 37500 ng / mL). In the low calibration range, the concentrations were in the range of 5.00 to 5000 ng / mL (calibration samples were 5.00, 10.0, 25.0, 100, 500, 2500, 3750, and 5000 ng / mL, and QC samples were 15.0, 2500, and 3750 ng / mL).

[0269] Sample preparation:

[0270] The stem cell pellet was reconstituted by adding 500 L of PBS and then sonicated for 5 minutes. After centrifugation at 4000 g and 8 °C for 10 minutes, the supernatant was collected.

[0271] Sample handling within the high calibration range:

[0272] To 20.0 L of the supernatant or an aliquot of the calibration / QC sample, 200 L of acetonitrile containing an internal standard (guanosine-5-diphosphate glucose, 250 ng / mL) was added. After vortexing for a few seconds, the sample was centrifuged at 30000 g and 8 °C for 10 minutes. An aliquot of 200 L of the supernatant was transferred to an autosampler vial and diluted with 200 L of water. During analysis, the sample was stored at 8 °C in the autosampler tray. An aliquot of 5 L of the sample was injected into the HPLC-MS / MS system.

[0273] Sample handling within the low calibration range (batch 4):

[0274] To 20.0 L of the supernatant or an aliquot of the calibration / QC sample, 100 L of acetonitrile containing an internal standard (guanosine-5-diphosphate glucose, 10.0 ng / mL) was added. After vortexing for a few seconds, the sample was centrifuged at 30000 g and 8 °C for 10 minutes. An aliquot of 100 L of the supernatant was transferred to an autosampler vial. During analysis, the sample was stored at 8 °C in the autosampler tray. An aliquot of 50 L of the sample was injected into the HPLC-MS / MS system.

[0275] Liquid chromatography and column switching:

[0276] For the high calibration range, the method was as follows. HPLC was performed using a binary Agilent 1290 pump (Agilent Technologies Inc, Santa Clara, CA, USA) and a PAL autosampler equipped with a cooling tower (CTC Analytics, Zwingen, Switzerland). The mobile phase for analytical separation consisted of water containing 10 mM ammonium acetate and 0.5% formic acid (solvent A) and acetonitrile / 2-propanol 80 / 20 (v / v) containing 0.5% formic acid (solvent B). The HILIC column (HILICON iHilic Fusion, 5 m, 20 x 2.1 mm) was maintained at 40 °C and equilibrated with 95% solvent B at a flow rate of 0.5 mL / min. After 0.5 minutes, a linear gradient was increased from 95% B to 25% B within 1.5 minutes and held at 25% B for 0.2 minutes. The linear gradient was increased to 5% B within 0.1 minute and held for 1.7 minutes. For the run time from 4.1 to 5 minutes, the column was re-equilibrated with 95% solvent B.

[0277] For the low calibration range, the method is as follows. Two-dimensional HPLC is performed using binary pumps Agilent 1200 and Agilent 1290 pumps (Agilent Technologies Inc, Santa Clara, CA, USA) and a PAL autosampler equipped with a switching valve and a cooling tower (CTC Analytics, Zwingen, Switzerland). For trapping, the binary pump Agilent 1200 is used. The mobile phase for trapping consists of water containing 10 mM ammonium acetate and 0.5% formic acid (solvent A) and acetonitrile / 2-propanol 80 / 20 (v / v) containing 0.5% formic acid (solvent B). The sample is loaded onto the trapping column at a flow rate of 1.0 mL / min with 100% solvent B for 0.5 minutes. After 0.5 minutes, the trapping column is switched to the analytical flow. After 3 minutes, the trapping column is switched to the trapping flow for washing.

[0278] The binary mobile phase for analytical separation consists of water containing 10 mM ammonium acetate and 0.5% formic acid (solvent A) and acetonitrile / 2-propanol 80 / 20 (v / v) containing 0.5% formic acid (solvent B). The HILIC column (HILICON iHilic Fusion, 5 μm, 20 x 2.1 mm) is maintained at 40 °C and equilibrated with 95% solvent B at a flow rate of 0.5 mL / min. After 0.5 minutes, a linear gradient is increased from 95% B to 25% B in 1.5 minutes and held at 25% B for 0.2 minutes. The linear gradient is increased to 5% B in 0.1 minutes and held for 1.7 minutes. For the run time from 4.1 to 5 minutes, the column is re-equilibrated with 95% solvent B.

[0279] Mass spectrometry:

[0280] Quantification is performed using a Sciex Triple Quad6500+ instrument (ABSciex, Concord, Canada) equipped with a Turbo V source operating in positive ion mode. The source temperature is set to 300 °C and a spray voltage of 5500 V is used. The mass transition for UDP-HexNAc is from 608.1 m / z to 204.0 m / z, and the mass transition for the internal standard GDP-glucose is from 606.1 m / z to 152.2 m / z.

[0281] Materials:

[0282] Acetonitrile, methanol, and 2-propanol were purchased from Fisher Scientific Ltd. (Loughborough, UK). Uridine-5'-diphosphate-N-acetylglucosamine sodium salt, guanosine-5-diphosphate glucose, formic acid, and phosphate buffered saline were purchased from Sigma-Aldrich GmbH, Buchs, Switzerland.

[0283] Determination of protein concentration:

[0284] Protein concentration was determined by spectrophotometric quantification after staining with bicinchoninic acid (BCA). PBS (Sigma-Aldrich GmbH, Buchs, Switzerland) was used as a diluent, and a calibration curve was prepared with bovine serum albumin (BSA, Pierce, Illinois, USA) in the range of 50.0 to 2000 μg / mL.

[0285] 10 μL aliquots of the supernatant or calibration / QC samples were mixed with 80 μL of BCA working reagent, which was prepared by mixing 50 parts of reagent A with 1 part of reagent B (BCA kit, Pierce, Illinois, USA) in a microtiter 96-well plate. After incubation at 37 °C for 30 minutes, the absorbance at 562 nm was measured using a Spectramax i3 (Molecular Devices, CA, USA). The standard curve was prepared by plotting the absorbance of the calibrators against the concentration using a 4-parameter fit. The concentration of the unknown samples was determined by interpolating the absorbance into the calibration curve. Evaluation was performed using Softmax Pro GxP (Molecular Devices, CA, USA).

[0286] 1.5 T Cell-Mediated Cytotoxicity Assay

[0287] 25,000 MKN45-nuclight red (NLR), 20,000 A549-hCEA, and 10,000 B16F10-NLR tumor cells (wt or UAP1 ko) were seeded into one well of a 96-well plate. Then, TCB or siinfekl was administered at the indicated concentrations. Pan T cells or PBMCs, mouse splenocytes (from C57 / BL6 or OT-I mice) were added immediately at the indicated E:T ratios. The co-cultures were incubated in an Incucye S3 instrument (Sartorius) at 37 °C and 5% CO2 for the indicated time. Images were acquired every 3 hours. For MKN45-NLR and B16F10-NLR, T cell-mediated killing was calculated based on the red fluorescence signal from the tumor cells.. First, all values were converted to fold change at time 0, and the percentage of specific lysis was calculated as follows:

[0288] 100 – [(Red fluorescence count TCB / Red fluorescence count control TCB) x 100]

[0289] For A549-hCEA, the cytotox-green reagent (sartorius) was added to the co-culture at a 1:16,000 dilution, and T cell-mediated killing was evaluated by measuring the green fluorescence count in each well. First, all values were converted to fold change relative to time 0, and then the percentage of normalized green signal was calculated as follows: [(Green fluorescence count TCB / Green fluorescence count control TCB) x 100]. For antigen-specific experiments, B16F10-NLRwt and UAP1 KO cells were pulsed with SIINFEKL peptide and co-cultured with OT-1 T cells. T cell-mediated killing was measured as described above.

[0290] 1.6 Flow Cytometry

[0291] T cell-mediated killing assays were performed as described above. At the end of the experiment, T cells were collected from the co-culture plates and subjected to immunofluorescence staining for the following markers: CD3, CD8, CD25, CD69, and near-infrared live / dead staining (Thermo Scientific). Cells were gated on live CD3 + cells, and the percentage of activated cells was calculated as follows: 100 - (% CD25 + + % CD69 + cells). For proliferation assays, T cells were pre-stained with CFSE (Biolegend) according to the manufacturer's instructions and then used in T cell-mediated killing assays with MKN45-NLR wt or MKN45-NLR KO cells for 4 days. Then, the cells were harvested and CFSE was evaluated by FACS.

[0292] 1.7 In Vivo Studies

[0293] Animals:

[0294] Immunocompetent C57BL / 6J and NOD.Cg-PrkdcscidIL-2rgtm1Wjl / SzJ (NSG) mice were obtained from Charles River Laboratories. All animal studies were conducted in accordance with international FELASA and national GV-Solas and TierSchG guidelines, under local government ethical approval and regulations in Switzerland (permit ZH183 / 2020). After arrival, the animals were maintained for one week to acclimatize to the new environment and observed. The mice were maintained under specific pathogen-free conditions, with a 12-hour light / 12-hour dark cycle daily. Continuous health status monitoring was performed daily. The mice were housed under standardized conditions and had free access to water and food. For humanization, NSG mice were injected with busulfan (15 mg / kg), and 24 hours later, with human CD34+ cord blood cells (1x10 5 per mouse; STEMCELL Technologies), as previously described (PMID: 33330050). Before tumor cell inoculation, the human T cell frequency of humanized mice was screened by flow cytometry, and only mice with more than 20% huCD45+ cells were randomly assigned to different treatment groups.

[0295] Study design:

[0296] B16F10 and MKN45 wtl as well as UAP1 KO cells were trypsinized, washed, and resuspended in a 1:1 mixture of tissue culture medium and Matrigel, with a total volume of 100 μl. B16F10 (0.5x10 6 ) and MKN45 (1x10 6 ) cells were injected subcutaneously (s.c.) into the flanks of the mice. Tumors were measured twice a week, and tumor volume (mm3) was determined using the formula 0.5 × length × width2. MKN45 tumor-bearing mice with a tumor size of 100 - 200 mm3 were randomly divided into 4 groups: 1) NSG (n = 6), 2) humanized mice huNSG (n = 11) received intravenous (i.v.) injection of vehicle (n = 11), 3 - 4) huNSG (n = 12) received weekly intravenous (i.v.) injection of 0.2 and 0.4 mg / kg CEA-TCB. B16F10 tumor-bearing mice with a tumor size of 100 - 150 mm3 were randomly divided into three groups: 1) NSG (n = 6), 2) C57BL / 6J (n = 10) received intravenous (i.v.) injection of vehicle, 3) C57BL / 6J (n = 10) received weekly intravenous (i.v.) injection of Tyrp1-TCB 5 mg / kg.

[0297] All mice were injected i.v. with 200 μl of the appropriate solution. Mice in the vehicle group were injected i.v. with histidine buffer (20 mM histidine, 140 mM NaCl, pH 6.0) and mice in the treatment group were injected with the antibody diluted to a volume of 200 μl with histidine buffer.

[0298] For some examples, KPC (0.3 x 106) wt and KO cells were injected into the mammary fat pads of C57 / BL6 mice, similar to the above B16F10 and MKN45 cells.

[0299] Statistical analysis:

[0300] Results are presented as mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism software v.7.04 (GraphPad Software Inc.). Two-way ANOVA test was used. A P-value less than 0.05 was considered statistically significant.

[0301] Tumor growth inhibition (TGI) for each group and time point was calculated as follows

[0302] 100 - mean (TV treatment [day x] - TV treatment [baseline]) / mean (TV reference [day x] - TV reference [baseline])

[0303] Example 2. CRISPR screening for cancer immunotherapy in tumor cells

[0304] A knockout CRISPR screen was established in the context of immunotherapy to identify mechanisms of resistance to immune cell attack in cancer cells (Figure 1). Briefly, the human gastric adenocarcinoma / cancer cell line MKN45 was transduced with Cas9 and a genome-wide sgRNA library. The selected cells were co-cultured with isolated PBMCs from healthy donors for 4 days in the presence of a T cell-engaging antibody targeting the tumor antigen CEACAM5 or an isotype control antibody. After this stage, the T cells were washed away and the remaining tumor cells were collected for DNA isolation. The composition of the remaining sgRNAs in the cell pool was detected by next-generation sequencing. sgRNAs significantly depleted in the group using cetuximab (CEA TCB) compared to the control TCB antibody were followed up in dedicated validation experiments. UAP1 was identified as one of the top hits from this screen.

[0305] Example 3. Knockout generation and in vitro model validation

[0306] To validate UAP1, MKN45-NLR cells were subjected to UAP1 KO as described above. The knockout was confirmed at the protein level ( Figure 2A ), and was also confirmed by a reduction in the enzymatic product UDP-HexNAc in cell lysates (Figure 2B )。Next, the KO cell line was subjected to the same killing assay conditions as described for the screening. MKN45 cells lacking UAP1 were killed more effectively compared to wt cells, indicating a higher susceptibility to TCB-mediated T cell cytotoxicity( Figure 3A ). The same effect was observed when using a TCB targeting EpCAM instead of CEACAM5( Figure 3B ). Conversion of the cell line to the human lung adenocarcinoma cell line A549 resulted in the same phenotype. A549 UAP1 KO cells were killed more effectively than A549 wt cells in a CEA-TCB-dependent manner( Figure 3C ). Consistent with the results, murine B16F10 melanoma cells lacking UAP1 were killed more effectively by T cells when conjugated with Tyrp1-TCB compared to B16F10 wt cells( Figure 3D ). The B16F10 model can be used in an antigen-specific setting to mimic the endogenous immune response of T cells to immunogenic antigens in the context of MHC-I. wt or UAP1-deficient B16F10 cells were pulsed with the model antigen peptide SIINFEKL and co-cultured with T cells derived from OT-1 transgenic mice. These T cells carry a transgenic T cell receptor that recognizes the H2kb-SIINFEKL complex. Similar to the TCB-mediated killing assay, UAP1-deficient cells were more susceptible to T cell cytotoxicity( Figure 4 ).

[0307] Next, the activation status of T cells co-cultured with wt or UAP1 KO cells was evaluated. For all cells tested (three cell lines), at similar TCB concentrations, T cells co-cultured with UAP1 KO cancer cells expressed higher levels of the early activation markers CD25 and CD69 compared to wt( Figures 5A to 5C ). Consistent with these results, T cells co-cultured with UAP1 KO had a higher proliferation rate compared to the wt counterparts of these cells( Figure 6 ).

[0308] It was also found that T cells co-cultured with UAP1 KO secreted more IFN-γ, TNF-α, and granzyme B (Figure 16).

[0309] These data indicate that UAP1 expression in cancer cells serves as a resistance mechanism to anti-cancer immune responses triggered by T cell-engaging antibodies or by the endogenous immune response.

[0310] Example 4. Validation in a tumor-bearing animal model

[0311] Next, the role of UAP1 was explored in a tumor-bearing mouse model in the context of TCB-induced immune responses. First, wt or UAP1-deficient B16F10 melanoma cells were transplanted into C57BL / 6 mice and treated with a TCB vehicle control targeting the melanoma antigen Tyrp1, and tumor volume was tracked over time. The growth rate of B16F10 UAP1 KO cells was much slower relative to its vehicle group compared to its wt counterpart ( Figure 7A ). The ratio of TCB-treated tumor volume to vehicle-treated tumor volume showed a significant reduction in UAP1 KO cells compared to wt cells ( Figure 7B ).

[0312] The stem cell-humanized mouse model provides an elegant way to mimic a part of the human immune system in a living model organism. Briefly, bone marrow-depleted NSG mice received hematopoietic stem cell transplantation from umbilical cord blood. The transplanted stem cells reconstituted the bone marrow and developed into human T cells and B cells. Combining the humanized mice with xenografts (human gastric adenocarcinoma cell line MKN45) provided a model to test the effect of UAP1 expression on tumor growth in vivo. Thus, MKN45 wt cells or UAP1 KO cells were transplanted into stem cell-humanized NSG mice and treated with vehicle control, low-dose TCB targeting the tumor antigen CEACAM5, or high-dose TCB treatment. For both the low-dose and high-dose groups, longitudinal tumor volume measurements highlighted better tumor control of TCB treatment on UAP1 KO cells relative to the vehicle group compared to wt cells ( Figure 8A and Figure 8C ). Quantifying the ratio of treated to vehicle tumor volume for the high-dose group showed a significant reduction in tumor volume when UAP1 was knocked out compared to wt ( Figure 8B ). Figure 8D and Figure 8E show the individual tumor volumes measured over time within the treatment groups, corresponding to the mean values shown in Figure 8A and Figure 8B .

[0313] In addition, in the presence of CEACAM5xCD5 TCB, increased expression of activation / exhaustion markers was observed in the UAP1 KO group but not in wt cells, indicating higher T cell activation in UAP1 KO tumors compared to controls (Figure 17). To demonstrate independent efficacy, UAP1 was knocked out in the KPC pancreatic ductal adenocarcinoma cell line and injected into the mammary fat pad of C57 / BL6 mice without immunotherapy. Data showed a significant increase in tumor growth inhibition in the UAP1 KO group compared to wt (Figures 18A to 18C). Additionally, UAP1 KO tumors showed increased infiltration of both CD8 + and CD4 + T cells (Figure 18D). To confirm that the observed effect was due to the involvement of the endogenous murine immune system, the experiment was repeated in NSG immunodeficient mice. In this mouse model, UAP1 KO did not improve tumor growth inhibition (Figure 18E).

[0314] Collectively, these data are consistent with the results from the screening and in vitro validation experiments. When UAP1 is knocked out in tumor cells, the effect of enhanced anti-tumor immunity is translated into the in vivo settings of both syngeneic and stem cell humanized xenograft models.

[0315] Example 5. Pharmacological inhibition of UAP1 in tumor cells recapitulates the effects observed by gene knockout.

[0316] To evaluate the effect of UAP1 pharmacological inhibition on modulating T cell function, MKN45 was pretreated with the Ac4Glc2Bz tool compound for 2 hours. LC-MS for detecting UDP-HexNAc confirmed dose-dependent inhibition of UAP1 ( Figure 9A ). Then, UAP1-inhibited MKN45 cells were co-cultured with T cells and TCB. Consistent with the UAP1 KO experiment, UAP1 inhibition led to increased T cell-mediated killing ( Figure 9B and 9C ) and T cell activation ( Figure 9D and 9E ).

[0317] Example 6. UAP1 is a positive regulator of hyaluronic acid (HA), an immunosuppressive glycosaminoglycan (GAG).

[0318] Given the key role of UAP1 in regulating multiple glycosylation-related processes in cells, the expression of HA was evaluated as this GAG has been reported to confer immune resistance to tumor cells. UAP1 KO led to a significant decrease in HA in both the supernatant and cell lysates of MKN45 tumor cells ( Figure 14 ).

[0319] Example 7. UAP1 depletion does not impair T cell function

[0320] To demonstrate that potential UAP1 inhibitor compounds only affect tumor cells and do not affect T cell function, we depleted UAP1 on T cells and evaluated its impact on their function in different ways. Notably, UAP1 KO neither impairs T cell-mediated killing nor T cell activation( Figures 15A to 15D ).

[0321] ***

[0322] Although the present invention has been described in considerable detail by way of illustration and example for purposes of clarity of understanding, such description and examples should not be construed as limiting the scope of the invention. The disclosures of all patents and scientific literature cited herein are hereby expressly incorporated by reference in their entirety.

Claims

1. An inhibitor of UDP-N-acetylhexosamine pyrophosphorylase (UAP1) for use in the treatment or prevention of cancer in an individual, wherein the treatment comprises (a) administering to the individual an inhibitor of UAP1, and (b) administering to the individual an immunotherapy.

2. A method for treating or preventing cancer in an individual, wherein the method comprises (a) administering to the individual an inhibitor of UDP-N-acetylhexosamine pyrophosphorylase (UAP1), and (b) administering to the individual an immunotherapy.

3. Use of an inhibitor of UDP-N-acetylhexosamine pyrophosphorylase (UAP1) in the manufacture of a medicament for treating cancer in an individual, wherein the treatment comprises (a) administering to the individual an inhibitor of UAP1, and (b) administering to the individual an immunotherapy.

4. An immunotherapy for use in the treatment of a disease in an individual, wherein the treatment comprises (a) administering to the individual the immunotherapy, and (b) administering to the individual an inhibitor of UDP-N-acetylhexosamine pyrophosphorylase (UAP1).

5. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the immunotherapy comprises adoptive cell transfer, administration of a monoclonal antibody, administration of a cytokine, administration of a cancer vaccine, T cell engager therapy, administration of a PD-1 axis-binding antagonist, or any combination thereof.

6. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein administration of the UAP1 inhibitor causes (i) an increase in the activity of the immunotherapy, (ii) an increase in the activation of T cells (induced by the immunotherapy), (iii) an increase in the proliferation of T cells (induced by the immunotherapy), (iv) an increase in the cytotoxic activity of T cells (induced by the immunotherapy), (v) an increase in T cell receptor signaling in T cells (induced by the immunotherapy), (vi) an increase in early activation markers (such as CD25 and / or CD69) in T cells (induced by the immunotherapy), (vii) an increase in cytokine secretion by T cells (induced by the immunotherapy), particularly wherein the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α and IFN-γ; and / or (viii) an increase in the secretion of lytic effector molecules by T cells (induced by the immunotherapy), particularly wherein the lytic effector molecule is granzyme-B or perforin; Optionally wherein the T cells are CD8+ T cells or CD4+ cells.

7. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein administration of the UAP1 inhibitor causes an increase in the level of one or more cytokines in the individual, particularly wherein the one or more cytokines are selected from the group consisting of IL-2, TNF-α and IFN-γ.

8. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the administration of the UAP1 inhibitor is (i) before the administration of the immunotherapy, simultaneous with the administration of the immunotherapy or after the administration of the immunotherapy, (ii) intermittent or continuous, and / or (iii) oral.

9. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the UAP1 inhibitor is administered in a dose sufficient to cause: (i) an increase in the activity of the immunotherapy, (ii) an increase in the activation of T cells (induced by the immunotherapy), (iii) an increase in the proliferation of T cells (induced by the immunotherapy), (iv) an increase in the cytotoxic activity of T cells (induced by the immunotherapy), (v) an increase in T cell receptor signaling in T cells (induced by the immunotherapy), (vi) an increase in early activation markers (such as CD25 and / or CD69) in T cells (induced by the immunotherapy), (vii) an increase in cytokine secretion by T cells (induced by the immunotherapy), particularly wherein the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α and IFN-γ; and / or (viii) an increase in the secretion of lytic effector molecules by T cells (induced by the immunotherapy), particularly wherein the lytic effector molecule is granzyme-B or perforin; Optionally, wherein the T cells are CD8+ T cells or CD4+ cells.

10. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the UAP1 inhibitor is administered in a dose sufficient to cause an increase in the level of one or more cytokines in the individual, optionally wherein the level of one or more cytokines is measured in the serum or tumor biopsy of the individual.

11. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the UAP1 inhibitor is administered in an effective dose.

12. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the UAP1 inhibitor is administered in a dose of (i) about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1000 mg or more, or (ii) between about 1 mg and about 10 g, between about 10 mg and about 5000 mg, between about 50 mg and about 2000 mg or between about 100 mg and about 1000 mg.

13. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the administration of the UAP1 inhibitor is associated with a first administration of the immunotherapy and is optionally carried out before, simultaneously with or after the first administration of the immunotherapy.

14. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the administration of the immunotherapy (i) is at an effective dose, and / or (ii) is parenteral administration, particularly intravenous administration.

15. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the immunotherapy (administration) induces (i) an increase in T cell activation, (ii) an increase in T cell proliferation, (iii) an increase in T cell cytotoxic activity, (iv) an increase in T cell receptor signaling in T cells, (v) an increase in early activation markers (such as CD25 and / or CD69) in T cells, (vi) an increase in cytokine secretion by T cells, particularly wherein the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α and IFN-γ; and / or (vii) an increase in the secretion of lytic effector molecules by T cells, particularly wherein the lytic effector molecule is granzyme-B or perforin; Optionally, wherein the T cells are CD8+ T cells or CD4+ cells.

16. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the immunotherapy is a T cell bispecific antibody, wherein the T cell bispecific antibody binds to CD3 and a target cell antigen.

17. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the immunotherapy is a T cell bispecific antibody, wherein the T cell bispecific antibody comprises an antigen-binding portion that binds to CD3 and an antigen-binding portion that binds to a target cell antigen.

18. The UAP1 inhibitor, immunotherapy, use or method according to claim 16 or 17, wherein the target cell antigen is carcinoembryonic antigen (CEA).

19. The UAP1 inhibitor, immunotherapy, use or method according to claim 18, wherein the T cell bispecific antibody comprises (i) a first antigen-binding portion that binds to CD3 and comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprising heavy chain CDR (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11 and HCDR3 of SEQ ID NO:12, and the light chain variable region comprising light chain CDR (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17 and LCDR3 of SEQ ID NO:18; and (ii) A second antigen-binding portion that binds to CEA and comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO:36, HCDR2 of SEQ ID NO:37, and HCDR3 of SEQ ID NO:38, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO:39, LCDR2 of SEQ ID NO:40, and LCDR3 of SEQ ID NO:

41.

20. The UAP1 inhibitor, immunotherapy, use, or method according to claim 18 or 19, wherein the T cell bispecific antibody comprises: a third antigen-binding portion that binds to CEA and / or an Fc domain comprising a first subunit and a second subunit.

21. The UAP1 inhibitor, immunotherapy, use, or method according to any one of claims 18 to 20, wherein the T cell bispecific antibody comprises (i) A first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18, wherein the first antigen-binding portion is a cross-Fab molecule in which the variable or constant regions of the Fab light chain and the Fab heavy chain are exchanged; (ii) A second antigen-binding portion and a third antigen-binding portion that bind to CEA, the second antigen-binding portion and the third antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO:36, HCDR2 of SEQ ID NO:37, and HCDR3 of SEQ ID NO:38, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO:39, LCDR2 of SEQ ID NO:40, and LCDR3 of SEQ ID NO:41; wherein the second antigen-binding portion and the third antigen-binding portion are each a Fab molecule, particularly a conventional Fab molecule; (iii) An Fc domain that comprises a first subunit and a second subunit, wherein the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, and the first antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain, and wherein the third antigen-binding portion is fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.

22. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 18 to 21, wherein the first antigen-binding portion of the T cell bispecific antibody comprises a heavy chain variable region sequence and a light chain variable region sequence, the heavy chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19, and / or the second antigen-binding portion and (if present) the third antigen-binding portion of the T cell bispecific antibody comprise a heavy chain variable region sequence and a light chain variable region sequence, the heavy chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, and the light chain variable region sequence is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

19.

23. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 18 to 22, wherein the Fc domain of the T cell bispecific antibody comprises a modification that promotes the association of the first subunit and the second subunit of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector functions.

24. The UAP1 inhibitor, immunotherapy, use or method according to any one of the preceding claims, wherein the immunotherapy is cetuximab.

25. The UAP1 inhibitor, immunotherapy, use or method according to claim 16 or 17, wherein the target cell antigen is epithelial cell adhesion molecule (EpCAM).

26. The UAP1 inhibitor, immunotherapy, use or method according to claim 25, wherein the T cell bispecific antibody comprises (i) a first antigen-binding portion that binds to CD3 and comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises heavy chain CDR (HCDR) 1 of SEQ ID NO: 9, HCDR2 of SEQ ID NO: 11, and HCDR3 of SEQ ID NO: 12, and the light chain variable region comprises light chain CDR (LCDR) 1 of SEQ ID NO: 16, LCDR2 of SEQ ID NO: 17, and LCDR3 of SEQ ID NO: 18; and (ii) A second antigen-binding portion that binds to EpCAM and comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain complementarity-determining region (HCDR) 1 of SEQ ID NO:60, HCDR2 of SEQ ID NO:61, and HCDR3 of SEQ ID NO:62, and the light-chain variable region comprises light-chain complementarity-determining region (LCDR) 1 of SEQ ID NO:63, LCDR2 of SEQ ID NO:64, and LCDR3 of SEQ ID NO:

65.

27. The UAP1 inhibitor, immunotherapy, use, or method according to claim 25 or 26, wherein the T cell bispecific antibody comprises: a third antigen-binding portion that binds to EpCAM and / or an Fc domain comprising a first subunit and a second subunit.

28. The UAP1 inhibitor, immunotherapy, use, or method according to any one of claims 25 to 27, wherein the T cell bispecific antibody comprises (i) A first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain complementarity-determining region (HCDR) 1 of SEQ ID NO:9, HCDR2 of SEQ ID NO:11, and HCDR3 of SEQ ID NO:12, and the light-chain variable region comprises light-chain complementarity-determining region (LCDR) 1 of SEQ ID NO:16, LCDR2 of SEQ ID NO:17, and LCDR3 of SEQ ID NO:18, wherein the first antigen-binding portion is a crossed Fab molecule in which the variable or constant regions of the Fab light chain and the Fab heavy chain are exchanged; (ii) A second antigen-binding portion and a third antigen-binding portion that bind to EpCAM, the second antigen-binding portion and the third antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain complementarity-determining region (HCDR) 1 of SEQ ID NO:60, HCDR2 of SEQ ID NO:61, and HCDR3 of SEQ ID NO:62, and the light-chain variable region comprises light-chain complementarity-determining region (LCDR) 1 of SEQ ID NO:63, LCDR2 of SEQ ID NO:64, and LCDR3 of SEQ ID NO:65, wherein the second antigen-binding portion and the third antigen-binding portion are each a Fab molecule, particularly a conventional Fab molecule; (iii) An Fc domain that comprises a first subunit and a second subunit, wherein the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, and the first antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain, and wherein the third antigen-binding portion is fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.

29. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 25 to 28, wherein the first antigen-binding portion of the T cell bispecific antibody comprises a heavy chain variable region sequence and a light chain variable region sequence, the heavy chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, the light chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19, and / or the second antigen-binding portion and (if present) the third antigen-binding portion of the T cell bispecific antibody comprise a heavy chain variable region sequence and a light chain variable region sequence, the heavy chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 66, the light chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

67.

30. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 25 to 29, wherein the first antigen-binding portion of the T cell bispecific antibody is a cross-Fab molecule, wherein the variable regions of the Fab light chain and the Fab heavy chain are exchanged, and wherein the second antigen-binding portion and (if present) the third antigen-binding portion of the T cell bispecific antibody are conventional Fab molecules, wherein in the constant domain CL, the amino acid at position 124 is independently substituted with lysine (K), arginine (R) or histidine (H) (according to Kabat numbering) and the amino acid at position 123 is independently substituted with lysine (K), arginine (R) or histidine (H) (according to Kabat numbering), and in the constant domain CH1, the amino acid at position 147 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering) and the amino acid at position 213 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

31. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 25 to 30, wherein the Fc domain of the T cell bispecific antibody comprises a modification that promotes the association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector functions.

32. The UAP1 inhibitor, immunotherapy, use or method according to claim 16 or 17, wherein the target cell antigen is tyrosinase-related protein 1 (TYRP1).

33. The UAP1 inhibitor, immunotherapy, use or method according to claim 32, wherein the T cell bispecific antibody comprises (i) A first antigen-binding portion that binds to CD3 and comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO: 10, HCDR2 of SEQ ID NO: 11, and HCDR3 of SEQ ID NO: 13, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO: 16, LCDR2 of SEQ ID NO: 17, and LCDR3 of SEQ ID NO: 18; and (ii) A second antigen-binding portion that binds to TYRP1 and comprises a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO: 23, HCDR2 of SEQ ID NO: 24, and HCDR3 of SEQ ID NO: 25, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO: 27, LCDR2 of SEQ ID NO: 28, and LCDR3 of SEQ ID NO:

29.

34. The UAP1 inhibitor, immunotherapy, use or method according to claim 32 or 33, wherein the T cell bispecific antibody comprises: a third antigen-binding portion that binds to TYRP1 and / or an Fc domain comprising a first subunit and a second subunit.

35. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 32 to 34, wherein the T cell bispecific antibody comprises (i) A first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, wherein the heavy-chain variable region comprises heavy-chain CDR (HCDR) 1 of SEQ ID NO: 10, HCDR2 of SEQ ID NO: 11, and HCDR3 of SEQ ID NO: 13, and the light-chain variable region comprises light-chain CDR (LCDR) 1 of SEQ ID NO: 16, LCDR2 of SEQ ID NO: 17, and LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding portion is a cross-Fab molecule in which the variable or constant regions of the Fab light chain and the Fab heavy chain are exchanged; (ii) A second antigen-binding portion and a third antigen-binding portion that bind to TYRP1, the second antigen-binding portion and the third antigen-binding portion comprising a heavy-chain variable region and a light-chain variable region, the heavy-chain variable region comprising heavy-chain CDR (HCDR) 1 of SEQ ID NO: 23, HCDR2 of SEQ ID NO: 24, and HCDR3 of SEQ ID NO: 25, and the light-chain variable region comprising light-chain CDR (LCDR) 1 of SEQ ID NO: 27, LCDR2 of SEQ ID NO: 28, and LCDR3 of SEQ ID NO: 29, wherein the second antigen-binding portion and the third antigen-binding portion are each a Fab molecule, particularly a conventional Fab molecule; (iii) An Fc domain, the Fc domain comprising a first subunit and a second subunit, wherein the second antigen-binding portion is fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain, and the first antigen-binding portion is fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain, and wherein the third antigen-binding portion is fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.

36. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 32 to 35, wherein the first antigen-binding portion of the T cell bispecific antibody comprises a heavy-chain variable region sequence and a light-chain variable region sequence, the heavy-chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 15, the light-chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19, and / or the second antigen-binding portion and (where present) the third antigen-binding portion of the T cell bispecific antibody comprise a heavy-chain variable region sequence and a light-chain variable region sequence, the heavy-chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 26, the light-chain variable region sequence being at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

30.

37. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 32 to 36, wherein the first antigen-binding portion of the T cell bispecific antibody is a cross-Fab molecule, wherein the variable regions of the Fab light chain and the Fab heavy chain are exchanged, and wherein the second antigen-binding portion of the T cell bispecific antibody and (if present) the third antigen-binding portion are conventional Fab molecules, wherein in the constant domain CL, the amino acid at position 124 is independently substituted with lysine (K), arginine (R) or histidine (H) (according to Kabat numbering) and the amino acid at position 123 is independently substituted with lysine (K), arginine (R) or histidine (H) (according to Kabat numbering), and in the constant domain CH1, the amino acid at position 147 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering) and the amino acid at position 213 is independently substituted with glutamic acid (E) or aspartic acid (D) (according to Kabat EU index numbering).

38. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 32 to 37, wherein the Fc domain of the T cell bispecific antibody comprises a modification that promotes the association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector functions.

39. The UAP1 inhibitor, immunotherapy, use or method according to claim 16 or 17, wherein the target cell antigen is a peptide presented on MHC class I molecules.

40. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 15, wherein the immunotherapy is a PD-1 axis-binding antagonist.

41. The UAP1 inhibitor, immunotherapy, use or method according to claim 40, wherein the PD-1 axis-binding antagonist is selected from the group consisting of PD-1-binding antagonists, PDL1-binding antagonists and PDL2-binding antagonists.

42. The UAP1 inhibitor, immunotherapy, use or method according to claim 40, wherein the PD-1 axis-binding antagonist is a PD-1-binding antagonist, wherein the PD-1-binding antagonist (i) inhibits the binding of PD-1 to its ligand-binding partner, (ii) inhibits the binding of PD-1 to PDL1, (iii) inhibits the binding of PD-1 to PDL2, (iv) inhibits the binding of PD-1 to both PDL1 and PDL2, and / or (v) is an anti-PD-1 antibody, particularly a monoclonal anti-PD-1 antibody.

43. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 15 or 40 to 42, wherein the immunotherapy is selected from the group consisting of ipilimumab, nivolumab and pembrolizumab.

44. The UAP1 inhibitor, immunotherapy, use or method according to claim 40, wherein the PD-1 axis binding antagonist is a PDL1 binding antagonist, and wherein the PDL1 binding antagonist (i) inhibits the binding of PDL1 to PD-1, (ii) inhibits the binding of PDL1 to B7-1, (iii) inhibits the binding of PDL1 to both PD-1 and B7-1, and / or (iv) is an anti-PDL1 antibody, particularly a monoclonal anti-PDL1 antibody.

45. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 15, 40 or 44, wherein the immunotherapy is selected from the group consisting of atezolizumab, durvalumab or avelumab.

46. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 15, wherein the immunotherapy comprises adoptive cell transfer.

47. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 15 or 46, wherein the immunotherapy comprises administering T cells expressing a chimeric antigen receptor (CAR T cells), T cell receptor (TCR)-modified T cells, tumor infiltrating lymphocytes (TILs), chimeric antigen receptor (CAR)-modified natural killer cells, TCR-transduced cells, or dendritic cells, or any combination thereof.

48. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 15, wherein the immunotherapy comprises administering a cancer vaccine.

49. The UAP1 inhibitor, T cell-based therapy, use or method according to any one of claims 1 to 24, wherein the cancer (i) is a cancer expressing carcinoembryonic antigen (CEA), and / or (ii) is selected from the group consisting of colorectal cancer, lung cancer, pancreatic cancer, breast cancer and gastric cancer.

50. The UAP1 inhibitor, T cell-based therapy, use or method according to any one of claims 1 to 17 or 25 to 31, wherein the cancer (i) is a cancer expressing epithelial cell adhesion molecule (EpCAM), and / or (ii) is selected from the group consisting of colorectal cancer, breast cancer, gastric cancer, prostate cancer, ovarian cancer and lung cancer.

51. The UAP1 inhibitor, T cell-based therapy, use or method according to any one of claims 1 to 17 or 32 to 38, wherein the cancer is (i) a cancer expressing tyrosinase-related protein 1 (TYRP1), and / or (ii) melanoma.

52. The present invention as described above.

Citation Information

Patent Citations

  • Bispecific and oligospecific, mono- and oligovalent receptors, production and applications thereof

    EP0404097A2

  • Recombinant antibodies specific for a growth factor receptor

    US5571894A

  • Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof

    US5587458A

  • Method for making heteromultimeric polypeptides

    US5731168A

  • Altered polypeptides with increased half-life

    US5869046A