Branched lipid compositions, lipid nanoparticles (lnps) including same, and methods of use thereof

Abstract

The present disclosure provides a modified immune cell, or a precursor thereof, comprising a chimeric antigen receptor and a surface-bound bioinert molecule. The disclosure also includes methods of making the modified immune cells, and methods of treating CAR therapy associated toxicity in a subject in need thereof, including the modified immune cells.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 373,793, filed on August 29, 2022, under 35 U.S.C.§119(e), the entire content of which is incorporated herein by reference.

[0003] Statement Regarding Federally Sponsored Research or Development

[0004] This disclosure was made with government support under Project TR002776 awarded by the National Institutes of Health. The government has certain rights in this disclosure.

[0005] Sequence Listing

[0006] An XML file named "046483 - 7399WO1 - SequenceListing.xml", created on August 24, 2023, with a size of 3,800 bytes, the entire content of which is incorporated herein by reference. Background of the Invention

[0007] In recent years, messenger RNA (mRNA), as a transient intermediate between genes and proteins, has emerged as a promising new approach for therapeutic applications, including protein replacement therapy, vaccines, and gene editing. However, mRNA degrades rapidly and is not easily able to cross cell membranes due to its large size and negative charge. Thus, the use of cargoes such as mRNA therapies (e.g., DNA, RNA, small molecules, and / or polypeptides) requires safe, effective, and stable delivery systems to prevent degradation and allow cellular uptake and function.

[0008] Accordingly, there is a need in the art for lipid nanoparticles (LNPs) suitable for delivering cargo to a target, ionizable lipids for their preparation, and methods of using such lipid nanoparticles. This disclosure addresses these needs. Summary of the Invention

[0009] In one aspect, the present disclosure provides certain branched ionizable lipid (IL) compounds, methods for their preparation, lipid nanoparticles (LNPs) comprising such compounds, and methods for their use in delivering cargo (e.g., mRNA).

[0010] In one aspect, the present disclosure provides a compound of formula (I) or a salt, solvate, stereoisomer, or isotopologue thereof, wherein R 1a , R 1b , R 2a , R 2b , R 2c , R 2d , R 2e , R2f , R 2g and R 2h are defined elsewhere in this document:

[0011]

[0012] In another aspect, the present disclosure provides lipid nanoparticle (LNP) compositions comprising at least one ionizable lipid compound of formula (I), or a salt, solvate, stereoisomer or isotopic configurational isomer thereof. In certain embodiments, the LNP comprises at least one neutral lipid. In certain embodiments, the LNP comprises cholesterol. In certain embodiments, the LNP comprises at least one conjugated lipid. In certain embodiments, the LNP further comprises at least one cargo molecule.

[0013] In another aspect, the present disclosure provides pharmaceutical compositions comprising at least one LNP of the present disclosure and a pharmaceutically acceptable carrier.

[0014] In another aspect, the present disclosure provides a method of treating, preventing, and / or ameliorating a disease in a subject. In certain embodiments, the method comprises administering to the subject at least one lipid nanoparticle (LNP) of the present disclosure and / or at least one pharmaceutical composition of the present disclosure.

[0015] In another aspect, the present disclosure provides a method of delivering a nucleic acid or therapeutic agent to the liver of a subject. In certain embodiments, the method comprises administering to the subject at least one lipid nanoparticle (LNP) of the present disclosure and / or at least one pharmaceutical composition disclosed herein.

[0016] In another aspect, the present disclosure provides a method of preparing a modified immune cell or a precursor thereof. In certain embodiments, the method comprises contacting an immune cell or a precursor thereof with at least one lipid nanoparticle (LNP) of the present disclosure and / or at least one pharmaceutical composition of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The drawings generally illustrate, by way of example and not limitation, various embodiments of the present application.

[0018] Figure 1 Depicts a non-limiting embodiment of the synthesis of an epoxide intermediate for preparing the ionizable lipid compositions of the present disclosure.

[0019] Figure 2A - 2B Depicts a non-limiting embodiment of synthesizing the ionizable lipid compositions of the present disclosure by attaching exemplary polyamine cores to an exemplary epoxide substrate S N 2.

[0020] Figure 3A - 3H: In vitro and in vivo fluc mRNA delivery of LNPs, the LNPs comprising exemplary linear and branched LNPs prepared from polyamine cores 494. Figure 3A - 3B : First, HeLa cells were cultured with LNPs having 494 cores IL and encapsulating fluc mRNA at 20 ng of mRNA per 20,000 cells. After 24 h, luminescence ( Figure 3A ) and cell viability ( Figure 3B ) were evaluated. Normalized luciferase expression was reported as the mean ± SEM of n = 3 biological replicates, averaged from each of n = 4 technical replicates. The percentage of cell viability was normalized to untreated cells and reported as the mean ± SEM of n = 3 biological replicates, averaged from each of n = 3 technical replicates. Figure 3C - 3F : LNPs of 0.1 mg / kg mRNA were injected intravenously into C57BL / 6J. After 12 h, whole-body luminescence ( Figure 3C ) and images ( Figure 3D ) were obtained by IVIS. Then the mice were sacrificed, and organ luminescence ( Figure 3E ) and images ( Figure 3F ) were collected by IVIS. The total flux was reported as the mean ± SEM of n = 3. Two-way ANOVA with Holm- corrected post hoc Student’s t-test for multiple comparisons was used to compare the normalized luciferase expression ( Figure 3A ) across branched groups and linker lengths. One-way ANOVA with Holm- corrected post hoc Student's t-test for multiple comparisons was used to compare the cell viability ( Figure 3C ) of treated and untreated groups or the total flux of the treated groups to C12-200 ( Figure 3C and Figure 3E ). *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001.

[0021] Figure 4A - 4E : In vitro and in vivo fluc mRNA delivery of LNPs, the LNPs comprising exemplary linear and branched LNPs prepared from polyamine cores 200. Figure 4A - 4B : First, HeLa cells were incubated with exemplary linear and branched LNPs having 200 cores IL encapsulating fluc mRNA at 20 ng of mRNA per 20,000 cells. After 24 h, luminescence ( Figure 4A ) and cell viability ( Figure 4B)。Normalized luciferase expression is represented as the mean ± SEM of n = 3 biological replicates, averaged from each of n = 4 technical replicates. Percent cell viability was normalized to untreated cells and reported as the mean ± SEM of n = 3 biological replicates, averaged from each of n = 3 technical replicates. Figure 4C - 4E : C57BL / J mice were intravenously injected with 0.1 mg / kg of LNP of mRNA. After 12 h, whole-body luminescence was obtained by IVIS ( Figure 4C ). Then the mice were sacrificed, and organ luminescence ( Figure 4D ) and images ( Figure 4E ) were collected by IVIS. Total flux is represented as the mean ± SEM of n = 3. Two-way ANOVA with Holm- corrected post hoc Student’s t-test for multiple comparisons was used to compare normalized luciferase expression across branched groups and linker lengths ( Figure 4A ). One-way ANOVA with Holm- corrected post hoc Student's t-test for multiple comparisons was used to compare cell viability between treated and untreated groups ( Figure 4B ) or total flux from the treated group to C12-200 ( Figure 4C -D). *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001.

[0022] Figure 5A - 5D Bar graphs are provided depicting combined organ (i.e., liver, spleen, lung, kidney, and heart) luminescence data for Black 6 mice administered exemplary LNPs of the present disclosure compared to selected controls (e.g., LNPs including C8, C12, and / or MC3 ionizable lipids), including LNPs comprising ionizable lipids prepared using polyamine core 494 ( Figure 5A ) and polyamine core 200 ( Figure 5B ), wherein the LNP comprises TriLink luciferase mRNA encapsulated therein. Figure 5C - 5D Magnified images of the data in Figure 5A - 5B are provided, respectively, to show data for organs other than the liver (i.e., heart, kidney, lung, and spleen).

[0023] Figure 6A - 6C : Hepatic TTR knockout was analyzed for 8 exemplary LNPs comprising ionizable lipids prepared with polyamine core 200. The LNPs were reconstituted with Cas9 mRNA and TTR single guide RNA (sgRNA). Mice were injected at a dose of 1.0 mg of combined RNA per kg body weight ( Figure 6A ). After 7 days, blood was drawn and serum TTR levels were measured by serum ELISA before injection ( Figure 6B)。In addition, the liver was extracted and indels were measured by next-generation sequencing. Overall, branched LNPs appear to significantly enhance Cas9-mediated gene editing( Figure 6C )。

[0024] Figure 7A - 7N : Analysis of the physicochemical properties, morphology, and stability of certain exemplary LNPs including unbranched and branched ILs. In vivo liver luminescence and hydrodynamic diameter of 8 exemplary LNPs including linear and branched ILs prepared from polyamine core 200 were plotted and fitted using cubic least squares regression( Figure 7A ), PDI( Figure 7B ), ζ potential( Figure 7C ), pK a ( Figure 7D ), encapsulation efficiency( Figure 7E ), and HeLa cell luminescence( Figure 7F ). Figure 7G -J: Cryo-TEM images of C8-200( Figure 7G ), E4i-200( Figure 7H ), E4t-200( Figure 7I ), and E4s-200( Figure 7J ). Figure 7K - 7N : Hydrodynamic diameter and PDI were measured hourly for 24 h immediately after incubation at 37 °C in 1X PBS( Figure 7K - 7H ) or DMEM supplemented with 10% FBS( Figure 7M - 7N ) to evaluate the stability of 8 exemplary LNPs including ILs prepared from polyamine core 200.

[0025] Figure 8A - 8G : Exemplary data of LNPs including branched and linear ILs in the liver and artificial endosomes. C57BL / 6J mice were injected intravenously with 1.0 mg clodronate. After 24 h, the mice were injected intravenously with 8 exemplary LNPs including ILs prepared from polyamine core 200, where the LNPs further included 0.1 mg / kg dose of fluc mRNA. Figure 8A : Mice were sacrificed and dissected after 36 h in total, and liver luminescence was measured by IVIS. Total flux is expressed as mean ± SEM for n = 3. Four exemplary LNPs containing fluc mRNA( Figure 8B ) were injected intravenously into apolipoprotein E (APOE)-knockout mice at a dose of 0.1 mg / kg. Mice were sacrificed and dissected after 12 h, and liver luminescence was measured by IVIS. Total flux is expressed as mean ± SEM for n = 3. Figure 8C - 8D : C57BL / 6J mice were injected with 8 200-core LNPs containing 1 mol% DiR. After 12 h, the mice were sacrificed and organ fluorescence was collectedFigure 8C ) and the image ( Figure 8D ). The overall radiation efficiency is expressed as the mean ± SEM at n = 3. Figure 8F - 8G : Eight exemplary representative LNPs were mixed with artificial endosomes containing a FRET pair. After mixing, the percentage of endosomal disruption was measured by examining the increase in donor fluorescence at several time points. Compared with linear LNPs, branched LNPs significantly increased endosomal disruption (endosomal molar ratio: DOPS (25%), DOPC (25%), DOPE (48%), NBD-PE (1%), and Rho-PE (1%)).

[0026] Figure 9A - 9B : Exemplary toxicity ( Figure 9A ) and luciferase expression ( Figure 9B ) data in CAL-27 cells administered with certain exemplary LNPs of the present disclosure comprising luciferase mRNA. The LNPs were incubated with luciferase mRNA and treated on cells at a dose of 20 ng of mRNA per 20,000 cells. After 24 h, luciferase assays and cell viability assays were performed separately to analyze luciferase expression and toxicity.

[0027] Figure 10A - 10B : Exemplary tumor luminescence data using a CAL-27 tumor-induced mouse model, in which certain exemplary LNPs of the present disclosure comprising luciferase were administered. One million CAL-27 cells were inoculated on the right side of Nu / J mice. After two weeks of tumor growth, five LNPs encapsulating luciferase mRNA, including two branched LNPs and three linear LNPs, including C12-200, were injected into the tumor at a dose of 0.1 mg / kg. PBS was injected into a group as a control. After 6 h, the mice were sacrificed and the major organs and tumors were imaged to obtain luminescence data.

[0028] Figure 11A - 11D : Exemplary survival rate data of certain squamous cell carcinoma cell lines administered with the exemplary LNPs of the present disclosure, which LNPs comprise human p53 mRNA and / or luciferase mRNA. CAL-27 cells ( Figure 11A - 11B ) and OECM-1 cells ( Figure 11C - 11D ) were treated with E10i-494 LNPs encapsulating human p53 mRNA or luciferase mRNA. The cells were administered at different intervals and the overall survival rate was measured using a cytotoxicity assay at 24 h ( Figure 11A and 11C ) and 48 h ( Figure 11B and 11D ).

[0029] Figure 12A - 12BDepicts the initial potency assessment of exemplary LNPs of the present disclosure by measuring relative luminescence ( Figure 12A ) and viability ( Figure 12B ) in induced pluripotent stem cells (iPSC-SV20) after 24 h, where the exemplary LNPs include 20 ng luciferase mRNA per 15,000 cells.

[0030] Figure 13A - 13B Depicts the dose escalation study of exemplary LNPs of the present disclosure, which include luciferase mRNA in iPSC-SV20 cells, where luminescence ( Figure 13A ) and viability ( Figure 13B ) are measured as a function of the mRNA dose (e.g., 20, 50, 100, 200, 400, and 600 ng / well).

[0031] Figure 14A - 14H : Exemplary data show that induced pluripotent stem cells (iPSC-SV20) are successfully transfected with mCherry mRNA cargo by administering exemplary LNPs of the present disclosure. A total of 90,000 iPSC-SV20 cells are placed in a 24-well plate overnight until they reach 50% confluence. They are treated with different concentrations of exemplary LNPs of the present disclosure and harvested after 24 h. Flow cytometry is performed to measure the percentage of successfully transfected cells ( Figure 14A - 14F ). The cells are further imaged by fluorescence microscopy to show the mCherry signal ( Figure 14G - 14H ).

[0032] Figure 15A - 15H Provides an exemplary fluorescence-activated cell sorting (FACS) flow cytometry plot of induced pluripotent stem cells (iPSC) transfected with mCherry mRNA, where a non-limiting exemplary LNP of the present disclosure (E4i-200) comprising mCherry mRNA cargo is administered. A total of 50,000 iPSCs are placed in a 24-well plate overnight and then 366 ng of mCherrymRNA encapsulated in E4i-200 LNPs ( Figure 15E - 15H ) or in a control ( Figure 15A - 15D ) is administered. Cells are harvested after 24 h ( Figure 15A and 15E ), 48 h ( Figure 15B and 15F ), 72 h ( Figure 15C and 15G ) and 96 h ( Figure 15D and 15H ).

[0033] Figure 16A - 16BBar graphs are provided depicting the relative luminescence data ( Figure 16A ) and viability data ( Figure 16B ) of activated primary T cells (1:1 CD4+:CD8+) from healthy human donors compared to a selected control group (e.g., LNPs containing C8, C12, and / or MC3 ionizable lipids), where the cells were incubated with exemplary LNPs of the present disclosure for 24 h, including LNPs comprising an IL prepared using polyamine core 494 and polyamine core 200, wherein the LNP includes luciferase mRNA encapsulated therein (200 ng luciferase mRNA per 60,000 cells).

[0034] Figure 17A - 17B Bar graphs are provided depicting the relative luminescence data ( Figure 17A ) and viability data ( Figure 17B ) of activated primary T cells (1:1 CD4+:CD8+) from healthy human donors, where the cells were incubated with exemplary LNPs of the present disclosure for 24 h, wherein the LNP includes luciferase mRNA encapsulated therein (200 ng luciferase mRNA per 60,000 cells), and wherein the ratio of ionizable lipid:DOPE:cholesterol:C14PEG 2000 for all LNPs is 40:30:25:2.5.

[0035] Figure 18 A bar graph is provided depicting the relative luminescence data of NK-92MI cells (i.e., immortalized human NK cells that self-express IL-2) incubated with certain exemplary LNPs of the present disclosure for 24 h compared to a control group, wherein the LNP includes luciferase mRNA. Detailed Description

[0036] Reference will now be made in detail to certain embodiments of the disclosed subject matter, examples of which are illustrated in part in the accompanying drawings. While the disclosed subject matter will be described in conjunction with the recited claims, it should be understood that the illustrated subject matter is not intended to limit the claims to the disclosed subject matter.

[0037] In this document, values expressed in a range format should be interpreted in a flexible manner, including not only the explicitly recited numerical values that are range limits, but also all individual numerical values or sub-ranges included within that range as if each numerical value and sub-range were explicitly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include not only about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and sub-ranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. Unless otherwise specified, the expression "about X to Y" has the same meaning as "about X to about Y". Similarly, unless otherwise specified, the expression "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z".

[0038] In this document, unless the context clearly dictates otherwise, the terms "a", "an", or "the" are used to include one or more. Unless otherwise specified, the term "or" is used to refer to a non-exclusive "or". The expressions "at least one of A and B" or "at least one of A or B" have the same meaning as "A, B, or A and B". Additionally, it should be understood that the wording or terms used herein (not otherwise defined) are for descriptive purposes only and not limiting. The use of any section headings is for the purpose of assisting in reading the document and should not be construed as limiting; the information related to a section heading may appear within or outside of that particular section. The entire contents of all publications, patents, and patent documents cited in this document are hereby incorporated by reference as if individually incorporated by reference herein.

[0039] In the methods described herein, the acts may be performed in any order, unless a time or operational sequence is explicitly stated. Additionally, particular acts may be performed simultaneously, unless express claim language states that they may be performed separately. For example, the claimed act of doing X and the claimed act of doing Y may be performed simultaneously in a single operation, and the resulting process will fall within the literal scope of the claimed method.

[0040] Description

[0041] Lipid nanoparticles (LNPs) have emerged as excellent drug delivery carriers for mRNA therapeutics. A major factor for the success of LNPs over previous lipid-based particles is the shift from permanently cationic lipids that can induce substantial toxicity to ionizable lipids (ILs) that are cationic only under low pH conditions. Considerable efforts have been devoted to optimizing the IL structure, which consists of an amine core conjugated to long lipid tails, as small molecule modifications can lead to drastic changes in the overall efficacy of the resulting LNPs.

[0042] In one aspect, the present disclosure relates to the design and evaluation of LNPs comprising ionizable lipids, the ionizable lipids comprising lipid tails with terminal branching. Simple and modular synthetic schemes were developed for the exemplary lipids described herein, which enable facile tuning of the length and terminal branching. Additionally, the present disclosure describes the application of this synthetic scheme for preparing non-limiting ILs using certain exemplary polyamine cores.

[0043] In one aspect, the present disclosure relates to the observation that lipid branching significantly increases liver transfection compared to non-branched lipids, which includes in gene editing models. Additionally, using a series of experiments involving physicochemical evaluation and hepatocyte targeting, it was determined that lipid branching induces stronger mRNA endosomal escape.

[0044] The present disclosure further provides non-limiting exemplary applications of the LNPs comprising branched ILs described herein, which include mRNA delivery for mRNA therapy, liver gene editing, stem cell reprogramming, and CAR T and / or CAR NK cell therapies.

[0045] Definitions

[0046] As used herein, the term “about” may allow for a degree of variability in a value or range, e.g., within 10%, within 5%, or within 1% of the stated limit of the value or range, and includes the exact stated value or range.

[0047] As used herein, the term “acyl” refers to a group containing a carbonyl moiety, wherein the group is bonded through the carbonyl carbon atom. The carbonyl carbon atom is bonded to a hydrogen atom to form a “formyl” group, or to another carbon atom, which can be part of an alkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, heterocyclic, heterocycloalkyl, heteroaryl, heteroarylalkyl, etc. The acyl group can include from 0 to about 12, 0 to about 20, or 0 to about 40 additional carbon atoms bonded to the carbonyl. The acyl group can include double or triple bonds within the meaning herein. Acryloyl is an example of an acyl group. The acyl group can also include heteroatoms within the meaning herein. Nicotinoyl (pyridin-3-carbonyl) is an example of an acyl group within the meaning herein. Other examples include acetyl, benzoyl, phenylacetyl, pyridylacetyl, cinnamoyl, and acryloyl, among others. When the group containing a carbon atom bonded to the carbonyl carbon atom contains a halogen, the group is referred to as a “haloacyl”. An example is trifluoroacetyl.

[0048] As used herein, the term “adjuvant” is defined as any molecule that enhances an antigen-specific adaptive immune response.

[0049] As used herein, the term "alkenyl" refers to straight-chain, branched-chain, and cycloalkyl groups as defined herein, except that there is at least one double bond between two carbon atoms. Thus, alkenyl groups have from 2 to 40 carbon atoms, or from 2 to about 20 carbon atoms or from 2 to 12 carbon atoms, or in some embodiments from 2 to 8 carbon atoms. Examples include, but are not limited to, vinyl, -CH=C=CCH2, -CH=CH(CH3), -CH=C(CH3)2, -C(CH3)=CH2, -C(CH3)=CH(CH3), -C(CH2CH3)=CH2-, cyclohexenyl, cyclopentenyl, cyclohexadienyl, butadienyl, pentadienyl, and hexadienyl, etc.

[0050] As used herein, the term "alkoxy" refers to an oxygen atom attached to an alkyl group, which includes cycloalkyl groups as defined herein. Examples of linear alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, pentyloxy, hexyloxy, and the like. Examples of branched alkoxy groups include, but are not limited to, isopropoxy, sec-butoxy, tert-butoxy, isopentyloxy, isohexyloxy, and the like. Examples of cycloalkoxy groups include, but are not limited to, cyclopropoxy, cyclobutoxy, cyclopentyloxy, cyclohexyloxy, and the like. An alkoxy group may include from about 1 to about 12, from about 1 to about 20, or from about 1 to about 40 carbon atoms bonded to the oxygen atom, and may further include double or triple bonds and may also include heteroatoms. For example, allyloxy or methoxyethoxy is also an alkoxy group within the meaning herein, and so is methylenedioxy in the case where two adjacent atoms of the structure are replaced by it.

[0051] As used herein, the term "alkyl" refers to straight-chain and branched-chain alkyl and cycloalkyl groups having from 1 to 40 carbon atoms, from 1 to about 20 carbon atoms, from 1 to 12 carbon atoms, or in some embodiments from 1 to 8 carbon atoms. Examples of straight-chain alkyl groups include those having from 1 to 8 carbon atoms, such as methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl. Examples of branched alkyl groups include, but are not limited to, isopropyl, isobutyl, sec-butyl, tert-butyl, neopentyl, isopentyl, and 2,2-dimethylpropyl. As used herein, the term "alkyl" encompasses n-alkyl, iso-alkyl, and anti-iso-alkyl, as well as other branched forms of alkyl. Representative substituted alkyl groups may be substituted one or more times with any of the groups listed herein, for example, amino, hydroxy, cyano, carboxyl, nitro, thio, alkoxy, and halogen.

[0052] As used herein, the term "alkynyl" refers to straight-chain and branched-chain alkyl groups having at least one triple bond between two carbon atoms. Thus, alkynyl groups have from 2 to 40 carbon atoms, from 2 to about 20 carbon atoms, or from 2 to 12 carbon atoms, or in some embodiments from 2 to 8 carbon atoms. Examples include, but are not limited to, -C≡CH, -C≡C(CH3), -C≡C(CH2CH3), -CH2C≡CH, -CH2C≡C(CH3), and -CH2C≡C(CH2CH3), among others.

[0053] As used herein, the term "alkylene" or "alkylenyl" refers to a divalent saturated aliphatic group (e.g., -CH2-, -CH2CH2-, and -CH2CH2CH2-, among others). In certain embodiments, the term can be considered a moiety derived from an alkene by opening a double bond, or a moiety derived from an alkane by removing two hydrogen atoms from the same (e.g., -CH2-) or different (e.g., -CH2CH2-) carbon atoms. Similarly, as used herein, the terms "heteroalkylenyl", "cycloalkylenyl", "heterocycloalkylenyl", etc. refer to divalent groups corresponding to moieties of the base groups (e.g., heteroalkyl, cycloalkyl, and / or heterocycloalkyl). The divalent group has two open valences at any position of the group. Thus, the divalent group can form single bonds with two different atoms or groups, or a double bond with one atom.

[0054] As used herein, the term "amine" refers to primary, secondary, and tertiary amines having, for example, the formula N(group)3, where each group can independently be H or non-H, such as alkyl, aryl, etc. Amines include, but are not limited to, R-NH2, e.g., alkylamines, arylamines, alkylarylamines; R2NH, where each R is independently selected, such as dialkylamines, diarylamines, aralkylamines, heterocyclic amines, etc.; and R3N, where each R is independently selected, such as trialkylamines, dialkylarylamines, alkyldiarylamines, triarylamines, etc. The term "amine" also includes ammonium ions as used herein.

[0055] As used herein, the term "amino group" refers to substituents of the form -NH2, -NHR, -NR2, -NR3 + where each R is independently selected, and the protonated forms of each (except -NR3 + which cannot be protonated). Thus, any compound substituted with an amino group can be considered an amine. "Amino" within the meaning herein can be primary, secondary, tertiary, or quaternary amino. "Alkylamino" groups include monoalkylamino, dialkylamino, and trialkylamino.

[0056] The term "anionic lipid" refers to any lipid that is negatively charged at physiological pH. These lipids include phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphonic acid, N-dodecanoylphosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutaroylphosphatidylethanolamine, lysylphosphatidylglycerol, and palmitoylhydroxyphosphatidylglycerol (POPG), as well as other anionic modifying groups in combination with neutral lipids.

[0057] As used herein, the term "aralkyl" refers to an alkyl group as defined herein, wherein a hydrogen or carbon bond of the alkyl group is replaced by an aryl bond as defined herein. Representative aralkyl groups include benzyl and phenethyl, as well as fused (cycloalkylaryl)alkyl groups such as 4-ethyl-indanyl. An aralkenyl is an alkenyl group as defined herein, wherein a hydrogen or carbon bond of the alkyl group is replaced by an aryl bond as defined herein.

[0058] As used herein, the term "aryl" refers to a cycloaromatic group that does not contain a heteroatom in the ring. Thus, aryl includes, but is not limited to, phenyl, azulenyl, heptalenyl, biphenyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, biphenylene, anthracenyl, and naphthyl. In some embodiments, the aryl group contains from about 6 to about 14 carbons in the ring portion of the group. The aryl group may be unsubstituted or substituted, as defined herein. Representative substituted aryl groups may be mono-substituted or substituted more than once, for example but not limited to phenyl substituted at any one or more of the 2-, 3-, 4-, 5-, or 6-positions of the benzene ring, or naphthyl substituted at any one or more of its 2- to 8-positions.

[0059] As used herein, the term "atm" refers to the pressure of atmospheric pressure under standard conditions. Thus, 1 atm is a pressure of 101 kPa, 2 atm is a pressure of 202 kPa, and so on.

[0060] As used herein, the term "cationic lipid" refers to any one of a number of lipid species that carry a net positive charge at a selected pH value, such as physiological pH (e.g., a pH value of about 7.0). Cationic lipids that include alkyl chains having multiple sites of unsaturation (e.g., at least two or three sites of unsaturation) have been found to be particularly useful for forming lipid particles with increased membrane fluidity. U.S. Patent Publication Nos. 20060083780 and 20060240554; U.S. Patents Nos. 5,208,036, 5,264,618, 5,279,833, 5,283,185, 5,753,613, and 5,785,992, and PCT Publication WO 96 / 10390 describe a number of cationic lipids and related analogs that are also useful in the present disclosure, the entire contents of which are incorporated herein by reference for all purposes. Non-limiting examples of cationic lipids are described in detail herein. In some cases, the cationic lipid includes a protonatable tertiary amine (e.g., titratable pH) head group, a C 18 alkyl chain, an ether bond between the head group and the alkyl chain, and from 0 to 3 double bonds. Such lipids include, for example, DSDMA, DLinDMA, DLenDMA, and DODMA.

[0061] As used herein, the term "cycloalkyl" refers to cycloalkyl groups, such as but not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. In some embodiments, the cycloalkyl may have from 3 to about 8 - 12 ring members, while in other embodiments, the number of ring carbon atoms ranges from 3 to 4, 5, 6, or 7. Cycloalkyl further includes polycyclic cycloalkyl groups, such as but not limited to norbornyl, adamantyl, bornyl, camphenyl, isocamphenyl, and carenyl, and fused rings, such as but not limited to decalinyl, and the like. Cycloalkyl also includes rings substituted with straight-chain or branched-chain alkyl groups as defined herein. Representative substituted cycloalkyl groups may be mono-substituted or multi-substituted, such as but not limited to 2,2-, 2,3-, 2,4-, 2,5-, or 2,6-disubstituted cyclohexyl or mono-substituted, di-substituted, or tri-substituted norbornyl or cycloheptyl, which may be substituted with, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups. The term "cycloalkenyl" alone or in combination refers to cyclic alkenyl groups.

[0062] As used herein, the term "epoxy-functional" or "epoxy-substituted" refers to a functional group in which an oxygen atom (epoxy substituent) is directly attached to two adjacent carbon atoms of a carbon chain or ring system. Examples of epoxy-substituted functional groups include, but are not limited to, 2,3-epoxypropyl, 3,4-epoxybutyl, 4,5-epoxypentyl, 2,3-epoxypropoxy, epoxypropoxypropyl, 2-glycidyloxyethyl, 3-glycidyloxypropyl, 4-glycidyloxybutyl, 2-(glycidyloxycarbonyl)propyl, 3-(3,4-epoxycyclohexyl)propyl, 2-(3,4-epoxycyclohexyl)ethyl, 2-(2,3-epoxycyclopentyl)ethyl, 2-(4-methyl-3,4-epoxycyclohexyl)propyl, 2-(3,4-epoxy-3-methylcyclohexyl)-2-methylethyl, and 5,6-epoxyhexyl.

[0063] A "disease" is a state of health in an animal in which the animal is unable to maintain homeostasis and in which the health of the animal continues to deteriorate if the disease is not ameliorated.

[0064] In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but the animal's state of health is not as good as it would be in the absence of the disorder. A disorder does not necessarily result in a further decline in the animal's health status if left untreated.

[0065] A disease or disorder is "alleviated" if the severity of the symptoms of the disease or disorder, the frequency with which the patient experiences such symptoms, or both, are reduced.

[0066] As used herein, the terms "effective amount", "pharmaceutically effective amount", and "therapeutically effective amount" refer to a non-toxic but sufficient amount of a formulation to provide the desired biological result. The result can be a reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. The appropriate therapeutically effective amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation.

[0067] Specifically, in the case of mRNA, an “effective amount” or “therapeutically effective amount” of a therapeutic nucleic acid associated with the mRNA is an amount sufficient to produce a desired effect, e.g., an amount of protein that causes a desired biological effect in an organism in which the mRNA is directionally expressed to express the protein therein. For example, in some embodiments, the expressed protein is an active form of a protein that is normally expressed in a cell type in vivo, and the therapeutically effective amount of the mRNA is an amount that produces an amount of the encoded protein that is at least 50% (e.g., at least 60%, or at least 70%, or at least 80%, or at least 90%) of the amount of the protein normally expressed in the cell type of a healthy individual. For example, in some embodiments, the expressed protein is a protein that is normally expressed in a cell type in vivo, and the therapeutically effective amount of the mRNA is an amount that produces a level of expression in an individual with abnormal expression of the protein (i.e., a protein-deficient individual) that is similar to the level of expression observed in a healthy individual. Suitable assays for measuring the expression of mRNA or protein include, but are not limited to, dot blot, Northern blot, in situ hybridization, ELISA, immunoprecipitation, enzyme function, and phenotypic analysis known to those of skill in the art.

[0068] As used herein, the term “encode” refers to a product (e.g., a protein and an RNA) specified by a given nucleotide sequence in a nucleic acid (i.e., DNA and / or RNA) upon transcription or translation of the DNA or RNA, respectively. In certain embodiments, the term “encode” refers to an RNA sequence specified by transcription of a DNA sequence. In certain embodiments, the term “encode” refers to an amino acid sequence (e.g., a polypeptide or a protein) specified by translation of an mRNA. In certain embodiments, the term “encode” refers to an amino acid sequence specified by transcription of a DNA into an mRNA and subsequent translation of the mRNA encoded by the DNA sequence. In certain embodiments, the encoded product may include a direct transcription or translation product. In certain embodiments, the encoded product may include post-translational modifications understood or reasonably expected by those of skill in the art.

[0069] The term “fully encapsulated” means that the active agent or therapeutic agent in the lipid particle is not significantly degraded after exposure to serum or an assay with nucleases or proteases that would significantly degrade free DNA, RNA, or protein. In a fully encapsulated system, in a treatment that would normally degrade 100% of the free active agent or therapeutic agent, preferably less than about 25% of the active agent or therapeutic agent in the particle is degraded, more preferably less than about 10%, and most preferably less than about 5% of the active agent or therapeutic agent in the particle is degraded. In the context of a nucleic acid therapeutic agent, full encapsulation can be determined by an assay. is a highly sensitive fluorescent nucleic acid stain for quantifying oligonucleotides and single-stranded DNA or RNA in solution (available from Invitrogen, Carlsbad, California). "Fully encapsulated" also means that the lipid particles are serum-stable, i.e., they do not rapidly break down into their component parts when administered in vivo.

[0070] Unless otherwise specified, the term "halo", "halogen", or "halide" group, as used herein, either alone or as part of another substituent, refers to a fluorine, chlorine, bromine, or iodine atom.

[0071] As used herein, the term "haloalkyl" group includes monohaloalkyl, polyhaloalkyl in which all halogen atoms may be the same or different, and perhaloalkyl in which all hydrogen atoms are replaced by halogen atoms such as fluorine. Examples of haloalkyl include trifluoromethyl, 1,1-dichloroethyl, 1,2-dichloroethyl, 1,3-dibromo-3,3-difluoropropyl, perfluorobutyl, and the like.

[0072] The term "heteroaryl" as used herein refers to an aromatic ring compound having 5 or more ring members, one or more of which are heteroatoms, such as but not limited to N, O, and S; for example, a heteroaryl ring may have 5 to about 8 - 12 ring members. Heteroaryl is a type of heterocyclic group that has an aromatic electronic structure. A heteroaryl called C2-heteroaryl can be a 5-ring having two carbon atoms and three heteroatoms, a 6-ring having two carbon atoms and four heteroatoms, and so on. Similarly, C4-heteroaryl can be a 5-ring having one heteroatom, a 6-ring having two heteroatoms, and so on. The sum of the number of carbon atoms plus the number of heteroatoms equals the total number of ring atoms. Heteroaryl includes but is not limited to groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridyl, thienyl, benzothienyl, benzofuranyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridyl, isoxazolopyridyl, thianaphthyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl. Heteroaryl can be unsubstituted or can be substituted with groups as discussed herein. Representative substituted heteroaryls can be substituted one or more times with groups such as those listed herein.

[0073] Other examples of aryl and heteroaryl include, but are not limited to, phenyl, biphenyl, indenyl, naphthyl (1-naphthyl, 2-naphthyl), N-hydroxytetrazolyl, N-hydroxytriazolyl, N-hydroxyimidazolyl, anthryl (1-anthryl, 2-anthryl, 3-anthryl), thienyl (2-thienyl, 3-thienyl), furyl (2-furyl, 3-furyl), indolyl, oxadiazolyl, isoxazolyl, quinazolinyl, fluorenyl, xanthenyl, isochromanyl, benzhydryl, acridinyl, thiazolyl, pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), triazolyl (1,2,3-triazol-1-yl, 1,2,3-triazol-2-yl, 1,2,3-triazol-4-yl, 1,2,4-triazol-3-yl), oxazolyl (2-oxazolyl, 4-oxazolyl, 5-oxazolyl), thiazolyl (2-thiazolyl, 4-thiazolyl, 5-thiazolyl), pyridyl (2-pyridyl, 3-pyridyl, 4-pyridyl), pyrimidinyl (2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 6-pyrimidinyl), pyrazinyl, pyridazinyl (3-pyridazinyl, 4-pyridazinyl, 5-pyridazinyl), quinolinyl (2-quinolinyl, 3-quinolinyl, 4-quinolinyl, 5-quinolinyl, 6-quinolinyl, 7-quinolinyl, 8-quinolinyl), isoquinolinyl (1-isoquinolinyl, 3-isoquinolinyl, 4-isoquinolinyl, 5-isoquinolinyl, 6-isoquinolinyl, 7-isoquinolinyl, 8-isoquinolinyl), benz[b]furyl (2-benz[b]furyl, 3-benz[b]furyl, 4-benz[b]furyl, 5-benz[b]furyl, 6-benz[b]furyl, 7-benz[b]furyl), 2,3-dihydro-benz[b]furyl (2-(2,3-dihydro-benz[b]furyl), 3-(2,3-dihydro-benz[b]furyl), 4-(2,3-dihydro-benz[b]furyl), 5-(2,3-dihydro-benz[b]furyl), 6-(2,3-dihydro-benz[b]furyl), 7-(2,3-dihydro-benz[b]furyl), benz[b]thienyl (2-benz[b]thienyl, 3-benz[b]thienyl, 4-benz[b]thienyl, 5-benz[b]thienyl, 6-benz[b]thienyl, 7-benz[b]thienyl), 2,3-dihydro-benz[b]thienyl, (2-(2,3-dihydro-benz[b]thienyl), 3-(2,3-dihydro-benz[b]thienyl), 4-(2,3-dihydro-benz[b]thienyl), 5-(2,3-dihydro-benz[b]thienyl), 6-(2,3-dihydro-benz[b]thienyl), 7-(2,3-dihydro-benzo[b]thienyl), indolyl (1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl), indazole (1-indazolyl, 3-indazolyl, 4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazolyl (1-benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5-benzimidazolyl, 6-benzimidazolyl, 7-benzimidazolyl, 8-benzimidazolyl), benzoxazolyl (1-benzoxazolyl, 2-benzoxazolyl), benzothiazolyl (1-benzothiazolyl, 2-benzothiazolyl, 4-benzothiazolyl, 5-benzothiazolyl, 6-benzothiazolyl, 7-benzothiazolyl), carbazolyl (1-carbazolyl, 2-carbazolyl, 3-carbazolyl, 4-carbazolyl), 5H-dibenzo[b,f]azepine, (5H-dibenzo[b,f]azepine -1-yl, 5H-dibenzo[b,f]azepine -2-yl, 5H-dibenzo[b,f]azepine -3-yl, 5H-dibenzo[b,f]azepine -4-yl, 5H-dibenzo[b,f]azepine -5-yl), 10,11-dihydro-5H-dibenzo[b,f]azepine (10,11-dihydro-5H-dibenzo[b,f]azepine -1-yl, 10,11-dihydro-5H-dibenzo[b,f]azepine -2-yl, 10,11-dihydro-5H-dibenzo[b,f]azepine -3-yl, 10,11-dihydro-5H-dibenzo[b,f]azepine -4-yl, 10,11-dihydro-5H-dibenzo[b,f]azepine -5-yl), etc.

[0074] As used herein, the term "heteroarylalkyl" means that the hydrogen bond or carbon bond of the alkyl in the alkyl as defined herein is replaced by the bond of the heteroaryl as defined herein.

[0075] As used herein, the term "heterocyclylalkyl" means that the hydrogen bond or carbon bond of the alkyl in the alkyl as defined herein is replaced by the bond of the heterocyclic group as defined herein. Representative heterocyclylalkyls include, but are not limited to, furan-2-ylmethyl, furan-3-ylmethyl, pyridin-3-ylmethyl, tetrahydrofuran-2-ylethyl, and indol-2-ylpropyl.

[0076] As used herein, the term "heterocyclyl" refers to aromatic and non-aromatic cyclic compounds having three or more ring members, one or more of which are heteroatoms, such as, but not limited to, N, O, and S. Thus, heterocyclyl can be cycloheteroalkyl or heteroaryl, or, if polycyclic, any combination thereof. In some embodiments, heterocyclyl includes from 3 to about 20 ring members, while other such groups have from 3 to about 15 ring members. A heterocyclyl designated as C2-heterocyclyl can be a 5-ring having two carbon atoms and three heteroatoms, a 6-ring having two carbon atoms and four heteroatoms, and so on. Similarly, a C4-heterocyclyl can be a 5-ring having one heteroatom, a 6-ring having two heteroatoms, and so on. The number of carbon atoms plus the number of heteroatoms equals the total number of ring atoms. The heterocyclyl ring can also include one or more double bonds. A heteroaryl ring is one embodiment of heterocyclyl. The phrase "heterocyclyl" includes fused ring species, including those containing fused aromatic and non-aromatic groups. For example, dioxolane and benzodioxole systems (methylenedioxyphenyl ring systems) are both heterocyclyls within the meaning herein. The phrase also includes polycyclic systems containing heteroatoms, such as, but not limited to, quinuclidyl. Heterocyclyl can be unsubstituted or can be substituted as discussed herein. Heterocyclyl includes, but is not limited to, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridyl, thienyl, benzothienyl, benzofuranyl, dihydrobenzofuranyl, indolyl, dihydroindolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridyl, isoxazolopyridyl, thianaphthyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolyl, isoquinolyl, tetrahydroquinolyl, quinoxalinyl, and quinazolinyl. Representative substituted heterocyclyls can be mono-substituted or multi-substituted, such as, but not limited to, piperidinyl or quinolyl, which are 2-, 3-, 4-, 5-, or 6-substituted, or disubstituted with groups as listed herein.

[0077] As used herein, the term "hydrocarbon" or "hydrocarbyl" refers to a molecule or functional group that includes carbon atoms and hydrogen atoms. The term can also refer to a molecule or functional group that typically includes carbon atoms and hydrogen atoms but in which all hydrogen atoms have been replaced by other functional groups.

[0078] As used herein, the term "hydrocarbyl" refers to a functional group derived from a straight-chain, branched, or cyclic hydrocarbon and can be alkyl, alkenyl, alkynyl, aryl, cycloalkyl, acyl, or any combination thereof. Hydrocarbyl can be represented as (C a -C b) Hydrocarbyl, where a and b are integers and mean any of from a to b carbon atoms. For example, (C1-C4) hydrocarbyl means the hydrocarbyl can be methyl (C1), ethyl (C2), propyl (C3), or butyl (C4), and (C0-C b ) hydrocarbyl means that in some embodiments there is no hydrocarbyl.

[0079] Unless the context clearly indicates otherwise, the term "independently selected from" as used herein means that the groups mentioned are the same, different, or a mixture thereof. Thus, under this definition, the phrase "X 1 , X 2 and X 3 independently selected from noble gases" will include, for example, the cases where X 1 , X 2 and X 3 are all the same, where X 1 , X 2 and X 3 are all different, where X 1 and X 2 are the same but X 3 is different, and other similar arrangements.

[0080] The term "ionizable lipid" as used herein refers to a lipid (e.g., a cationic lipid) having at least one group that can be protonated or deprotonated such that the lipid is positively charged at a pH equal to or lower than physiological pH (e.g., pH 7.4) and is neutral at a second pH, preferably neutral at or above physiological pH. Those skilled in the art will understand that the addition or removal of protons as a function of pH is an equilibrium process, and the reference to a charged or neutral lipid refers to the nature of the major species and does not require that all lipids be present in a charged or neutral form. Generally, an ionizable lipid has a pK a in the range of about 4 to about 7.

[0081] The term "local delivery" as used herein refers to the direct delivery of an active agent or therapeutic agent (such as messenger RNA) to a target site within a living organism. For example, a formulation can be locally delivered by direct injection into a disease site (such as a tumor) or other target site (such as an inflamed area) or target organ (such as the liver, heart, pancreas, kidney, etc.).

[0082] The term "lipid" refers to a group of organic compounds that includes, but is not limited to, fatty acid esters and is characterized by insolubility in water but solubility in many organic solvents. They are typically classified into at least three categories: (1) "simple lipids", which include fats, oils, and waxes; (2) "compound lipids", which include phospholipids and glycolipids; (3) "derived lipids", such as steroids.

[0083] The term "lipid conjugate" refers to a conjugated lipid that inhibits the aggregation of lipid particles. Such lipid conjugates include, but are not limited to, polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates such as PEG coupled to dialkoxypropyl, PEG coupled to diacylglycerol, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamine, PEG coupled to ceramide (e.g., U.S. Patent No. 5,885,613, the entire content of which is incorporated herein by reference for all purposes), cationic PEG lipids, and mixtures thereof. The PEG can be directly conjugated to the lipid or can be linked to the lipid through a linker moiety. Any linker moiety suitable for coupling PEG to a lipid can be used, including, for example, an ester-free linker moiety and an ester-containing linker moiety. In a preferred embodiment, an ester-free linker moiety is used.

[0084] As used herein, "lipid encapsulated" can refer to a lipid particle that provides an active agent or therapeutic agent (such as a nucleic acid (e.g., a protein cargo)) with full encapsulation, partial encapsulation, or both. In a preferred embodiment, the nucleic acid is fully encapsulated within the lipid particle (e.g., to form an SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle).

[0085] The term "lipid nanoparticle" refers to a particle having at least one dimension in the nanometer range (e.g., 1 - 1000 nm) that includes one or more lipids and / or additives.

[0086] The term "lipid particle" as used herein refers to a lipid formulation that can be used to deliver an active agent or therapeutic agent (such as a nucleic acid (e.g., mRNA)) to a target of interest. In the lipid particles of the present disclosure, which are typically formed from cationic lipids, non-cationic lipids, and conjugated lipids that prevent particle aggregation, the active agent or therapeutic agent can be encapsulated within the lipid, thereby protecting the formulation from enzymatic degradation.

[0087] The term "monovalent" as used herein refers to a substituent that is attached to a substituted molecule by a single bond. When the substituent is monovalent, such as F or Cl, it is attached to the atom it replaces by a single bond.

[0088] The term "neutral lipid" refers to any one of many lipid species that exist in an uncharged or neutral zwitterionic form at a selected pH value. At physiological pH, such lipids include, for example, diacyl phosphatidylcholine, diacyl phosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebroside, and diacylglycerol.

[0089] The term "non-cationic lipid" refers to any amphiphilic lipid and any other neutral lipid or anionic lipid.

[0090] As used herein, the term "nucleic acid" refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in single-stranded or double-stranded form, and includes DNA and RNA. DNA can be in the form of, for example, antisense molecules, plasmid DNA, precondensed DNA, PCR products, vectors (Pl, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. RNA can be in the form of siRNA, asymmetric interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and have binding properties similar to those of reference nucleic acids. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoroamidates, methylphosphonates, chiral methylphosphonates, 2'-O-methyl ribonucleotides, and peptide nucleic acids (PNAs). Unless specifically defined otherwise, the term includes nucleic acids containing known natural nucleotide analogs having binding properties similar to those of reference nucleic acids. Unless otherwise indicated, a particular nucleic acid sequence also implicitly includes its conservatively modified variants (e.g., degenerate codon substitutions), alleles, homologous genes, SNPs, and complementary sequences, as well as the explicitly indicated sequence. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced with a mixture of bases and / or deoxynucleoside residues (Batzer et al., Nucleic Acid Res, 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mal. Cell. Probes, 8:91-98 (1994)).

[0091] As used herein, the term "nucleic acid" includes any oligonucleotide or polynucleotide, wherein the fragment containing up to 60 nucleotides is generally referred to as an oligonucleotide, and longer fragments are referred to as polynucleotides. In a particular embodiment, the oligonucleotide length of the present disclosure is about 15 to about 60 nucleotides. Nucleic acid can be used alone in lipid particles of the present disclosure, or combined with lipid particles of the present disclosure including peptides, polypeptides or small molecules (such as conventional drugs) (e.g., co-administered). In other embodiments, nucleic acids can be used in viral vectors.

[0092] "Nucleotides" comprise the sugar deoxyribose (DNA) or ribose (RNA), a base and a phosphate group. The nucleotides are linked together by the phosphate group. "Bases" include purines and pyrimidines, which further include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine and natural analogs, and synthetic derivatives of purines and pyrimidines, which include but are not limited to modifications that place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates and halogenated hydrocarbons.

[0093] Unless otherwise indicated, a specific nucleic acid sequence also implicitly includes variants (e.g., degenerate codon replacements), alleles, homologous genes, SNPs and complementary sequences of its conservative modifications and sequences explicitly indicated. Specifically, degenerate codon replacements can be achieved by generating a sequence in which the third position of one or more selected (or all) codons is replaced by mixed bases and / or deoxynucleoside residues (Batzer et al., Nucleic Acid Res, 19:5081 (1991); Ohtsuka et al., J.Biol.Chem., 260:2605-2608 (1985); Rossolini et al., Mol.Cell.Probes, 8:91-98 (1994)).

[0094] As used herein, the term "organic group" refers to any carbon-containing functional group. Examples may include oxygen-containing groups such as alkoxy, aryloxy, aralkyloxy, oxo (carbonyl) groups; carboxyl groups including carboxylic acids, carboxylates and carboxylates; sulfur-containing groups such as alkyl and aryl sulfides; and other heteroatom-containing groups. Non-limiting examples of organic groups include OR, OOR, OC(O)N(R)2, CN, CF3, OCF3, R, C(O), methylenedioxy, ethylenedioxy, N(R)2, SR, SOR, S02R, SO2N(R)2, S03R, C(O)R, C(O)C(O)R, C(O)CH2C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R)2, OC(O)N(R)2, C(S)N(R)2, (CH2)0-2 N(R)C(O)R, (CH2) 0-2 N(R)N(R)2, N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)CON(R)2, N(R)SO2R, N(R)SO2N(R)2, N(R)C(O)OR, N(R)C(O)R, N(R)C(S)R, N(R)C(O)N(R)2, N(R)C(S)N(R)2, N(COR)COR, N(OR)R, C(=NH)N(R )2 , C(O)N(OR)R, C(=NOR)R, and a substituted or unsubstituted (C1-C 100 ) hydrocarbyl group, where R can be hydrogen (in instances where other carbon atoms are included) or a carbon-based moiety, and where the carbon-based moiety can be substituted or unsubstituted.

[0095] The terms “patient,” “subject,” or “individual” are used interchangeably herein and refer to any animal or its cells, whether in vitro or in situ, suitable for the methods described herein. In non-limiting embodiments, the patient, subject, or individual is a human.

[0096] As used herein, the term “pharmaceutically acceptable” refers to a material (such as a carrier or diluent) that does not abrogate the biological activity or properties of a compound and is relatively non-toxic, i.e., the material can be administered to an individual without causing undesirable biological effects or interacting in a harmful manner with any component of the composition in which it is contained.

[0097] As used herein, the term “pharmaceutically acceptable salt” refers to salts of an administered compound prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic or organic acids or bases, solvates, hydrates, or inclusion compounds thereof.

[0098] Suitable pharmaceutically acceptable acid addition salts can be prepared from inorganic or organic acids. Examples of inorganic acids include hydrochloric acid, hydrobromic acid, hydroiodic acid, nitric acid, carbonic acid, sulfuric acid (including sulfates and bisulfates) and phosphoric acid (including hydrogen phosphates and dihydrogen phosphates). Suitable organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic acids, examples of which include formic acid, acetic acid, propionic acid, succinic acid, glycolic acid, gluconic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, glucuronic acid, maleic acid, malonic acid, saccharin, fumaric acid, pyruvic acid, aspartic acid, glutamic acid, benzoic acid, anthranilic acid, 4-hydroxybenzoic acid, phenylacetic acid, mandelic acid, pamoic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, pantothenic acid, trifluoromethanesulfonic acid, 2-hydroxyethanesulfonic acid, p-toluenesulfonic acid, sulfamic acid, cyclohexylaminosulfonic acid, stearic acid, alginic acid, β-hydroxybutyric acid, salicylic acid, galacturonic acid and galactaric acid.

[0099] Suitable pharmaceutically acceptable base addition salts of the compounds described herein include, for example, ammonium salts, metal salts, including alkali metal, alkaline earth metal and transition metal salts, such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines, such as N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, glucamine (N-methylglucamine) and procaine. All of these salts can be prepared from the corresponding compounds by reacting the appropriate acid or base with the compound, for example.

[0100] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent, or encapsulating material involved in carrying or transporting the compounds described herein within or to a patient so that they can perform their intended functions. Typically, such compounds are carried or transported from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, including the compounds described herein, and not injurious to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; tragacanth powder; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surfactants; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; phosphate buffer solutions; and other non-toxic compatible substances for pharmaceutical formulations. As used herein, "pharmaceutically acceptable carrier" also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, etc. that are compatible with the activity of the compounds described herein and physiologically acceptable to the patient. Supplementary active compounds can also be incorporated into the compositions. "Pharmaceutically acceptable carrier" can further include pharmaceutically acceptable salts of the compounds described herein. Other additional ingredients that can be included in the pharmaceutical compositions used in conjunction with the methods or compounds described herein are known in the art and are described, for example, in Remington’s Pharmaceutical Sciences (Genaro, editor, Mack Publishing Company, 1985, Easton, PA), which is incorporated herein by reference.

[0101] The terms "peptide", "polypeptide", and "protein" are used interchangeably herein and refer to a compound composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limitation on the maximum number of amino acids that can comprise the sequence of the protein or peptide. A polypeptide includes any peptide or protein that contains two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains (which are also commonly referred to in the art as, for example, peptides, oligopeptides, and oligomers) and long chains (which are commonly referred to in the art as proteins, of which there are many types). "Polypeptide" includes, for example, bioactive fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0102] The term "polymer conjugated lipid" refers to a molecule that includes both a lipid moiety and a polymer moiety. An example of a polymer conjugated lipid is a PEGylated lipid. The term "PEGylated lipid" refers to a molecule that includes both a lipid moiety and a polyethylene glycol moiety. PEGylated lipids are known in the art and include 1-(monomethoxy polyethylene glycol)-2,3-dimyristoyl glycerol (PEG-s-DMG), DSPE-PEG-DBCO, DOPE-PEG-azide, DSPE-PEG-azide, DPPE-PEG-azide, DSPE-PEG-carboxyl-NHS, DOPE-PEG-carboxylic acid, DSPE-PEG carboxylic acid, and the like.

[0103] The term "room temperature" as used herein refers to a temperature of about 15 to 28 °C.

[0104] The term "solvent" as used herein refers to a liquid that is capable of dissolving a solid, liquid, or gas. Non-limiting examples of solvents are siloxanes, organic compounds, water, alcohols, ionic liquids, and supercritical fluids.

[0105] As used herein, the term "substantially" means most or the majority, such as at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99% or at least about 99.999% or more, or 100%. As used herein, the term "substantially free of" may mean free of or having a small amount such that the amount of the material present does not affect the material properties of the composition including the material, such that the material in the composition is from about 0 wt% to about 5 wt%, or from about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to or greater than about 4.5 wt%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.01% or about 0.001 wt% or less. The term "substantially free of" may mean having a small amount such that the material in the composition is from about 0 wt% to about 5 wt%, or from about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to or greater than about 4.5 wt%, 4%, 3.5%, 3%, 2.5%, 2%, 1.5%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.01%, or about 0.001 wt% or less, or about 0 wt%.

[0106] As used herein, the term "substituted" when used in connection with a molecule or organic group defined herein means a state in which one or more hydrogen atoms contained therein are replaced by one or more non-hydrogen atoms. As used herein, the term "functional group" or "substituent" means a group that can or has been substituted onto a molecule or organic group. Examples of substituents or functional groups include, but are not limited to, halogens (e.g., F, Cl, Br, and I); oxygen atoms in groups such as hydroxyl, alkoxy, aryloxy, aralkyloxy, oxo(carbonyl) groups, carboxyl groups including carboxylic acids, carboxylates, and carboxylic esters; sulfur atoms in groups such as mercapto, alkyl and aryl sulfide groups, sulfoxide groups, sulfone groups, sulfonyl groups, and sulfonamide groups; nitrogen atoms in groups such as amines, hydroxylamines, nitriles, nitro groups, N-oxides, hydrazides, azides, and enamines; and heteroatoms in various other groups. Non-limiting examples of substituents that can be attached to a substituted carbon (or other) atom include F, Cl, Br, I, OR, OC(O)N(R)2, CN, NO, NO2, ONO2, azido, CF3, OCF3, R, O(oxo), S(thiocarbonyl), C(O), S(O), methylenedioxy, ethylenedioxy, N(R)2, SR, SOR, SO2R, SO2N(R)2, SO3R, C(O)R, C(O)C(O)R, C(O)CH2C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R)2, OC(O)N(R)2, C(S)N(R)2, (CH2) 0-2 N(R)C(O)R, (CH2) 0-2 N(R)N(R)2, N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)CON(R)2, N(R)SO2R, N(R)SO2N(R)2, N(R)C(O)OR, N(R)C(O)R, N(R)C(S)R, N(R)C(O)N(R)2, N(R)C(S)N(R)2, N(COR)COR, N(OR)R, C(=NH)N(R)2, C(O)N(OR)R, and C(=NOR)R, where R can be hydrogen or a carbon-based moiety; for example, R can be hydrogen, (C1-C 100 )hydrocarbyl, alkyl, acyl, cycloalkyl, aryl, aralkyl, heterocyclic, heteroaryl, or heteroaralkyl; or, where two R groups bonded to a nitrogen atom or adjacent nitrogen atoms can together with one or more nitrogen atoms form a heterocyclic group.

[0107] A "therapeutic" treatment refers to treating a subject exhibiting pathological signs to reduce or eliminate those signs.

[0108] As used herein, the term "therapeutic protein" refers to a protein or peptide that has a positive or beneficial effect on the condition or disease state of a subject when provided to the subject in a therapeutically effective amount. In certain embodiments, the therapeutic protein or peptide has curative or palliative properties and can be administered to improve, alleviate, mitigate, reverse, delay the onset of, or reduce the severity of one or more symptoms of a disease or disorder. The therapeutic protein or peptide can have prophylactic properties and can be used to delay the onset of a disease or reduce the severity of the disease or pathological condition. The term "therapeutic protein" includes the whole protein or peptide and can also refer to its therapeutically active fragments. It can also include therapeutically active variants of the protein. Exemplary therapeutic proteins include, but are not limited to, analgesic proteins, anti-inflammatory proteins, anti-proliferative proteins, pro-apoptotic proteins, anti-angiogenic proteins, cytotoxic proteins, cytostatic proteins, cytokines, chemokines, growth factors, wound healing proteins, drug proteins, or prodrug activating proteins. Therapeutic proteins can include growth factors (such as EGF, TGF-a, TGF-β, TNF, HGF, IGF, and IL-1-8, etc.), cytokines, antibody binding sites (paratopes), Fab (fragments, antigen binding), and antibodies.

[0109] As used herein, the terms "treat", "treating", and "treatment" mean reducing the frequency or severity of symptoms of a disease or condition experienced by a subject by administering a formulation or compound to the subject.

[0110] Lipid compound

[0111] In one aspect, the present disclosure provides an ionizable lipid compound of formula (I) or a salt, solvate, stereoisomer, or isotopic configurational isomer thereof:

[0112]

[0113] Wherein:

[0114] R 1a and R 1b are each independently

[0115] R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are each independently selected from the group consisting of H, optionally substituted C1-C 12 alkyl, optionally substituted C2-C 12Heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C2-C 12 alkenyl, optionally substituted C2-C 12 alkynyl, optionally substituted C6-C 10 aryl and optionally substituted C2-C 10 heteroaryl.

[0116] Each occurrence of R 3a , R 3b and R 3c is independently selected from the group consisting of H, .

[0117] wherein no more than one of R 3a , R 3b and R 3c is H;

[0118] Each occurrence of R 4a , R 4b , R 4c and R 4d (if present) is independently selected from the group consisting of optionally substituted C1-C 12 alkyl, halogen, CN and NO2;

[0119] Each occurrence of R 5 is independently selected from the group consisting of optionally substituted C1-C3 alkyl, optionally substituted C3-C 12 cycloalkyl, optionally substituted C6-C 10 aryl and optionally substituted C2-C 10 heteroaryl;

[0120] Each occurrence of R 6 is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C 12 cycloalkyl, C2-C 12 heterocycloalkyl, optionally substituted C6-C 12 aralkyl, optionally substituted C6-C 12 aryl, optionally substituted C2-C 12 heteroaryl, C(=O)R a , C(=O)OR a , and C(=O)N(R a )(R b );

[0121] Each occurrence of L is independently selected from the group consisting of a bond, -(optionally substituted C1-C 12 alkylene)-X-, -(optionally substituted C2-C 12-alkenylene)-X-, -(optionally substituted C1-C 12 -alkynylene)-X-, -(optionally substituted C1-C 12 -heteroalkylene)-X-, optionally substituted C3-C8 cycloalkylene, and optionally substituted C2-C8 heterocycloalkylene;

[0122] Each occurrence of X (if present) is independently selected from the group consisting of a bond, -N(R 3c ), and -O-;

[0123] Each occurrence of Y (if present) is independently selected from the group consisting of a bond, -N(R a ), and -O-;

[0124] Each occurrence of Z is C1-C 24 -alkylene,

[0125] wherein the C1-C 24 -alkylene in each occurrence of Z is independently substituted by at least one substituent selected from the group consisting of C1-C 12 -alkyl and C1-C 12 -haloalkyl, and

[0126] wherein the C1-C 24 -alkylene in each occurrence of Z is independently optionally further substituted;

[0127] R a and R b Each occurrence is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 -arylalkyl, optionally substituted phenyl, optionally substituted C2-C8 heteroaryl, C(=O)R c , C(=O)OR c and C(=O)N(R c )(R d );

[0128] R c and R d Each occurrence is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 -arylalkyl, optionally substituted phenyl, and optionally substituted C2-C8 heteroaryl; and

[0129] Each occurrence of m is independently 1, 2, 3, or 4.

[0130] In certain embodiments, selected from R2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least one in the group consisting of is H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least two in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least three in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least four in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least five in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least six in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2hAt least seven in the group formed are H. In certain embodiments, R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h are each H.

[0131] In certain embodiments, L is -(CH2) 1-10 -. In certain embodiments, L is -(CH2) 2-10 NR 3c -. In certain embodiments, L is -(CH2) 2-10 O-. In certain embodiments, L is -(CH2) 1-3 -CH(OR a )-(CH2) 1-3 -. In certain embodiments, L is piperazinyl. In certain embodiments, L is cyclohexylidene.

[0132] In certain embodiments, L is -CH2-. In certain embodiments, L is -(CH2)2-. In certain embodiments, L is -(CH2)3-. In certain embodiments, L is -(CH2) 10 -. In certain embodiments, L is -(CH2)2O-. In certain embodiments, L is -(CH2)3O-. In certain embodiments, L is -CH2CH(OR a )CH2-. In certain embodiments, L is -(CH2)2NR 3c -. In certain embodiments, L is In certain embodiments, L is In certain embodiments, L is

[0133] In certain embodiments, the compound of formula (I) is:

[0134]

[0135] In certain embodiments, the compound of formula (I) is:

[0136] In certain embodiments, the compound of formula (I) is:

[0137] In certain embodiments, the compound of formula (I) is:

[0138] In certain embodiments, the compound of formula (I) is:

[0139] In certain embodiments, the compound of formula (I) is:

[0140] In certain embodiments, the compound of formula (I) is:

[0141] In certain embodiments, the compound of formula (I) is:

[0142] In certain embodiments, the compound of formula (I) is:

[0143]

[0144] In certain embodiments, R 4a is H. In certain embodiments, R 4b is H. In certain embodiments, R 4c is H. In certain embodiments, R 4d is H.

[0145] In certain embodiments, R 5 is methyl.

[0146] In certain embodiments, R 6 is H.

[0147] In certain embodiments, each occurrence of Z is independently:

[0148]

[0149] Wherein:

[0150] R 7a , R 7b , R 7c and R 7d each occurrence of is independently selected from the group consisting of H, C1-C6 alkyl, and C1-C6 haloalkyl,

[0151] wherein, R 7a , R 7b , R 7c and R 7d at least one of is not H; and

[0152] each occurrence of o is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

[0153] In certain embodiments, R 7ais H. In certain embodiments, R 7b is H. In certain embodiments, R 7c is H. In certain embodiments, R 7d is H. In certain embodiments, R 7a is methyl. In certain embodiments, R 7b is methyl. In certain embodiments, R 7c is methyl. In certain embodiments, R 7d is methyl.

[0154] In certain embodiments, Z is -(CH2) 4-10 -CH(CH3)-*. In certain embodiments, Z is -(CH2) 4-10 -C(CH3)2-*. In certain embodiments, Z is -(CH2) 4-1 0-CH(CH3)-CH2-*.

[0155] In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain

[0156] embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is

[0157] In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is

[0158] In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is

[0159] In certain embodiments, each occurrence of an optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted aralkyl, optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted cycloalkylene, and optionally substituted heterocycloalkylene (if present) is independently optionally substituted with at least one substituent selected from the group consisting of a C1-C6 alkyl, a C3-C8 cycloalkyl, a C1-C6 haloalkyl, a C1-C3 haloalkoxy, a phenoxy, a halogen, CN, NO2, OH, N(R’)(R”), C(═O)R’, C(═O)OR’, OC(═O)OR’, C(═O)N(R’)(R”), S(═O)2N(R’)(R”), N(R’)C(═O)R”, N(R’)S(═O)2R”, a C2-C8 heteroaryl, and a phenyl optionally substituted with at least one halogen, where each occurrence of R’ and R” is independently selected from the group consisting of H, a C1-C6 alkyl, a C3-C8 cycloalkyl, a C1-C6 haloalkyl, a benzyl, and a phenyl.

[0160] In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: Ionizable lipids and / or cationic lipids

[0161] The scope of ionizable lipids contemplated for use in the present disclosure is not limited to the ionizable lipids of formula (I). In the lipid nanoparticles of the present disclosure, the cationic lipid or ionizable lipid may include, for example, one or more of the following: (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate (DLinMC3DMA), [(4-hydroxybutyl)azanediyl]bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadec-9-yl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102), 1,1’-[[2-[4-[2-[[2-[bis(2-hydroxydodecyl)amino]ethyl](2-hydroxydodecyl)amino]ethyl]-1-piperazinyl]ethyl]imino]bis-2-dodecanol (C12-200), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA; “XTC2”), 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane (DLin-K-C3-DMA), 2,2-dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane (DLin-K-C4-DMA), 2,2-dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA), 2,2-dilinoleyl-4-N-methylpiperazine-[1,3]-dioxolane (DLin-K-MPZ), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 1,2-dilinoleoylamidoxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyloxy-3-dimethylaminoacetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane hydrochloride (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane hydrochloride (DLin-TAP.(Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazine)propane (DLin-MPZ), 3-(N,N-dilinoleylamino)-1,2-propanediol (D LinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxy-3-(2-N,N-dimethylamino)ethoxypropane (D Lin-EG-D MA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 1,2-distearyloxy-N,N-dimethylaminopropane (DSD MA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N’N’-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 2,3-dioleyloxy-N-[2(spermine-formamidoethyl]-N,N-dimethyl-1-1-propanammonium trifluoroacetate (DOSPA), dioctadecylaminoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3-β-oxybutane-4-oxy)-1-(cis,cis-9,12-octadecadienyloxy)propane (CLinDMA), 2-[5’-(cholest-5-en-3-β-oxy)-3’-oxapentyloxy)-3-dimethyl-1-(cis,cis-9’,1-2’-octadecadienyloxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N’-dioleylcarbamoyl-3-dimethylaminopropane (DOcarbDAP), 1,2-N,N’-dilino leylcarbamoyl-3-dimethylaminopropane (DLincarbDAP) or a mixture thereof. In certain embodiments, the cationic lipid is DLinDMA, DLin-K-C2-DMA (“XTC2”) or a mixture thereof. Ionizable lipids are not limited to those described herein and may further include ionizable lipids known to those of skill in the art or described in PCT Application No. PCT / US2020 / 056255 and / or PCT Application No. PCT / US2020 / 056252, the entire disclosures of which are incorporated herein by reference.

[0162] The synthesis of cationic lipids such as DLin-K-C2-DMA (“XTC2”), DLin-K-C3-DMA, DLin-K-C4-DMA, DLin-K6-DMA, and DLin-K-MPZ, and other cationic lipids, is described in U.S. Patent Application Publication No. US 2011 / 0256175, the entire content of which is incorporated herein by reference for all purposes. The synthesis of cationic lipids such as DLin-K-DMA, DLin-CDAP, DLin-DAC, DLin-MA, DLinDAP, DLin-S-DMA, DLin-2-DMAP, DLin-TMA.Cl, DLin-TAP.Cl, DLin-MPZ, DLinAP, DOAP, and DLin-EG-DMA, and other cationic lipids, is described in PCT Application No. PCT / US08 / 88676, filed Dec. 31, 2008, the entire content of which is incorporated herein by reference for all purposes. The synthesis of cationic lipids such as CLinDMA, and other cationic lipids, is described in U.S. Patent Publication No. 20060240554, the entire content of which is incorporated herein by reference for all purposes.

[0163] Non-cationic lipids

[0164] In the nucleic acid lipid particles of the present disclosure, the non-cationic lipids can include, for example, one or more anionic lipids and / or neutral lipids. In some embodiments, the non-cationic lipids include one of the following neutral lipid components: (1) cholesterol or its derivatives; (2) phospholipids; or (3) a mixture of phospholipids and cholesterol or its derivatives.

[0165] Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholestenyl-2'-hydroxyethyl ether, cholestenyl-4'-hydroxybutyl ether, and mixtures thereof. The synthesis of cholestenyl-2'-hydroxyethyl ether is known to those skilled in the art and is described in U.S. Pat. Nos. 8058069, 8492359, 8822668, 9364435, 9504651, and 11141378, the entire content of which is incorporated herein by reference for all purposes.

[0166] Non-limiting examples of non-cationic lipids include phospholipids such as lecithin, phosphatidylethanolamine, lysophosphatidylcholine, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetylphosphate, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylglycerol (POPG), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), monomethylphosphatidylethanolamine, dimethylphosphatidylethanolamine, dierucoylphosphatidylethanolamine (DEPE), stearoyloleoylphosphatidylethanolamine (SOPE), lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof.

[0167] Other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids can be, for example, acyl groups derived from fatty acids having C 10 -C 24 -carbon chains, such as, for example, lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Other examples of non-cationic lipids include sterols such as cholesterol and its derivatives, such as cholestanol, cholestanone, cholestenone, coprostanol, cholestenyl-2'-hydroxyethyl ether, cholestenyl-4'-hydroxybutyl ether, and mixtures thereof. In certain embodiments, the phospholipid is DPPC, DSPC, or a mixture thereof.

[0168] Conjugated lipids

[0169] In the nucleic acid-lipid particles of the present disclosure, conjugated lipids that inhibit particle aggregation can include, for example, one or more of the following: polyethylene glycol (PEG)-lipid conjugates, polyamide (ATTA)-lipid conjugates, cationic polymer-lipid conjugates (CPL), or mixtures thereof. In some embodiments, the nucleic acid-lipid particles include PEG-lipid conjugates or ATTA-lipid conjugates.

[0170] PEG is a linear water-soluble polymer of ethylene-PEG repeating units with two terminal hydroxyl groups. PEG is classified by its molecular weight; for example, PEG 2000 has an average molecular weight of approximately 2000 daltons, and PEG 5000 has an average molecular weight of approximately 5000 daltons. PEG is commercially available from Sigma Chemical Company and other companies, including, for example, the following: monomethoxypolyethylene glycol (MePEGOH), monomethoxypolyethylene glycol succinate (MePEGS), monomethoxypolyethylene glycol N-hydroxysuccinimide ester (MePEG-S-NHS), monomethoxypolyethylene glycol amine (MePEG-NH2), monomethoxypolyethylene glycol tosylate (MePEG-TRES), and monomethoxypolyethylene glycol imidazolecarbonyl (MePEG-IM). Other PEGs, such as those described in U.S. Patent Nos. 6,774,180 and 7,053,150 (e.g., mPEG(20KDa) amine), can also be used to prepare the PEG-lipid conjugates of the present disclosure. The entire disclosures of these patents are incorporated herein by reference for all purposes. In addition, monomethoxypolyethylene glycol acetic acid (MePEG-CH2COOH) is particularly suitable for preparing PEG-lipid conjugates, including, for example, PEG-DAA conjugates.

[0171] In certain embodiments, the PEG-lipid conjugate or the ATTA-lipid conjugate is used with CPL. The conjugated lipid that inhibits particle aggregation can include PEG-lipids, including, for example, PEG-diacylglycerol (DAG), PEG-dialkoxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or mixtures thereof. The PEGDAA conjugate can be PEG dilauroyl oxypropyl (C 12 ), PEG-dimyristoyl oxypropyl (C 14 ), PEG-dipalmitoyl oxypropyl (C 16 ), PEG-distearoyl oxypropyl (C 18 ), or mixtures thereof.

[0172] Other PEG-lipid conjugates suitable for the present disclosure include, but are not limited to, mPEG2000-1,2-di-O-alkyl-sn-3-carbonyl glycerol ester (PEG-C-DOMG). The synthesis of PEG-C-DOMG is described in PCT application No. PCT / US08 / 88676, filed Dec. 31, 2008, the entire disclosure of which is incorporated herein by reference for all purposes. Yet other PEG-lipid conjugates suitable for use in the present disclosure include, but are not limited to, 1-[8'-(1,2-ditetradecanoyl-3-propoxy)-formamide-3',6'-dioxaoctyl]carbamoyl-methyl-poly(ethylene glycol) (2KPEG-DMG). The synthesis of 2KPEG-DMG is described in U.S. Pat. No. 7,404,969, the entire disclosure of which is incorporated herein by reference for all purposes.

[0173] The PEG moiety of the PEG-lipid conjugates described herein can include an average molecular weight in the range from about 550 Daltons to about 10,000 Daltons. In certain examples, the PEG moiety has an average molecular weight from about 750 Daltons to about 5000 Daltons (e.g., from about 1000 Daltons to about 5000 Daltons, from about 1500 Daltons to about 3000 Daltons, from about 750 Daltons to about 3000 Daltons, from about 750 Daltons to about 2000 Daltons, etc.). In some embodiments, the PEG moiety has an average molecular weight of about 2000 Daltons or about 750 Daltons.

[0174] In addition to the above, it will be readily apparent to those skilled in the art that other hydrophilic polymers can be used in place of PEG. Examples of suitable polymers that can be used in place of PEG include, but are not limited to, polyvinylpyrrolidone, poly(methyloxazoline), poly(ethyloxazoline), poly(hydroxypropylmethacrylamide), poly(methacrylamide) and poly(dimethylacrylamide), polylactic acid, polyglycolic acid, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.

[0175] In addition to the foregoing components, the particles of the present disclosure (e.g., LNPs) can further include cationic poly(ethylene glycol) (PEG) lipids or CPLs (e.g., Chen et al., Bioconj. Chem., 11:433-437 (2000)). For example, suitable SPLPs and SPLP-CPLs for the present disclosure, as well as methods of making and using SPLPs and SPLP-CPLs, are disclosed in U.S. Pat. No. 6,852,334 and PCT publication WO 00 / 62813, the entire disclosures of which are incorporated herein by reference for all purposes.

[0176] In certain examples, the conjugating lipids that inhibit particle aggregation (e.g., PEG-lipid conjugates) can account for about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mol% (or any fraction or range therein) of the total lipids in the particle.

[0177] In the lipid nanoparticles of the present disclosure, an active agent or therapeutic agent can be completely encapsulated within the lipid portion of the particle, thereby protecting the active agent or therapeutic agent from enzymatic degradation. In some embodiments, a nucleic acid-lipid particle comprising a nucleic acid such as messenger RNA (i.e., mRNA) is completely encapsulated within the lipid portion of the particle, thereby protecting the nucleic acid from nuclease degradation. In certain examples, the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after the particle is exposed to nuclease at 37 °C for at least about 20, 30, 45 or 60 minutes. In certain other examples, the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after the particle is cultured in serum at 37 °C for at least about 30, 45 or 60 minutes or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 or 36 hours. In other embodiments, an active agent or therapeutic agent (e.g., a nucleic acid such as siRNA) is complexed with the lipid portion of the particle. One of the benefits of the formulations of the present disclosure is that the lipid particle compositions are substantially non-toxic to mammals such as humans.

[0178] Synthesis

[0179] The present disclosure further provides methods for preparing the compounds of the present disclosure. By employing standard synthetic methods and procedures known to those skilled in the art, the compounds of the present teachings can be prepared from commercially available starting materials, compounds known in the literature, or readily prepared intermediates according to the procedures outlined herein. Standard synthetic methods and procedures for preparing organic molecules and for functional group transformation and manipulation can be readily obtained from relevant scientific literature or standard textbooks in the field.

[0180] Unless otherwise specified, it should be understood that given typical or preferred process conditions (i.e., reaction temperature, time, molar ratio of reactants, solvent, pressure, etc.), other process conditions may also be used. The optimal reaction conditions may vary depending on the specific reactants or solvents used, but such conditions can be determined by those skilled in the art through routine optimization procedures. Those skilled in the art of organic synthesis will recognize that the nature and sequence of the synthetic steps can be altered to optimize the formation of the compounds described herein.

[0181] The processes described herein can be monitored according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means such as nuclear magnetic resonance spectroscopy (e.g., 1 H or 13 C), infrared spectroscopy, spectrophotometry (e.g., UV-visible), mass spectrometry, or by chromatography (such as high performance liquid chromatography (HPLC), gas chromatography (GC), gel permeation chromatography (GPC) or thin layer chromatography (TLC)).

[0182] The preparation of the compounds may involve the protection and deprotection of various chemical groups. The need for protection and deprotection and the selection of appropriate protecting groups can be readily determined by those skilled in the art. The chemistry of protecting groups can be found, for example, in Greene et al., Protective Groups in Organic Synthesis, 2nd Edition, Eds. (Wiley & Sons, 1991), the entire disclosure of which is incorporated herein by reference for all purposes.

[0183] The reactions or processes described herein can be carried out in a suitable solvent readily selected by those skilled in the art of organic synthesis. Suitable solvents are generally substantially non-reactive with the reactants, intermediates, and / or products at the temperature at which the reaction is carried out (i.e., in the range from the freezing temperature of the solvent to the boiling temperature of the solvent). A given reaction can be carried out in one solvent or a mixture of one or more solvents. The suitable solvent for a particular reaction step can be selected according to the specific reaction step.

[0184] In certain embodiments, the compounds synthesized using the methods described herein may contain one or more chiral carbon atoms, giving rise to two or more isomers. The absolute stereochemistry can be described using wedge bonds (bold or parallel lines). In certain embodiments, the product formed in any of the reactions described herein may be a racemate. If a racemate is formed, the isomers constituting the racemate can be separated using any suitable chiral resolution method known to those skilled in the art. Suitable chiral resolution methods include, but are not limited to, supercritical fluid chromatography (SFC), chiral HPCL, crystallization, derivatization, or any combination thereof.

[0185] In certain embodiments, separating isomers formed in one or more separate reactions may require forming derivatives prior to chiral resolution. Non-limiting examples of derivatization are protecting one or more functional groups present in a compound using known protecting groups such as esters, amides, carbamates, ethers, etc., and then separating the isomers by suitable methods. By removing the protecting groups, the desired compound is ultimately obtained.

[0186] The present disclosure provides ionizable lipid compounds of formula (I) and non-limiting exemplary methods for their preparation. Those skilled in the art will recognize that alternative techniques and / or methods may be applicable to the synthesis of compounds of formula (I).

[0187] In certain embodiments, the compounds of the present disclosure may be prepared as provided in Schemes 1-5, where X 1 、X 2 and X 3 are each independently a halogen, s is an integer ranging from 1 to 24, R’ is an optionally substituted alkyl group comprising at least one branched or tertiary carbon (i.e., a carbon atom covalently bonded to at least 3 carbon atoms), and L, m, and Y are defined within the scope of the present disclosure.

[0188]

[0189] Scheme 1

[0190] In certain embodiments, the homolog halide olefin 1-2 can be prepared from the dihaloalkane 1-1 by selectively eliminating one halogen in a suitable solvent (including but not limited to tetrahydrofuran (THF)) at a suitable temperature (including but not limited to about 70 °C) over a period of time including but not limited to about 16 h. In certain embodiments, the olefin 1-3 can be further prepared by nucleophilic addition of a Grignard reagent (i.e., R’-MgX 3 ) in the presence of a suitable catalyst (including but not limited to Li2CuCl4), in the presence of a polar solvent and / or additive (non-limiting examples include N-methylpyrrolidone (NMP)), further in the presence of a suitable solvent (including but not limited to THF), at suitable reaction conditions (including ambient reaction temperature) over a period of time including but not limited to 1 h. In certain embodiments, the epoxide 1-4 can be prepared by epoxidation of the olefin 1-3 using a suitable epoxidizing reagent (including but not limited to m-chloroperoxybenzoic acid (mCPBA)) at suitable reaction conditions (including ambient reaction temperature) for a duration including but not limited to 16 h. Figure 1 Exemplary embodiments of the synthetic route depicted in Scheme 1 are provided.

[0191]

[0192] Scheme 2

[0193] In certain embodiments, the polyamine core 2-1 can be alkylated with 4 or more equivalents of epoxide 1-4 in the presence of a suitable solvent (including but not limited to ethanol (EtOH)) and at suitable reaction conditions (including but not limited to a temperature of about 80 °C) for a period of time including but not limited to 48 h to provide the ionizable lipid compound 2-2. In certain embodiments, L includes a primary or secondary amine. In these embodiments, where L includes a primary or secondary amine, greater than 4 equivalents of 1-4 are required for full alkylation. In certain embodiments, a superstoichiometric amount of 1-4 can be used to facilitate alkylation.

[0194] Exemplary embodiments of the synthetic routes depicted in Scheme 2 are provided in Figure 2.

[0195]

[0196] Scheme 3

[0197] In certain embodiments, the polyamine core 2-1 can be conjugated with 4 or more equivalents of an α,β-unsaturated carbonyl compound 3-1 (i.e., an α,β-unsaturated ketone, ester, and / or amide) by [1,4]-conjugate addition (i.e., Michael addition reaction) in the presence of a suitable solvent and at suitable reaction conditions to provide the ionizable lipid compound 3-2.

[0198]

[0199] Scheme 4

[0200] In certain embodiments, in the presence of a suitable solvent and at suitable reaction conditions, the polyamine core 2-1 can be conjugated with 4 or more equivalents of an α,β-epoxy-substituted carbonyl compound 4-1 by nucleophilic addition to provide the ionizable lipid compound 4-2.

[0201]

[0202] Scheme 5

[0203] In certain embodiments, the polyamine core 2-1 can be conjugated with 4 or more equivalents of an aldehyde 5-1 by reductive amination and / or reductive alkylation in the presence of a suitable hydride reducing agent and in the presence of a suitable solvent and at suitable reaction conditions to provide the ionizable lipid compound 5-2.

[0204] In addition, the present disclosure illustrates the synthesis of ionizable lipids of formula (I) (e.g., compounds 2-2, 3-2, 4-2, and 5-2 in Schemes 2-5), wherein the polyamine 2-1 is selected from polyamine core 494 (i.e., 2-(2-aminoethoxy)-N-(2-(4-(2-(2-aminoethoxy)ethyl)piperazin-1-yl)ethyl)ethan-1-amine) and polyamine core 200 (i.e., N 1 -(2-(4-(2-aminoethyl)piperazin-1-yl)ethyl)ethane-1,2-diamine). The present disclosure is not limited to the embodiments explicitly illustrated herein, and alternative polyamine cores are contemplated for use in the present disclosure, including but not limited to 3-(4-(3-aminopropyl)piperazin-1-yl)-N-(2-(4-(3-(4-(3-aminopropyl)piperazin-1-yl)propyl)piperazin-1-yl)ethyl)propan-1-amine, 2-(2-(2-aminoethoxy)ethoxy)-N-(2-(4-(2-(2-(2-aminoethoxy)ethoxy)ethyl)piperazin-1-yl)ethyl)ethan-1-amine, N 1 -(2-(4-(10-aminodecyl)piperazin-1-yl)ethyl)decane-1,10-diamine, 3-(2-(2-(3-aminopropoxy)ethoxy)ethoxy)-N-(2-(4-(3-(2-(2-(3-aminopropoxy)ethoxy)ethoxy)propyl)piperazin-1-yl)ethyl)propan-1-amine, N 1 -(2-(4-(3-amino-2-ethoxypropyl)piperazin-1-yl)ethyl)-2-ethoxypropane-1,3-diamine, N-((1-(aminomethyl)cyclohexyl)methyl)-2-(4-((1-(aminomethyl)cyclohexyl)methyl)piperazin-1-yl)ethan-1-amine, and N 1 -(2-(4-(4-aminocyclohexyl)piperazin-1-yl)ethyl)cyclohexane-1,4-diamine.

[0205] Table 1: Exemplary ionizable lipids of the present disclosure

[0206]

[0207]

[0208]

[0209]

[0210]

[0211] Lipid nanoparticles (LNP)

[0212] In another aspect, the present disclosure provides lipid nanoparticle (LNP) compositions.

[0213] In certain embodiments, the LNP composition comprises at least one ionizable lipid compound having the structure of formula (I) or a salt, solvate, stereoisomer or isotopic configurational isomer thereof:

[0214]

[0215] Wherein:

[0216] R 1a and R 1b are each independently

[0217] R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h are each independently selected from the group consisting of H, optionally substituted C1-C 12 alkyl, optionally substituted C2-C 12 heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C2-C 12 alkenyl, optionally substituted C2-C 12 alkynyl, optionally substituted C6-C 10 aryl and optionally substituted C2-C 10 heteroaryl;

[0218] R 3a , R 3b and R 3c each occurrence of which is independently selected from the group consisting of H, ;

[0219] wherein no more than one of R 3a , R 3b and R 3c is H;

[0220] R 4a , R 4b , R 4c and R 4d each occurrence (if any) of which is independently selected from the group consisting of optionally substituted C1-C 12 alkyl, halogen, CN and NO2;

[0221] R 5 each occurrence of which is independently selected from the group consisting of optionally substituted C1-C3 alkyl, optionally substituted C3-C 12 cycloalkyl, optionally substituted C6-C 10A group consisting of an aryl group and an optionally substituted C2-C 10 heteroaryl group;

[0222] Each occurrence of R 6 is independently selected from the group consisting of H, an optionally substituted C1-C6 alkyl group, an optionally substituted C3-C 12 cycloalkyl group, a C2-C 12 heterocycloalkyl group, an optionally substituted C6-C 12 arylalkyl group, an optionally substituted C6-C 12 aryl group, an optionally substituted C2-C 12 heteroaryl group, C(=O)R a , C(=O)OR a and C(=O)N(R a )(R b ).

[0223] Each occurrence of L is independently selected from the group consisting of a bond, -(optionally substituted C1-C 12 alkylene)-X-, -(optionally substituted C2-C 12 alkenylene)-X-, -(optionally substituted C1-C 12 alkynylene)-X-, -(optionally substituted C1-C 12 heteroalkylene)-X-, an optionally substituted C3-C8 cycloalkylene and an optionally substituted C2-C8 heterocycloalkylene;

[0224] Each occurrence of X (if present) is independently selected from the group consisting of a bond, -N(R 3c )- and -O-;

[0225] Each occurrence of Y (if present) is independently selected from the group consisting of a bond, -N(R a )- and -O-;

[0226] Each occurrence of Z is a C1-C 24 alkylene,

[0227] wherein the C1-C 24 alkylene in each occurrence of Z is independently substituted by at least one substituent selected from the group consisting of a C1-C 12 alkyl group and a C1-C 12 haloalkyl group, and

[0228] wherein the C1-C 24 alkylene in each occurrence of Z is independently optionally further substituted;

[0229] R a and R bEach occurrence of is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl, optionally substituted C2-C8 heteroaryl, C(═O)R c 、C(═O)OR c and C(═O)N(R c )(R d );

[0230] R c and R d Each occurrence of is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl and optionally substituted C2-C8 heteroaryl; and

[0231] Each occurrence of m is independently an integer selected from the group consisting of 1, 2, 3 and 4.

[0232] In certain embodiments, the LNP composition comprises at least one neutral lipid.

[0233] In certain embodiments, the LNP composition comprises cholesterol.

[0234] In certain embodiments, the LNP composition comprises at least one conjugated lipid.

[0235] In certain embodiments, the LNP comprises at least one nucleic acid and / or therapeutic agent cargo, wherein the cargo is at least partially encapsulated therein.

[0236] In certain embodiments, at least one selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h is H. In certain embodiments, at least two selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H. In certain embodiments, at least three selected from the group consisting of R 2a 、R 2b 、R 2c 、R2d , R 2e , R 2f , R 2g and R 2h at least three in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h at least four in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h at least five in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h at least six in the group consisting of are H. In certain embodiments, selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h at least seven in the group consisting of are H. In certain embodiments, each of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h is H..

[0237] In certain embodiments, L is -(CH2) 1-10 -. In certain embodiments, L is -(CH2) 2-10 NR 3c -. In certain embodiments, L is -(CH2) 2-10 O-. In certain embodiments, L is -(CH2) 1-3 -CH(OR a )-(CH2)1-3 -. In certain embodiments, L is a piperazinyl group. In certain embodiments, L is a cyclohexenyl group.

[0238] In certain embodiments, L is -CH2-. In certain embodiments, L is -(CH2)2-. In certain embodiments, L is -(CH2)3-. In certain embodiments, L is -(CH2) 10 -. In certain embodiments, L is -(CH2)2O-. In certain embodiments, L is -(CH2)3O-. In certain embodiments, L is -CH2CH(OR a )CH2-. In certain embodiments, L is -(CH2)2NR 3c -. In certain embodiments, L is In certain embodiments, L is In certain embodiments, L is

[0239] In certain embodiments, the compound of formula (I) is:

[0240]

[0241] In certain embodiments, the compound of formula (I) is:

[0242]

[0243] In certain embodiments, the compound of formula (I) is:

[0244]

[0245] In certain embodiments, the compound of formula (I) is:

[0246]

[0247] In certain embodiments, the compound of formula (I) is:

[0248]

[0249] In certain embodiments, the compound of formula (I) is:

[0250]

[0251] In certain embodiments, the compound of formula (I) is:

[0252]

[0253] In certain embodiments, the compound of formula (I) is:

[0254]

[0255] In certain embodiments, the compound of formula (I) is:

[0256]

[0257] In certain embodiments, R 4a is H. In certain embodiments, R 4b is H. In certain embodiments, R 4c is H. In certain embodiments, R 4d is H.

[0258] In certain embodiments, R 5 is methyl.

[0259] In certain embodiments, R 6 is H.

[0260] In certain embodiments, each occurrence of Z is independently:

[0261]

[0262] Wherein:

[0263] R 7a 、R 7b 、R 7c and R 7d each occurrence of is independently selected from the group consisting of H, C1-C6 alkyl, and C1-C6 haloalkyl,

[0264] wherein, R 7a 、R 7b 、R 7c and R 7d at least one of is not H; and

[0265] each occurrence of o is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

[0266] In certain embodiments, R 7a is H. In certain embodiments, R 7b is H. In certain embodiments, R 7c is H. In certain embodiments, R 7d is H. In certain embodiments, R 7a is methyl. In certain embodiments, R 7b is methyl. In certain embodiments, R 7c is methyl. In certain embodiments, R 7d is methyl.

[0267] In certain embodiments, Z is -(CH2) 4-10 -CH(CH3)-*. In certain embodiments, Z is -(CH2) 4-10 -C(CH3)2-*. In certain embodiments, Z is -(CH2) 4-1 0-CH(CH3)-CH2-*.

[0268] In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is In certain embodiments, R 3a is

[0269] In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is In certain embodiments, R 3b is

[0270] In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is In certain embodiments, R 3c is

[0271] In certain embodiments, each occurrence of an optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted aralkyl, optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted cycloalkylene and optionally substituted heterocycloalkylene (if present) is independently optionally substituted with at least one substituent selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, C1-C3 haloalkoxy, phenoxy, halogen, CN, NO2, OH, N(R’)(R”), C(=O)R’, C(=O)OR’, OC(=O)OR’, C(=O)N(R’)(R”), S(=O)2N(R’)(R”), N(R’)C(=O)R”, N(R’)S(=O)2R”, C2-C8 heteroaryl and phenyl optionally substituted with at least one halogen, wherein each occurrence of R’ and R” is independently selected from the group consisting of H, C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, benzyl and phenyl.

[0272] In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is: In certain embodiments, the compound of formula (I) is:

[0273] In certain embodiments, at least one ionizable lipid of formula (I) accounts for about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or about 90 mol% of the LNP.

[0274] In certain embodiments, at least one ionizable lipid of formula (I) accounts for less than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or about 90 mol% of the LNP.

[0275] In certain embodiments, at least one ionizable lipid of formula (I) comprises greater than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or about 90 mol% of the LNP.

[0276] In certain embodiments, at least one ionizable lipid of formula (I) comprises about 35 mol% of the LNP. In certain embodiments, at least one ionizable lipid of formula (I) comprises less than about 35 mol% of the LNP. In certain embodiments, at least one ionizable lipid of formula (I) comprises greater than about 35 mol% of the LNP.

[0277] In certain embodiments, at least one ionizable lipid of formula (I) comprises about 40 mol% of the LNP. In certain embodiments, at least one ionizable lipid of formula (I) comprises less than about 40 mol% of the LNP. In certain embodiments, at least one ionizable lipid of formula (I) comprises greater than about 40 mol% of the LNP.

[0278] In certain embodiments, at least one neutral lipid comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or about 40 mol% of the LNP.

[0279] In certain embodiments, at least one neutral lipid comprises less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or about 40 mol% of the LNP.

[0280] In certain embodiments, at least one neutral lipid comprises greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or about 40 mol% of the LNP.

[0281] In certain embodiments, at least one neutral lipid comprises about 16 mol% of the LNP. In certain embodiments, at least one neutral lipid comprises less than about 16 mol% of the LNP. In certain embodiments, at least one neutral lipid comprises greater than about 16 mol% of the LNP.

[0282] In certain embodiments, at least one neutral lipid comprises about 30 mol% of the LNP. In certain embodiments, at least one neutral lipid comprises less than about 30 mol% of the LNP. In certain embodiments, at least one neutral lipid comprises greater than about 30 mol% of the LNP.

[0283] In certain embodiments, at least one neutral lipid comprises dioleoylphosphatidylethanolamine (DOPE). In certain embodiments, at least one neutral lipid comprises distearoylphosphatidylcholine (DSPC). In certain embodiments, at least one neutral lipid comprises dioleoylphosphatidylcholine (DOPC).

[0284] In certain embodiments, cholesterol comprises about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or about 75 mol% of the LNP.

[0285] In certain embodiments, cholesterol comprises less than about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or about 75 mol% of the LNP.

[0286] In certain embodiments, cholesterol comprises greater than about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or about 75 mol% of the LNP.

[0287] In certain embodiments, cholesterol comprises about 25 mol% of the LNP. In certain embodiments, cholesterol comprises less than about 25 mol% of the LNP. In certain embodiments, cholesterol comprises greater than about 25 mol% of the LNP.

[0288] In certain embodiments, cholesterol comprises about 46.5 mol% of the LNP. In certain embodiments, cholesterol comprises less than about 46.5 mol% of the LNP. In certain embodiments, cholesterol comprises greater than about 46.5 mol% of the LNP.

[0289] In certain embodiments, at least one conjugated lipid comprises about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, or about 15.0 mol% of the LNP.

[0290] In certain embodiments, at least one conjugated lipid comprises less than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, or about 15.0 mol% of the LNP.

[0291] In certain embodiments, at least one conjugated lipid comprises greater than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, or about 15.0 mol% of the LNP.

[0292] In certain embodiments, at least one conjugated lipid comprises 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000 )

[0293] In certain embodiments, the LNP has a molar ratio of (a):(b):(c):(d) of about 35:16:46.5:2.5. In certain embodiments, the LNP has a molar ratio of (a):(b):(c):(d) of about 40:30:25:2.5.

[0294] In certain embodiments, the nucleic acid molecule is a therapeutic agent. In certain embodiments, the nucleic acid molecule comprises RNA. In certain embodiments, the nucleic acid molecule comprises DNA. In certain embodiments, the nucleic acid molecule comprises mRNA. In certain embodiments, the nucleic acid molecule comprises cDNA. In certain embodiments, the nucleic acid molecule comprises miRNA. In certain embodiments, the nucleic acid molecule comprises siRNA. In certain embodiments, the nucleic acid molecule comprises modified RNA.

[0295] In certain embodiments, the nucleic acid is mRNA.

[0296] In certain embodiments, the LNP has an (a):mRNA mass ratio of about 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1 or about 5:1 (w / w). In certain embodiments, the LNP has an (a):mRNA mass ratio of about 10:1.

[0297] In certain embodiments, the mRNA encodes a chimeric antigen receptor (CAR). In certain embodiments, the CAR specifically binds to a surface antigen of a pathogenic cell or a tumor cell. In certain embodiments, the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD5RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligand, B7-H6, IL13R-α2, MUC1, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, fetal AchR, NKG2D ligand, TEM1, and TEM8.

[0298] In certain embodiments, the mRNA encodes an enzyme. In certain embodiments, the mRNA encodes a clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein, optionally wherein the CRISPR-associated protein is Cas9. In certain embodiments, the mRNA further encodes a small guide RNA (sgRNA).

[0299] Method

[0300] In another aspect, the present disclosure provides a method for treating, preventing, and / or ameliorating a disease in a subject. In certain embodiments, the method comprises administering to the subject at least one lipid nanoparticle (LNP) of the present disclosure and / or at least one pharmaceutical composition of the present disclosure.

[0301] In certain embodiments, the LNPs of the present disclosure can be used to treat, prevent, and / or ameliorate any one of a number of diseases and / or disorders. In certain embodiments, the LNPs of the present disclosure are suitable for treating, preventing, and / or ameliorating diseases and / or disorders for which mRNA delivery and / or gene therapy is useful (e.g., cancer immunotherapy). In certain embodiments, the LNPs of the present disclosure are applicable to treating, preventing, and / or ameliorating diseases and / or disorders including autoimmune diseases, cardiovascular diseases, and neurological diseases, among others. In certain embodiments, the LNPs of the present disclosure are suitable for gene editing applications, including gene editing of liver, brain, lung, and / or hematopoietic cells for monogenic diseases.

[0302] In certain embodiments, the disease is cancer. In certain embodiments, the cancer is at least one selected from the group consisting of pancreatic cancer, colorectal cancer, bladder cancer, breast cancer, prostate cancer, kidney cancer, hepatocellular carcinoma, lung cancer, ovarian cancer, cervical cancer, gastric cancer, esophageal cancer, head and neck cancer, melanoma, neuroendocrine cancer, CNS cancer, brain cancer, bone cancer, soft tissue sarcoma, non-small cell lung cancer, small cell lung cancer, or colon cancer. In certain embodiments, at least one additional agent or therapy for treating, preventing, and / or ameliorating cancer in the subject is further administered to the subject.

[0303] In certain embodiments, the subject is a mammal. In certain embodiments, the mammal is a human.

[0304] In another aspect, the present disclosure provides a method of delivering a nucleic acid or therapeutic agent to the liver of a subject. In certain embodiments, the method comprises administering to the subject at least one lipid nanoparticle (LNP) of the present disclosure and / or at least one pharmaceutical composition of the present disclosure.

[0305] In another aspect, the present disclosure provides a method of preparing a modified immune cell or its precursor. In certain embodiments, the method comprises contacting the immune cell or its precursor with at least one lipid nanoparticle (LNP) of the present disclosure and / or at least one pharmaceutical composition.

[0306] In certain embodiments, the modified immune cell or its precursor is an αβ T cell, γδ T cell, CD8 + T cell, CD4 + helper T cell, CD4 + regulatory T cell, NK T cell, NK cell, and any combination thereof.

[0307] In certain embodiments, the modified immune cell or its precursor is a T cell, optionally wherein the T cell is a CD4 + T cell. In certain embodiments, the modified immune cell or its precursor is an NK cell.

[0308] In another aspect, the present disclosure provides a method for preparing a compound of formula (2-2) or a salt, solvate, stereoisomer or isotopic isomer thereof:

[0309]

[0310] In certain embodiments, the method comprises contacting a compound of formula (1-4) and a compound of formula (2-1):

[0311]

[0312]

[0313] wherein:

[0314] Each occurrence of L is independently selected from the group consisting of a bond, -(optionally substituted C1-C 12 alkylene)-X-, -(optionally substituted C2-C 12 alkenylene)-X-, -(optionally substituted C1-C 12 alkynylene)-X-, -(optionally substituted C1-C 12 heteroalkylene)-X-, optionally substituted C3-C8 cycloalkylene, and optionally substituted C2-C8 heterocycloalkylene;

[0315] Each occurrence of R’ is independently an optionally substituted C1-C 12 alkyl, wherein each occurrence of R’ includes at least one tertiary carbon;

[0316] Each occurrence of m is independently an integer selected from the group consisting of 1, 2, 3, and 4; and

[0317] Each occurrence of s is independently an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

[0318] In certain embodiments, the contacting occurs in the presence of a solvent, optionally wherein the solvent comprises ethanol (EtOH). In certain embodiments, the contacting occurs at a temperature of about 70 °C to about 90 °C, optionally wherein the contacting occurs at a temperature of about 80 °C. In certain embodiments, the contacting occurs for a period of about 1 h to about 72 h, optionally wherein the contacting occurs for a period of about 48 h.

[0319] In certain embodiments, the compound of formula (1-4) is prepared by contacting a compound of formula (1-3) and an organomagnesium compound of formula R’-MgX 3 :

[0320]

[0321] wherein X3 Selected from the group consisting of Cl, Br, and I.

[0322] In certain embodiments, the contacting occurs in the presence of a suitable epoxidizing reagent, optionally wherein the epoxidizing reagent is m-chloroperoxybenzoic acid. In certain embodiments, the contacting occurs in the presence of a solvent, optionally wherein the solvent comprises dichloromethane.

[0323] In certain embodiments, the compound of formula (1-2) and an organomagnesium compound of formula R’-MgX are contacted to prepare a compound of formula (1-3): 3

[0324]

[0325] wherein X 1 and X 3 are each independently selected from the group consisting of Cl, Br, and I.

[0326] In certain embodiments, the contacting occurs in the presence of a suitable catalyst, optionally wherein the catalyst comprises Li2CuCl4. In certain embodiments, the contacting occurs in the presence of a solvent, optionally wherein the solvent comprises at least one selected from the group consisting of tetrahydrofuran (THF) and N-methylpyrrolidone (NMP).

[0327] In certain embodiments, the compound of formula (1-1) and an alcohol base are contacted to prepare a compound of formula (1-2):

[0328]

[0329] wherein X 1 、X 2 and X 3 are each independently selected from the group consisting of Cl, Br, and I.

[0330] In certain embodiments, the contacting occurs in the presence of a solvent, optionally wherein the solvent comprises THF. In certain embodiments, the alcohol base comprises a tert-butyl alcohol base, optionally wherein the tert-butyl alcohol base is potassium tert-butoxide. In certain embodiments, the contacting occurs at a temperature of about 60 °C to about 80 °C.

[0331] Pharmaceutical composition

[0332] In another aspect, the present disclosure provides a pharmaceutical composition comprising the lipid nanoparticles (LNPs) of the present disclosure and at least one pharmaceutically acceptable carrier. In certain embodiments, the composition further comprises at least one adjuvant.

[0333] Such a pharmaceutical composition may consist of at least one composition of the present invention in a form suitable for administration to a subject, or the pharmaceutical composition may comprise at least one composition and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or any combination thereof. As is known in the art, at least one composition of the present invention may be present in the pharmaceutical composition in the form of a physiologically acceptable salt, such as in combination with a physiologically acceptable cation or anion.

[0334] In certain embodiments, the pharmaceutical composition useful for practicing the methods of the present invention may be administered to deliver a dose between 1 ng / kg / day and 100 mg / kg / day. In other embodiments, the pharmaceutical composition useful for practicing the present disclosure may be administered to deliver a dose between 1 ng / kg / day and 1000 mg / kg / day.

[0335] The relative amounts of the active ingredient, pharmaceutically acceptable carrier, and any additional ingredients in the pharmaceutical composition of the present invention will vary depending on the identity, volume, and condition of the subject being treated, and further depending on the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) of the active ingredient.

[0336] The pharmaceutical compositions useful in the methods of the present invention may be appropriately developed for nasal, inhalation, oral, rectal, vaginal, pleural, peritoneal, parenteral, topical, transdermal, pulmonary, intranasal, oral, ocular, epidural, intrathecal, intravenous, or other routes of administration. The compositions useful in the methods of the present invention may be administered directly to the brain, brainstem, or any other part of the central nervous system of a mammal or bird. Other formulations considered include projected nanoparticles, microspheres, liposomal formulations, coated particles, polymer conjugates, re-encapsulated red blood cells containing the active ingredient, and immunology-based formulations.

[0337] In certain embodiments, the composition of the present invention is part of a pharmaceutical matrix that allows manipulation of insoluble materials and improvement of their bioavailability, development of controlled or sustained release products, and generation of homogeneous compositions. By way of example, hot melt extrusion, solid solutions, solid dispersions, size reduction techniques, molecular complexes (e.g., cyclodextrins and others), microparticles, and particle and formulation coating processes may be used to prepare the pharmaceutical matrix. Either amorphous or crystalline phases may be used in such processes.

[0338] The route of administration will be apparent to those skilled in the art and will depend on many factors, including the type and severity of the disease being treated, the type and age of the animal or human patient being treated, and the like.

[0339] The formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the fields of pharmacology and pharmacy. Generally, such methods of preparation include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then (if necessary or desired) shaping or packaging the product into the desired single-dose or multi-dose unit.

[0340] As used herein, a "unit dose" is a pharmaceutical composition that comprises a discrete amount of a predetermined quantity of the active ingredient. The quantity of the active ingredient is usually equal to the dose of the active ingredient to be administered to a subject or a convenient fraction of that dose, such as, for example, one-half or one-third of that dose. The unit dosage form can be used for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 times or more per day). When multiple daily doses are used, the unit dosage form for each dose may be the same or different.

[0341] Although the description of the pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for ethical administration to humans, those skilled in the art will understand that such compositions are generally suitable for administration to a variety of animals. Modifying a pharmaceutical composition suitable for administration to humans to render the composition suitable for administration to a variety of animals is well known, and an ordinarily skilled veterinary pharmacologist can design and carry out such modifications by only ordinary (if any) experimentation. Subjects contemplated for administration of the pharmaceutical compositions of the present disclosure include, but are not limited to, humans and other primates, mammals (including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs).

[0342] In certain embodiments, the compositions of the present invention are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the present invention comprise a therapeutically effective amount of at least one compound of the present invention and a pharmaceutically acceptable carrier. Useful pharmaceutically acceptable carriers include, but are not limited to, glycerol, water, saline, ethanol, recombinant human albumin (e.g., ), soluble gelatin (e.g., ) and other pharmaceutically acceptable salt solutions (such as phosphates and organic salts). Examples of these and other pharmaceutically acceptable carriers are described in Remington’s Pharmaceutical Sciences (1991, Mack Publishing Co., New Jersey).

[0343] The carrier can be a solvent or a dispersion medium, which includes, for example, water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol, etc.), recombinant human albumin, soluble gelatin, their suitable mixtures, and vegetable oils. The desired particle size can be maintained in the case of dispersion by using coatings such as lecithin, and the appropriate fluidity can be maintained by using surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents (such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc.). In many cases, isotonizing agents, such as sugars, sodium chloride, or polyols (such as mannitol and sorbitol), are included in the composition. Prolonged absorption of injectable compositions can be achieved by including reagents that delay absorption (such as aluminum monostearate or gelatin) in the composition.

[0344] The formulations can be used in mixtures with conventional excipients, which are pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, inhalation, intravenous, subcutaneous, transdermal enteral, or any other suitable mode of administration known in the art. The pharmaceutical formulations can be sterilized and, if desired, mixed with adjuvants (such as lubricants, preservatives, stabilizers, wetting agents, emulsifying agents, salts for influencing osmotic pressure buffers, colorants, flavoring agents, and / or substances imparting fragrance, etc.). They can also be combined with other active agents (such as other analgesics, anxiolytics, or hypnotics) when needed. As used herein, "additional ingredients" includes, but is not limited to, one or more ingredients that can be used as pharmaceutical carriers.

[0345] The compositions of the present invention can include preservatives in an amount of about 0.005% to 2.0% by weight of the total composition. Preservatives are used to prevent spoilage when exposed to environmental contaminants. Examples of useful preservatives according to the present invention include, but are not limited to, those selected from the group consisting of benzyl alcohol, sorbic acid, parabens, imidurea, and any combination thereof. One such preservative is a combination of about 0.5% to 2.0% benzyl alcohol and 0.05 - 0.5% sorbic acid.

[0346] The composition may include antioxidants and chelating agents that inhibit the degradation of the compounds. Antioxidants for some compounds are BHT, BHA, α-tocopherol, and ascorbic acid, with an exemplary range of about 0.01% to 0.3% by weight, or BHT in the range of 0.03% to 0.1% by weight of the total weight of the composition. The chelating agent is present in an amount of 0.01% to 0.5% by weight of the total weight of the composition. Exemplary chelating agents include edetates (e.g., disodium edetate) and citric acid, with a weight range of about 0.01% to 0.20% by weight of the total weight of the composition, or a weight range of 0.02% to 0.10% by weight. Chelating agents can be used to chelate metal ions in the composition that may be detrimental to the shelf life of the formulation. Although BHT and disodium edetate are exemplary antioxidants and chelating agents for some compounds, other suitable and equivalent antioxidants and chelating agents known to those skilled in the art can be substituted.

[0347] Liquid suspensions can be prepared using conventional methods to achieve the suspension of the active ingredient in an aqueous or oily carrier. Aqueous carriers include, for example, water and isotonic saline. Oily carriers include, for example, almond oil, fatty esters, ethanol, vegetable oils (such as peanut oil, olive oil, sesame oil, or coconut oil), fractionated vegetable oils, and mineral oils (such as liquid paraffin). The liquid suspension may further include one or more additional ingredients, including but not limited to suspending agents, dispersing agents or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavoring agents, coloring agents, and sweetening agents. Oily suspensions may further include thickening agents. Known suspending agents include but are not limited to sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, tragacanth gum, acacia gum, and cellulose derivatives (such as sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose). Known dispersing agents or wetting agents include but are not limited to naturally occurring phospholipids (such as lecithin), condensation products of alkylene oxides with fatty acids, with long-chain fatty alcohols, with partial esters derived from fatty acids and hexitols, or with partial esters derived from fatty acids and hexitol anhydrides (for example, polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitan monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifying agents include but are not limited to lecithin, acacia, and ionic or non-ionic surfactants. Known preservatives include but are not limited to methyl, ethyl, or n-propyl paraben, ascorbic acid, and sorbic acid. Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin.

[0348] Liquid solutions of the active ingredient in aqueous or oily solvents can be prepared in substantially the same manner as liquid suspensions, the main difference being that the active ingredient is dissolved rather than suspended in the solvent. As used herein, an "oily" liquid is a liquid that includes carbon-containing liquid molecules and exhibits less polar characteristics than water. Liquid solutions of the pharmaceutical compositions of the present invention may include each of the components described with respect to liquid suspensions, it being understood that suspending agents do not necessarily aid in the dissolution of the active ingredient in the solvent. Aqueous solvents include, for example, water and isotonic saline. Oily solvents include, for example, almond oil, fatty esters, ethanol, vegetable oils (such as peanut oil, olive oil, sesame oil or coconut oil), fractionated vegetable oils and mineral oils (such as liquid paraffin).

[0349] The pharmaceutical compositions of the present invention can also be prepared, packaged or sold in the form of oil-in-water emulsions or water-in-oil emulsions. The oil phase can be a vegetable oil (such as olive oil or peanut oil), a mineral oil (such as liquid paraffin) or a combination thereof. Such compositions may further include one or more emulsifiers, such as naturally occurring gums (such as gum acacia or gum tragacanth), naturally occurring phospholipids (such as soy or lecithin phospholipids), esters or partial esters derived from combinations of fatty acids and hexitol anhydrides (such as sorbitan monooleate), and condensation products of such partial esters with ethylene oxide (such as polyoxyethylene sorbitan monooleate). These emulsions may also include additional ingredients, including, for example, sweeteners or flavoring agents.

[0350] Methods for impregnating or coating materials with chemical compositions are known in the art and include, but are not limited to, methods of depositing or binding a chemical composition to a surface, methods of incorporating a chemical composition into the structure of a material during synthesis of the material (e.g., as using a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material with or without subsequent drying. Methods for mixing components include physical grinding, using granules in solid and suspension formulations, and mixing in transdermal patches, as known to those skilled in the art.

[0351] Administration / Dose

[0352] The administration regimen may affect what constitutes an effective amount. A therapeutic formulation may be administered to a patient before or after the onset of a disease or disorder. In addition, several divided doses and staggered doses may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus. In addition, the dose of the therapeutic formulation may be increased or decreased proportionally, as indicated by the exigency of the therapeutic or prophylactic situation.

[0353] Administration of the compositions of the present disclosure to a patient (such as a mammal, such as a human) can be carried out using known procedures in a dose and for a period of time effective to treat the diseases or disorders described herein. The effective amount of the therapeutic agent (i.e., the composition) required to achieve a therapeutic effect can vary depending on factors such as the activity of the particular therapeutic agent used; the time of administration; the excretion rate of the composition; the duration of treatment; other drugs, compounds or materials used in combination with the composition; the state of the disease or disorder, age, sex, body weight, condition, general health and medical history of the patient being treated, and similar factors known to the medical community. The dosage regimen can be adjusted to provide the optimal therapeutic response. For example, several divided doses can be administered daily, or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of the effective dose range of the therapeutic composition of the present disclosure is from about 0.01 mg / kg to 100 mg / kg body weight per day of the active agent (i.e., nucleic acid). A person of ordinary skill in the art will be able to study the relevant factors and determine the effective amount of the therapeutic composition without undue experimentation.

[0354] The composition can be administered to an animal several times a day, or it can be administered to the animal less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every few months or even once a year or less. It should be understood that, in non-limiting examples, the amount of the composition of the daily dose can be administered daily, every other day, every 2 days, every 3 days, every 4 days or every 5 days. For example, for administration every other day, a dose of 5 mg per day can be administered starting on Monday, followed by a first dose of 5 mg per day on Wednesday, followed by a second dose of 5 mg per day on Friday, and so on. The frequency of the dose will be apparent to the skilled artisan and depends on many factors, such as but not limited to the type and severity of the disease being treated, and the type and age of the animal.

[0355] The actual dosage level of the active ingredient in the pharmaceutical compositions of the present disclosure can be varied so as to obtain an effective amount of the active ingredient to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0356] A physician (e.g., a medical doctor or veterinarian) having ordinary skill in the art can readily determine and prescribe the effective amount of the required pharmaceutical composition. For example, a physician or veterinarian can start with a dose of the compound of the present disclosure used in the pharmaceutical composition at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved.

[0357] In certain embodiments, it is particularly advantageous to formulate the compounds in dosage unit form for ease of administration and uniformity of dosage. As used herein, a dosage unit form refers to physically discrete units suitable as a single dose for the patient to be treated; each unit contains a predetermined quantity of the therapeutic composition calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The dosage unit forms of the present disclosure depend on and are directly dependent on (a) the unique characteristics of the therapeutic composition and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such therapeutic composition for the treatment of the diseases or disorders of patients.

[0358] In some embodiments, the dosage of the compositions of the present disclosure administered to a patient ranges from 1 to 5 times or more per day. In other embodiments, the dosage of the compositions of the present disclosure administered to a patient ranges from, but is not limited to, once a day, once every two days, once every three days to once a week, and once every two weeks. It will be apparent to those skilled in the art that, depending on many factors including, but not limited to, age, the disease or disorder to be treated, gender, general health, and other factors, the frequency of administration of the various combination compositions of the present disclosure will vary from subject to subject. Accordingly, the present disclosure should not be construed as being limited to any particular dosage regimen, and the exact dosage and composition to be administered to any patient will be determined by the attending physician taking into account all other factors regarding the patient.

[0359] The amount of the active agent of the compositions of the present disclosure for administration can be in the range of about 1 μg to about 7500 mg, about 20 μg to about 7000 mg, about 40 μg to about 6500 mg, about 80 μg to about 6000 mg, about 100 μg to about 5500 mg, about 200 μg to about 5000 mg, about 400 μg to about 4000 mg, about 800 μg to about 3000 mg, about 1 mg to about 2500 mg, about 2 mg to about 2000 mg, about 5 mg to about 1000 mg, about 10 mg to about 750 mg, about 20 mg to about 600 mg, about 30 mg to about 500 mg, about 40 mg to about 400 mg, about 50 mg to about 300 mg, about 60 mg to about 250 mg, about 70 mg to about 200 mg, about 80 mg to about 150 mg, and any and all whole or partial increments therebetween.

[0360] In some embodiments, the dosage of the active agent (i.e., nucleic acid) present in the compositions of the present disclosure is from about 0.5 μg to about 5000 mg. In some embodiments, the dosage of the active agent present in the compositions of the present disclosure used in the compositions described herein is less than about 5000 mg, or less than about 4000 mg, or less than about 3000 mg, or less than about 2000 mg, or less than about 1000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, the dosage of the second compound as described herein is less than about 1000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and all or part increments thereof.

[0361] In certain embodiments, the present disclosure relates to a packaged pharmaceutical composition comprising a container that houses a therapeutically effective amount of the composition of the present disclosure, either alone or in combination with a second agent; and instructions for using the compound to treat, prevent, or alleviate one or more symptoms of a disease or disorder in a patient.

[0362] The term "container" includes any container for housing a pharmaceutical composition or for managing stability or water absorbency. For example, in certain embodiments, the container is a package that includes a pharmaceutical composition such as a liquid (solution and suspension), semi-solid, lyophilized solid, solution and powder, or lyophilized formulation present in a two-chamber. In other embodiments, the container is not a package that contains the pharmaceutical composition, i.e., the container is a receptacle such as a box or bottle that contains the packaged pharmaceutical composition or the unpackaged pharmaceutical composition and the instructions for use of the pharmaceutical composition. Additionally, packaging techniques are known in the art. It should be understood that the instructions for use of the pharmaceutical composition can be included on the package that contains the pharmaceutical composition, and thus the instructions form an additional functional relationship with the packaged product. However, it should be understood that the instructions can contain information related to the ability of the compound to perform its intended function, e.g., the ability to treat, prevent, or reduce a disease or disorder in a patient.

[0363] Administration

[0364] Routes of administration of any composition of the present disclosure include inhalation, oral, nasal, rectal, parenteral, sublingual, transdermal, transmucosal (e.g., sublingual, lingual, (trans)oral, (trans)urethral, vaginal (e.g., transvaginal and perivaginal), nasal (intra) and (trans)rectal), intravesical, intralung, intraduodenal, enteral, intrathecal, epidural, intrathoracic, intraperitoneal, subcutaneous, intramuscular, intradermal, intraarterial, intravenous, intrabronchial, inhalational, and topical administration.

[0365] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, emulsions, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, ointments, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration, and the like. It should be understood that the formulations and compositions useful in the present disclosure are not limited to the specific formulations and compositions described herein.

[0366] Parenteral administration

[0367] As used herein, "parenteral administration" of a pharmaceutical composition includes any route of administration characterized by physically disrupting the tissue of a subject and administering the pharmaceutical composition through the disruption in the tissue. Thus, parenteral administration includes, but is not limited to, administering the pharmaceutical composition by injecting the composition, by surgically incising the composition, by penetrating the tissue of a non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intravenous, intraperitoneal, intramuscular, intrasternal injection, and hemodialysis infusion techniques.

[0368] Formulations of pharmaceutical compositions suitable for parenteral administration include the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in an ampule or in a multi-dose container containing a preservative. Injectable formulations may also be prepared, packaged, or sold in a patient-controlled analgesia (PCA) device. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous carriers, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further include one or more additional ingredients, including, but not limited to, suspending agents, stabilizing agents, or dispersing agents. In certain embodiments of formulations for parenteral administration, the active ingredient is provided in a dry (i.e., powder or granule) form for reconstitution with a suitable carrier (e.g., sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.

[0369] The pharmaceutical composition can be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. The suspension or solution can be formulated according to known techniques and, in addition to the active ingredient, can include additional ingredients such as dispersing agents, wetting agents, or suspending agents as described herein. Such sterile injectable preparations can be prepared using non-toxic parenterally acceptable diluents or solvents such as water or 1,3-butanediol. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic monoglycerides or diglycerides. Other useful parenterally administrable preparations include preparations containing the active ingredient in microcrystalline form in recombinant human albumin, fluid gelatin, liposome formulations, or preparations containing the active ingredient as a component of a biodegradable polymer system. Compositions for sustained release or implantation can include pharmaceutically acceptable polymers or hydrophobic materials such as emulsions, ion exchange resins, slightly soluble polymers, or slightly soluble salts.

[0370] Examples

[0371] The various embodiments of the present application can be better understood by reference to the following examples provided by way of illustration. The scope of the present application is not limited to the examples given herein.

[0372] Materials and Methods

[0373] Materials

[0374] All non-IL LNP lipid excipients and lipids for preparing artificial endosomes were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Cas9 and 5-methoxyuridine-substituted firefly luciferase mRNA were purchased from TriLink Biotechnologies (San Diego, CA, USA). TTR sgRNA was synthesized by Axolabs (Kulmbach, Germany) using the following sequence: 5’-ususasCAGCCACGUCUACAGCAGUUUUAGAgcuagaaauagcAAGUUAAAAUAAGGCUAGUCCGUUAUCAacuugaaaaaguggcaccgagucggugcusususu-3’ (SEQ ID NO:1), where N represents an RNA residue, n is a 2’-O-methyl residue, and s is a phosphorothioate backbone modification.

[0375] The chemicals 1,2-epoxyoctane, 1,2-epoxydecane, 1,2-epoxydodecane, 1,2-epoxytetradecane, and 8-bromo-1-octene were purchased from TCI (Montgomeryville, PA, USA); Triton X-100 was purchased from Alfa Aesar (Haverhill, MA, USA), 1,12-dibromodecane and N1-(2-(4-(2-aminoethyl)piperazin-1-yl)ethyl)ethane-1,2-diamine were purchased from AmBeed (Arlington Heights, IL, USA); anhydrous 1-methyl-2-pyrrolidone and chloroform-d were purchased from Acros Organics (Geel, Belgium); all non-anhydrous solvents, as well as anhydrous magnesium sulfate and 1 N hydrochloric acid, were purchased from Fisher Scientific (Waltham, MA, USA); 10-bromo-1-decene was purchased from Oakwood Chemicals (Estill, SC, USA); 6-bromo-1-hexene was purchased from Asta Tech (Bristol, PA, USA); 2-{2-[4-(2-{[2-(2-aminoethoxy)ethyl]amino}ethyl)piperazin-1-yl]ethoxy}ethan-1-amine was purchased from Enamine (Kiev, Ukraine). All other chemical reagents were purchased from MilliporeSigma (St. Louis, MO, USA).

[0376] Synthesis

[0377] All flash chromatography was performed on a Teledyne Isco (Lincoln, NE, USA) CombiFlash NextGen 300+ equipped with evaporative light scattering detection using a RediSep silica disposable flash chromatography column. Solvent evaporation was performed using a Büchi (New Castle, DE, USA) R-300 System Pro. H and 1 H and 13 C NMR spectra were obtained on an Avance Neo 400 MHz spectrometer (Bruker, Billerica, MA, USA) in d-chloroform. LC-MS spectra were obtained using an SQD equipped with an Acquity UPLC (Milford, MA, USA) using a C8 column, washing for 2 min, and then using a gradient mobile phase of 50% water (1% trifluoroacetic acid) and 50% acetonitrile (1% trifluoroacetic acid) to 100% acetonitrile (1% trifluoroacetic acid).

[0378] 12-bromododec-1-ene

[0379] Add 1,12-dibromodecane (8.00 g, 24.4 mmol, 2.0 equiv) and anhydrous tetrahydrofuran (20 mL) to a 250 mL round-bottom flask. Then, add dropwise potassium tert-butoxide (2.74 g, 24.4 mmol, 1.0 equiv) in anhydrous tetrahydrofuran (50 mL). The reaction was stirred at 70 °C for 16 h. Then, quench the reaction with deionized water (40 mL) and extract with hexane (3 x 35 mL). Combine the organic fractions, dry over magnesium sulfate, filter, and concentrate in vacuo. The crude product was further purified by flash chromatography, which was assisted by CombiFlash, using a liquid injection into an 80 g column. The mobile phase was n-hexane, with a flow rate of 20 mL / min for 10 min. The isolated product was a clear oil with a yield of 25.8%. 1 1H NMR (400 MHz, CDCl3) δ 5.82 (ddt, J = 16.9, 10.1, 6.7 Hz, 1H), 5.18–4.81 (m, 2H), 3.41 (td, J = 6.8, 1.0 Hz, 2H), 2.25–1.96 (m, 2H), 1.87 (dt, J = 14.5, 7.0 Hz, 2H), 1.64–1.01 (m, 14H). 13 13C NMR (101 MHz, CDCl3) δ 139.06, 114.12, 33.83, 33.77, 32.89, 29.52, 29.48, 29.46, 29.15, 28.96, 28.80, 28.21.

[0380] General procedure "A": Synthesis of branched alkenes

[0381] Purge a 100 mL Schlenk flask with nitrogen. Add anhydrous tetrahydrofuran (5 or 10 mL), N-methylpyrrolidone (48.0 mmol, 4.0 equiv), lithium tetrachlorocuprate (0.1 M in tetrahydrofuran; 0.36 mmol, 0.03 equiv), and the corresponding bromoalkene (12.0 mmol, 1.0 equiv) to the flask. The solution is stirred for 5 min at room temperature and under nitrogen. Then, the flask is placed in a water bath at room temperature. Then, the corresponding Grignard reagent (13.2 mmol, 1.1 equiv) is added dropwise. After 5 min, the flask is removed from the water bath and then stirred for 1 h at room temperature. Then, the flask is cooled to 0 °C and then quenched slowly with hydrochloric acid (1 M; 40 mL). The aqueous phase is extracted with hexane (3 x 20 mL), the organic layers are combined, washed with hydrochloric acid (1 M; 1 x 40 mL), washed with brine (2 x 40 mL), dried over magnesium sulfate, filtered, and concentrated in vacuo. The crude product is further purified by flash chromatography, which is carried out with the assistance of CombiFlash using a liquid injection in a 40 g column. The mobile phase is n-hexane with a flow rate of 7 mL / min. The separated product is a clear oil. The specific conditions for each reaction are shown in the Supplementary Information.

[0382] General procedure “B”: Synthesis of branched epoxides

[0383] Add the corresponding branched alkene (1.0 equiv) and dichloromethane (5 mL) to a 100 mL round-bottom flask. The flask is mixed for 1 min and then cooled to 0 °C. Then, a solution of meta-chloroperoxybenzoic acid (70% purity; 2.0 equiv) dissolved in dichloromethane (30 mL) is added dropwise to the flask. After stirring the mixture for 1 h, the other half of the meta-chloroperoxybenzoic acid dichloromethane solution is added dropwise. After 1 h, the reaction flask is removed from the 0 °C bath and stirred for 14 h at room temperature. The reaction is quenched by adding 20 mL of a 1:1 saturated sodium bicarbonate and saturated sodium thiosulfate solution. The layers are separated and the organic layer is rinsed with brine (1 x 30 mL). Then, the aqueous layers are combined and extracted with DCM (3 x 15 mL). The organic layers are combined, dried over magnesium sulfate, filtered, and concentrated in vacuo. The crude product is further purified by flash chromatography, which is carried out with the assistance of CombiFlash using a liquid injection in a 24 g column. The mobile phase has a gradient from 100% hexane to 90% hexane and 10% ethyl acetate with a flow rate of 35 mL / min for 15 min. The specific conditions for each reaction are shown in the Supplementary Information.

[0384] General procedure “C”: Synthesis of ionizable lipids

[0385] The corresponding polyamine core (1.0 equivalent), the corresponding epoxide (6.0 or 7.0 equivalents), and ethanol (0.3 mL) were added to a 1 dram vial. The reaction was stirred at 80 °C for 48 h. After that, the solution was diluted with dichloromethane (0.7 mL). The solution was purified by flash chromatography, which was injected into a 12 g column using a liquid with the assistance of CombiFlash. The mobile phase had a gradient from 95% dichloromethane and 5% Ultra solution (75% dichloromethane, 22% methanol, and 3% aqueous ammonium hydroxide) to 80% dichloromethane and 20% Ultra solution, with a flow rate of 7 mL / min for 35 min. The separated product was a yellow to clear viscous oil. The specific conditions for each reaction are shown in the supplementary information.

[0386] LNP formulation

[0387] An ethanol phase containing each lipid used in the formulation (i.e., ionizable lipid, neutral lipid, and lipid conjugate) and cholesterol and an aqueous phase containing mRNA were mixed using a microfluidic device to formulate LNP. The ethanol phase consisted of the corresponding ionizable lipid, 1,2-diacyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DMG-PEG2000) with fixed molar ratios of 35%, 16%, 46.5%, and 2.5% respectively. The aqueous phase consisted of mRNA dissolved in 10 mM citrate buffer. The aqueous phase and the ethanol phase were mixed using a Pump33DS syringe pump at flow rates of 1.8 mL / min and 0.6 mL / min. The LNP was dialyzed in 1X phosphate-buffered saline using a microdialysis cassette (20000 MWCO, Thermo Fisher Scientific, Waltham, MA) for 2 h and then filtered through a 0.22 μm filter.

[0388] LNP encapsulation efficiency

[0389] As previously described (Heyes et al., 2005, J. Controlled Release. 107:276 - 287), the mRNA encapsulation efficiency of each LNP formulation was calculated using Quant-iT-RiboGreen (Thermo Fisher Scientific, Waltham, MA) assay. Each LNP sample was diluted to approximately 2 ng / μL in two microcentrifuge tubes containing 1X TE buffer or 0.1% (v / v) Triton X-100 (Sigma-Aldrich). After 20 min, the LNPs in TE buffer and Triton X-100, as well as the mRNA standards, were plated in triplicate in a black 96-well plate, and the fluorescent RioGreen reagent was added according to the manufacturer's instructions. Fluorescence intensity was read on an Infinite 200Pro plate reader (Tecan) at an excitation wavelength of 480 nm and an emission wavelength of 520 nm. RNA content was estimated by comparison to a standard curve estimated using least squares linear regression (LSLR). The encapsulation efficiency was calculated as (B - A) / B·100, where A is the RNA content in TE buffer and B is the RNA content in Triton X-100. The encapsulation efficiency was reported as the mean ± standard deviation (n = 3).

[0390] Dynamic light scattering and ζ potential

[0391] For baseline dynamic light scattering (DLS) measurements, 10 μL of each LNP solution was diluted 100-fold in 1X PBS in a 4 mL disposable tube. For baseline ζ potential measurements, 20 μL of each LNP solution was diluted 50-fold in deionized water in a DTS1070 ζ potential cuvette (Malvern Panalytical, Malvern, UK). Four measurements of each sample were recorded using a Zetasizer Nano (Malvern Instruments, Malvern, UK), with at least 10 measurements per run. Data were reported as the mean ± standard deviation (n = 3 to 4 measurements).

[0392] LNP pKa measurement

[0393] Surface ionization measurements were performed as previously described (Hajj et al., 2019, Small, 15:1805097) to calculate the pKa of each LNP formulation. A buffer solution containing 150 mM sodium chloride, 20 mM sodium phosphate, 20 mM ammonium acetate, and 25 mM ammonium citrate was adjusted from pH 2 to 12 in 0.5 increments. 125 μL of each pH-adjusted solution and 5 μL of each LNP formulation were plated in triplicate in a black 96-well plate. Then, 6-(p-toluidino)naphthalene-2-sulfonic acid (TNS) was added to each well to a final TNS concentration of 6 μM. Fluorescence intensity was read on an Infinite 200Pro plate reader (Tecan, Morrisville, NC) at an excitation wavelength of 322 nm and an emission wavelength of 431 nm. Using the least-squares regression method, the pKa was the pH value corresponding to the half-maximal fluorescence intensity, i.e., 50% protonation.

[0394] In vitro delivery of LNP-mediated luciferase mRNA to HeLa cells

[0395] HeLa cells (ATCC no. CCL-2) were cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin in L-glutamine (Thermo Fisher Scientific). In a tissue culture-treated 96-well plate, cells were seeded at 20,000 cells per well in 100 μL of medium and allowed to adhere overnight. Cells were treated with LNP formulations at a dose of 20 ng mRNA (i.e., TriLink luciferase) per 20,000 cells. A group of cells was designated untreated and treated with medium only. After 24 h of LNP treatment, the medium was removed. 50 μL of 1X lysis buffer (Promega, Madison, WI) was added to each well, followed by 100 μL of luciferase assay substrate (Promega). After a 10-min incubation, luminescence was quantified using an Infinite 200Pro plate reader (Tecan). The luminescence signal for each condition was normalized by dividing by the luminescence signal of the LNP designated as the control (i.e., C14-494).

[0396] To assess cytotoxicity, additional plates were prepared as described elsewhere herein. After 24 h, 100 μL of CellTite Glo (Promega) was added to each well, and luminescence corresponding to ATP production was quantified using a plate reader after a 10-min incubation. Luminescence for each group was normalized by dividing by the luminescence signal of untreated control cells.

[0397] Luciferase expression and viability were reported as mean ± standard deviation (n = 3 - 4 biological replicates and at least 4 technical replicates per well). For luciferase expression, two-way ANOVA with Dunnett's multiple comparison test was used to compare the means across formulations and treatment conditions.

[0398] Luciferase Imaging and Quantification

[0399] Luciferase signals were evaluated after tail vein injection of luciferase mRNA in C57BL / 6 mice. Specifically, mice were imaged 12 h after I.V. injection of LNP or PBS. Luciferase imaging was performed using an in vivo imaging system (IVIS, PerkinElmer, Waltham, MA). Ten minutes prior to sacrifice and imaging, mice were injected intraperitoneally with D-luciferin 150 mg / kg and potassium salt (Biotium, Fremont, CA). Subsequently, the livers, spleens, lungs, kidneys, and hearts of the mice were excised and imaged by IVIS. Image analysis was performed using Living Image software (PerkinElmer). Reported whole-body and organ bioluminescence represented mean ± standard deviation (SD) (n ≥ 3). Representative organ IVIS images shown were the images with the highest luminescence values under each treatment condition.

[0400] In Vivo Biodistribution Studies

[0401] C57BL / 6J female mice, 6 - 8 weeks old, with an average body weight of 20 g, were purchased from Jackson Laboratory (Bar Harbor, ME). Mice were injected via the lateral tail vein with LNP encapsulating fluc mRNA at a dose of 0.1 mg mRNA per kg body weight (mg / kg). Twelve hours later, the ventral hair of the mice was removed using Veet Gel hair remover cream (Reckitt Benckiser, Slough, UK). Then, the mice were injected intraperitoneally with D-luciferin (0.2 mL, 15 mg / mL; Biotium, Fremont, CA). Five minutes later, whole-body luminescence images were obtained using an in vivo imaging system (IVIS; PerkinElmer, Waltham, MA). Subsequently, the mice were euthanized, and the hearts, lungs, livers, kidneys, and spleens were excised and imaged by IVIS to obtain luminescence. Luminescence flux was quantified using Living Image software (PerkinElmer) by placing rectangular regions of interest (ROIs) around the whole-body or organ images and maintaining the same ROI size between each body or organ. Total flux was reported as mean ± SEM for n = 3 biological replicates.

[0402] TTR Gene Editing

[0403] One day before injection, blood was collected from mice by retro-orbital bleeding. Serum was separated by centrifuging the blood at 3500 rpm for 15 min in Microtainer blood collection tubes containing serum separator gel (BD, Franklin Lakes, NJ, USA). Mice were injected with 1.0 mg / kg of LNP via the tail vein, and the LNP encapsulated Cas9 mRNA and TTR-sgRNA at a molar ratio of 1:3. Serum was separated 7 days later as described above, and the mice were sacrificed and the livers were removed. Serum TTR levels were measured using a mouse prealbumin ELISA kit (Aviva Systems Biology, San Diego, CA, USA) according to the manufacturer's instructions.

[0404] For indel analysis, DNA was extracted from the liver using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) and quantified using the nanodrop plate attachment on an Infinite 200Pro plate reader (Tecan). PCR amplification of the TTR target was performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and the following primer sequences: mTTR-exon2-F, 5’-CGGTTTATCTGACCATTTC-3’ (SEQ ID NO:2) and mTTR-exon2-R, 5’-GGGCTTTCTACAAGCTTACC-3’ (SEQ ID NO:3). Deep sequencing of the TTR amplicon and determination of the on-target indel frequency were performed essentially as described, except that 150 bp paired-end reads were generated.

[0405] Primary T cell luminescence

[0406] In some embodiments, the present disclosure provides primary T cell luminescence data obtained using healthy human donor T cells to evaluate the LNPs of the present disclosure. Cells were plated at 60,000 cells per well and 200 ng mRNA per well (i.e., TriLink luciferase) and treated with the LNPs of the present disclosure.

[0407] A group of cells was designated as untreated and treated with only the culture medium. After treatment with LNP for 24 hours, the cells were centrifuged at 700 g for 5 min and the culture medium was removed. 50 μL of 1X lysis buffer (Promega, Madison, WI) was added to each well, followed by 100 μL of luciferase assay substrate (Promega). After incubation for 10 minutes, the luminescence was quantified using an Infinite 200Pro plate reader (Tecan). The luminescence signal for each condition was normalized by dividing by the luminescence signal of the LNP designated as the control (i.e., C14-494). For the expression of luciferase, a one-way ANOVA multiple comparison test with Sidak multiple comparison correction was used, which used the B10 preparation as the control group. In addition, a two-way ANOVA with Dunnett multiple comparison test was used to compare the means on the preparation and treatment conditions.

[0408] To evaluate cytotoxicity, additional plates were prepared as described elsewhere herein. After 24 hours, the cells were centrifuged at 700 g for 5 min, and 100 μL of CellTite Glo (Promega) was added to each well, and the luminescence corresponding to ATP production was quantified using a plate reader after culturing for 10 minutes. The luminescence of each group was normalized by dividing by the luminescence signal of the untreated control cells.

[0409] Cryo-TEM

[0410] Morphological and size analysis was performed by cryo-TEM by adding 3 μL of LNP with an mRNA concentration of 50 ng / μL to a glow-discharged Quantifoil holey carbon grid. Using a Vitrobot Mark IV, the grid was blotted dry and immersed in liquid ethane for freezing. Imaging was performed on a Titan Krios equipped with a K3 Bioquantum at the Beckman Cryo-EM Center.

[0411] LNP Stability Analysis

[0412] The LNP was diluted 10-fold in 1X PBS or supplemented DMEM (Gibco). As described above, the hydrodynamic diameter and PDI of the LNP were measured hourly at 37 °C using a DynaPro plate reader III (Wyatt Technology). All samples were run in duplicate. Supplemented DMEM was used as a control.

[0413] Kupffer Cell Knockout

[0414] Deplete murine macrophages by administering 0.2 mL of clodronate liposomes (Liposoma, Amsterdam, the Netherlands) at a dose of 5 mg / mL via the lateral tail vein. After 24 h, reinject 0.1 mg / kg dose of LNP-encapsulated fluc via the lateral tail vein. After 12 h, quantify liver luminescence as described above.

[0415] To verify Kupffer cell depletion, inject a portion of mice with clodronate liposomes as described above. After 24 h, perfuse the liver with 10 mL of 1X PBS and then with 10 mL of supplemented DMEM containing 5 mg / mL of collagenase IV (STEMCELL Technologies, Vancouver, Canada). Then dissect the liver and place it in 5 mL of RPMI containing 5 mg / mL of collagenase IV at room temperature for 1 h. Then isolate the liver lobes, crush them with a syringe plunger, and pass them through a 70 μm filter. Then centrifuge the suspension at 100 rpm for 3 min to pellet hepatocytes. Transfer the supernatant to a new tube and add up to 30 mL of supplemented DMEM. Repeat the centrifugation process two more times. Then, spin the three separate supernatants at 200 rpm for 10 min, then discard the top of the supernatant, leaving approximately 5 mL in each tube. Combine the fractions into one tube, spin at 25 g for 5 min, wash the cell pellet with 6 mL of supplemented DMEM, recentrifuge, and collect the upper half of the supernatant. Count the cells as described above and then analyze them by flow cytometry.

[0416] LNP accumulation

[0417] Reformulate LNP with fluc mRNA as described above. Then, mix the LNP with 1,1'-dioctadecyl-3,3,3',3'-tetramethylindotricarbocyanine iodide (DiR; 5 μM in DMSO; Thermo Fisher Scientific) at a volume ratio of 50:1. Place the solution on a plate shaker at 200 rpm at room temperature for 25 min. Then, administer the LNP to the mice and dissect them as described above. Obtain organ fluorescence using the specific "DiR" settings on Living Image. Obtain the ROI as described above. Total radiant efficiency is reported as the mean ± SEM of n = 3 biological replicates.

[0418] Artificial endosome disruption assay

[0419] Artificial endosomes were generated by the hydration method of lipid membranes. DOPS, DOPC, DOPE, NBD-PE, and Rho-PE were added to a 3 mL vial in a molar ratio of 25:25:48:1:1. The lipids were concentrated under vacuum and wrapped in aluminum foil on a rotary evaporator to prevent photobleaching. After 2 h of concentration, the sample was rehydrated with 1X PBS (pH 7.4) at a final concentration of 1 mM for 20 min at room temperature using a Branson 3800 ultrasonic cleaner (Brookfield, CT, USA).

[0420] Assays were performed in black-bottom 96-well plates. 0.1 mL of PBS (pH 5.5, 0.1 M), 1 μL of artificial endosomes, and an amount of LNP corresponding to 400 ng were added to each well.

[0421] As a negative control, more PBS was used instead of LNP, and as a positive control, 2% Triton-X100 was used instead of LNP. The plates were wrapped in aluminum foil and incubated at 37 °C. Fluorescence was measured at different time points over the course of 24 h.

[0422] Example 1: Synthesis of Certain Exemplary Ionizable Lipids, Preparation of Lipid Nanoparticle (LNP) Formulations, and Their Selected Properties

[0423] Ionizable lipids (ILs) can be generated in one step by reacting monoamines or polyamines with lipids containing electrophilic functional groups (e.g., epoxides). This allows for the rapid production of a combinatorial library of ILs by simply mixing different amine cores with epoxides of different lengths. Thus, a synthetic method was developed to synthesize epoxides with any desired length and terminal branching, which could then be further reacted with most polyamine or monoamine reagents to produce ILs with greater structural variability.

[0424] To enable the flexible synthesis of structurally diverse epoxides, primary bromoalkenes were coupled with branched halo-magnesium alkyls via copper-catalyzed Grignard C-C coupling to produce branched alkenes ( Figure 1 ). Primary bromoalkenes are common reagents and were thus used here to establish epoxides of different lengths. Longer bromoalkenes could be generated by the mono-selective elimination of dibromoalkanes with tert-butanol. Many Grignard-functionalized alkyls, due to their wide use in other synthetic pathways, were also commercially available and were used here to establish terminal-branched groups. Terminal-branched alkenes were converted to the corresponding branched epoxides via mCBPA-mediated epoxidation. The C-C coupling and epoxidation steps could be completed and purified in less than 24 h, demonstrating the simplicity of this method.

[0425] In this study, twelve unique branched epoxides were synthesized, non-limiting examples of which include isopropyl, tert-butyl, and sec-butyl branched groups with four different lipid lengths. To form the ILs, the epoxides were first reacted with 2-(2-aminoethoxy)-N-(2-(4-(2-aminoethoxy)ethyl)piperazin-1-yl)ethyl)ethan-1-amine (494) or N-(2-(-4-(2-aminoethyl)piperazin-1-yl)ethyl)ethan-1,2-diamine (200) via an S N 2 reaction ([[]] Figure 2A - 2B [[]]). The 494 and 200 polyamine cores have previously been used to generate ILs and the corresponding LNPs for a variety of applications, including CAR-T cell therapy, intrauterine delivery, and placental delivery, and thus this core represents an interesting structural motif for exploring these preliminary studies. As a control, four linear ILs with the same relative lipid lengths as the branched library were also synthesized using the same S Figure 2A - 2B ) reaction. A total of 16 exemplary ILs were synthesized using 494. N The nomenclature used herein to describe the branched lipids of the present disclosure uses the formula “AXb-C”, where A is the reactive moiety of the lipid tail, b is the type of branching, C is the number of lipid nuclei, and X is the linker length or the number of methylene units between A and B. The branching is abbreviated as “i” for isopropyl, “t” for tert-butyl, and “s” for sec-butyl. Unbranched ILs use their historical names.

[0426] In one aspect, the present disclosure relates to lipid nanoparticles comprising one or more ionizable lipid compounds of formula (I), one or more neutral lipids, cholesterol, and one or more conjugated lipids. In certain embodiments, one or more of the conjugated lipids inhibit aggregation of two or more lipid nanoparticles. In certain embodiments, the lipid nanoparticles further comprise one or more nucleic acid cargos. The preparation and characterization of such lipid nanoparticles are provided in more detail herein.

[0427] In certain embodiments, the LNPs of the present disclosure are prepared using a microfluidic device to prepare LNPs having the following component molar ratios: (a) an ionizable lipid of formula (I) (35 mol%); (b) DOPE (16 mol%); (c) cholesterol (46.5 mol%) and DMG-PEG

[0428] 2000 ​(2.5 mol %). In certain embodiments, the ionizable lipid of formula (I) is selected from E4i-494, E6i-494, E8i-494, E10i-494, E4t-494, E6t-494, E8t-494, E10t-494, E4s-494, E6s-494, E8s-494, E10s-494, E4i-200, E8i-200, E4t-200, E8t-200, E4s-200, and E8s-200 (Table 1). LNPs comprising each of the above ionizable lipids of formula (I) and having the above molar ratios are illustrated herein, and such LNP formulations are disclosed herein with reference to the identifier assigned to each ionizable lipid used to prepare the LNP (e.g., the E4i-494 ionizable lipid is used to prepare the LNP labeled E4i-494).

[0429] Since several of the exemplary applications and / or studies described herein use the same non-limiting excipient molar ratios and are formulated with the same phospholipids and PEGylated lipids, the difference between each LNP formulation lies in the structure of the IL.

[0430] For consistency, each LNP is named after the corresponding IL, as described herein. The LNPs were initially encapsulated with firefly luciferase (fluc) mRNA at an IL to mRNA weight ratio of 10:1, and the encapsulation efficiency, hydrodynamic diameter, ζ potential, and pK a were characterized (Table 2). Although multiple parameters were evaluated, there were no significant differences among the LNPs of linear, isopropyl, tert-butyl, and sec-butyl ILs. All exemplary LNPs had an encapsulation efficiency >80%, and sizes ranged from 70 - 160 nm, with an average PDI of approximately 0.2. The ζ potential of the LNPs also ranged from 5.57 to -28.1, indicating that most LNPs were neutrally or weakly negatively charged. Finally, the pK a of most LNPs was approximately 6.

[0431] Table 2. Selected properties of exemplary LNPs and controls of the present disclosure

[0432]

[0433]

[0434] LNP C8-494, C10-494, C12-494, and C12-200 correspond to LNPs having the same formulation as the present disclosure but differing in the ionizable lipid component, where the ionizable lipid is prepared using polyamine core 494 or polyamine core 200 and an epoxide having a linear alkyl group, and the linker length is represented by an integer C (i.e., C10-494 corresponds to an ionizable lipid prepared using polyamine core 494 and 2-undecyloxirane).

[0435] Example 2: LNPs Comprising Branched Ionizable Lipids Enhance mRNA Delivery In Vivo, Ex Vivo, and In Vitro The present disclosure provides data related to the in vivo, ex vivo, and in vitro delivery of exemplary LNPs of the present disclosure.

[0436] The efficiency of exemplary LNPs of the present disclosure was evaluated in both in vitro and in vivo models. The transfection efficiency of each LNP in HeLa cells was evaluated by incubating the LNP with 20 ng of mRNA per 20,000 cells for 24 h. Luminescence results showed that branching significantly enhanced LNP transfection by 10-fold at the lowest and highest lipid lengths, while at intermediate lengths, branching did not induce a significant change or a significant decrease in transfection ( Figure 3A ). When toxicity was examined using the CellTiter-Glo assay, 7 LNPs showed statistically significant toxicity; however, the viability of none of the LNPs was below 80% ( Figure 3B ).

[0437] To verify the consistency of this trend, the LNPs were intravenously administered to C57BL / 6J mice at a dose of 0.1 mg / kg. DLin-MC3-DMA (MC3), an LNP formulation approved by the FDA for siRNA delivery, and C12-200, a more efficient LNP for mRNA delivery with a polyamine core similar to 494, were also administered as positive controls. Twelve hours later, whole body and organ luminescence were obtained ( Figure 3C - 3D ). Contrary to the in vitro results, all LNPs with branched ILs (branched LNPs) performed as well or better than the corresponding LNPs with linear ILs (linear LNPs) in terms of total RNA delivery and liver delivery. For whole body delivery, 6 branched LNPs and only 1 linear LNP induced luciferase expression as well as C12-200, while E4t-494 and E6t-494 performed better than C12-200 and the performance of the linear LNPs was not better than C12-200.

[0438] All LNPs transfected the liver preferentially over other organs, and in terms of liver luminescence, 6 LNPs with branched ILs performed as well or better than C12-200, and the luminescence of E4i-494 was 1.5 times that of C12-200 ( Figure 3E - 3G)。Notably, no linear LNP statistically achieved a signal equal to or greater than that of C12-200. When compared to MC3 rather than C12-200, the luminescence of the 4 branched LNPs was significantly higher than that of MC3 and the luminescence of the linear LNPs was not significantly higher than that of MC3.

[0439] To further investigate the branched lipid paradigm, it was studied whether lipid branching could enhance the delivery of hepatotropic amine nuclei, particularly the 200 nuclei exemplified herein. Accordingly, 6 branched epoxides were conjugated to the 200 nuclei to form 6 new branched ILs including the 200 nuclei( Figure 2B )。The successful synthesis of the branched 200-nucleus IL highlights the robustness of the initial branched epoxide design as it can be applied to many different amine nuclei. The three branched groups were each evaluated at relative lipid lengths of 8 and 12 carbons, although the present disclosure is not limited to these chain lengths, and the corresponding linear versions C8-200 and C12-200 were used as controls. While C12-200 is considered a standard hepatotropic IL, C8-200 performed much worse, thus indicating an important test of whether branching can also convert such an IL into a potent liver-targeted LNP.

[0440] These 8 ILs were then formulated into LNPs with fluc mRNA and characterized using the same method as above( Figure 4A )。Similar to the study of 494LNP, testing in HeLa cells revealed conflicting results as C8-200 performed better or equivalently to the branched equivalents, while the two long-chain branched LNPs performed significantly better than C12-200( Figure 4B )。Under the concentration test of the luciferase assay, none of the LNPs showed toxicity in vitro. Subsequently, the 200-nucleus LNPs were intravenously injected into C57BL / 6J mice at 0.1 mg / kg of fluc mRNA. All branched LNPs performed similarly to or better than C12-200 in terms of whole-body luminescence and liver delivery( Figure 4C - 4E ), including the C8-200 branched lipid, and the liver luminescence induced by E4s-200 was five times that of C12-200. These results indicate that branching at the lipid terminus enhances liver delivery regardless of the lipid nucleus, providing a fundamental design criterion for future ILs.

[0441] In certain embodiments, the present disclosure provides delivery data comprising luminescence data (e.g., whole body, liver, and / or combined organ luminescence data) obtained by administering an exemplary LNP comprising TriLink luciferase to Black 6 mice. In certain embodiments, one or more controls (e.g., LNP comprising MC3 and / or unbranched ionizable lipid) are also administered to the mice. In certain embodiments, a subset of LNPs comprising ionizable lipids prepared from polyamine core 494 was evaluated in this manner, and the data showed that several LNPs of the present disclosure had enhanced luminescence in organ luminescence compared to LNPs comprising unbranched ionizable lipids ( Figure 5A ). In certain embodiments, a subset of LNPs comprising ionizable lipids prepared from polyamine core 200 was evaluated in this manner, and the data showed that several LNPs of the present disclosure had enhanced luminescence in combined organ luminescence compared to LNPs comprising unbranched ionizable lipids ( Figure 5B ).

[0442] Furthermore, the experiments provided herein show that the LNPs of the present disclosure have a selectivity for liver distribution compared to the spleen, lung, kidney, and / or heart, and little luminescence was observed in non-liver organs ( Figure 5A - 5D ).

[0443] Example 3: Branched LNPs Induce Effective Gene Editing

[0444] Next, LNP delivery was evaluated in a clinically relevant mouse model of transthyretin (TTR)-mediated amyloidosis. TTR is a protein that, when overexpressed in the liver, develops into amyloid fibrils, which can induce restrictive cardiomyopathy and heart failure. LNP-based siRNA therapies, such as those based on MC3 have been used to silence TTR translation in the liver; however, because of the limited therapeutic window of siRNA, this may require multiple infusions. Instead, delivering a gene editing mechanism can provide a single-dose treatment that permanently reduces TTR to a safe level. Accordingly, 8 200-core LNPs were reformulated to encapsulate Cas9 mRNA and a single-guide RNA (sgRNA) targeting TTR. Then C57BL / 6J mice were injected with a combination of Cas9 and TTR sgRNA at 0.3 mg / kg or 1.0 mg / kg. Seven days later, blood was taken, serum was isolated, and the level of TTR protein was evaluated by comparing it with the serum isolated from the same mice 24 h before the study ( Figure 6A ).

[0445] Mice were sacrificed after blood collection, the livers were removed, DNA was isolated, and indels were analyzed using next-generation sequencing (NGS). Although C12-200 LNP reduced TTR levels by 70%, some LNPs with branched ILs reduced TTR levels by 80-90%( Figure 6B ). Additionally, these latter LNPs induced 50-60% indels, while C12-200 LNP induced only 40% indels( Figure 6C ). These results suggest that lipid branching can enhance delivery regardless of the mRNA, demonstrating the generality of this design.

[0446] To assess toxicity, mice were re-injected with the same formulations. Blood was collected after 12 h, and after 24 h, the major organs were removed, stained with H&E, and toxicity markers were analyzed by independent experts. When analyzing liver injury markers in the blood, the AST levels of E4i-200, E4s-200, and E8t-200 were significantly higher than those of the control group, while C12-200 was not. However, for ALT, the levels of E4s-200, C12-200, E8i-200, and E8t-200 were all higher than those of PBS.

[0447] Example 4: Branched IL promotes more endosomal escape

[0448] To determine the mechanism by which the efficacy of branched LNPs is improved, several possible explanations were evaluated. First, by correlating the liver luminescence of each LNP with fluc mRNA in the study with the hydrodynamic diameter, PDI, ζ potential, and pK a of the particles, it was evaluated whether lipid branching would result in LNPs with optimal physicochemical parameters( Figure 7A - 7E ). The success of liver delivery was further correlated with HeLa cell transfection( Figure 7F ). Interestingly, after fitting the data with a three-way least squares regression, no parameter could predict successful liver delivery. Additionally, HeLa cell transfection was also a very poor predictor of in vivo delivery. After this study, it was analyzed whether the morphology of branched LNPs was significantly different from that of linear LNPs; however, after analyzing the structure by cryo-TEM, all LNPs had a similar egg-shaped morphology( Figure 7G - 7J ). This suggests that this form of lipid branching may have a minimal impact on the overall arrangement of LNPs, although this does not rule out the possibility of more subtle changes in bilayer and monolayer arrangements.

[0449] Next, the stability of the exemplary LNPs was evaluated by incubating them in PBS and Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37 °C. The size and PDI of the LNPs were measured hourly by dynamic light scattering immediately after incubation for 24 h( Figure 7K - 7N ). Similar to the characterization results, no significant instability was observed in either PBS or DMEM, and in the latter, all LNPs formed a protein corona of similar size.

[0450] Since the physicochemical properties, morphology, and stability of the particles did not seem to be affected by lipid branching, the role of liver transport and uptake was investigated. Several studies have shown that the IL structure can affect the specific hepatocytes that take up LNPs. For example, Kupffer cells are liver macrophages that are more likely to capture certain types of LNPs, which may lead to different liver biodistributions. Therefore, C57BL / 6J mice were injected with clodronate liposomes, which deplete macrophages, and 24 h later, the mice were reinjected with 8 × 200 nL of LNPs encapsulating fluc mRNA( Figure 8E ). A total of 36 h later, the liver luminescence was imaged, showing a significant decrease in luminescence for all LNPs except C8-200 and E4i-200( Figure 8A ).

[0451] These data suggest that branching may not be a factor in macrophage uptake rates. Moreover, compared to non-macrophages, the two LNPs with the shortest lipid length IL, C8-200 and E4i-200, transfected macrophages at a lower frequency; however, a larger library needs to be screened to verify this trend.

[0452] Next, the role of the protein corona and liver interactions was investigated by injecting E4i-200, E4t-200, E4s-200, and C12-200 fluc LNPs into apolipoprotein E (APOE)-knockout mice at 0.1 mg / kg. When liver luminescence was measured at 12 h, the luminescence of all four LNPs decreased sharply by 100 - 1000-fold compared to wild-type mice( Figure 8B ). This indicates that both branched and unbranched LNPs target the liver through an APOE-mediated mechanism, as demonstrated for many other hepatotropic LNPs.

[0453] Next, analyze the particle accumulation in the liver. The fluc-containing LNP was reconstituted with 1 mol% DiR, a lipophilic carbocyanine near-infrared fluorescent dye. The fluorescent LNP was injected into C57BL / 6J mice at 0.1 mg / kg of fluc mRNA, and after 12 h, the major organs were dissected and imaged for fluorescence. Here, fluorescence is a marker of LNP accumulation. Although mRNA transfection and translation occur only in the liver, LNP fluorescence was observed in both the liver and spleen ( Figure 8C - 8D ). More interestingly, all LNPs showed similar fluorescence in both organs.

[0454] Without being bound by any theory, if all 8 LNPs accumulate in the liver in relatively the same amount, but the branched LNP promotes more mRNA translation, it is hypothesized that this result may be due to the branched IL allowing more mRNA molecules to escape the endosome and enter the cytoplasm. Although there are other reports on the effect of certain IL structural moieties on endosome escape, the specific role of terminal branching remains unknown in the art.

[0455] To verify this result, the interaction of 8 LNPs with artificial endosomes was studied, which is an effective strategy for studying the role of endosome escape. Exemplary endosomes were prepared by thin-film hydration of DOPE, 18:1Δ9-Cis phosphatidylcholine (DOPC), 18:1 phosphatidyl-L-serine (DOPS), NBD-conjugated 18:1 phosphatidylethanolamine (NBD-PE), and Lissamine-Rhodamine-B-conjugated 18:1 phosphatidylethanolammonium (Liss-Rhod-PE) at a molar ratio of 48:25:25:1:1, respectively. The latter two lipids are a FRET pair, which is used to monitor the integrity of the endosome. An increase in the fluorescence of the donor fluorophore corresponds to endosome disruption when the FRET pair is separated. In this study, each LNP was diluted 6-fold in a buffer at pH 5.5 to represent endosomal conditions and mixed with artificial endosomes. At different time points, the fluorescence of the donor fluorophore was measured. For the C8-200 ( Figure 8F ) and C12-2000 ( Figure 8G ) groups, the fluorescence induced by the branched LNP was 2 to 3 times greater than that of the linear LNP, supporting the view that lipid branching promotes more significant endosome escape and the linear version.

[0456] Example 5: Oral cancer tumor suppression therapy

[0457] The present disclosure further provides exemplary data related to the use of the LNPs described herein for treating and / or ameliorating oral cancer tumors. Exemplary LNPs of the present disclosure used LNPs comprising ionizable lipids prepared from 494 polyamine cores, including C8-C14-, E4i-E10i-, E4t-E10t-, and E4s-E10s-494 ionizable lipids, while C12-200 was used as a positive control.

[0458] In this study, CAL-27 cells were used as a model to evaluate the utility of the LNPs of the present disclosure in delivering certain mRNA cargo. CAL-27 cells are human HPV-negative tongue squamous cell carcinomas and are considered the gold standard cell line for studying HPV-negative oral cancers.

[0459] Exemplary LNPs were incubated with luciferase mRNA, and the resulting LNPs were then administered to the cells at a dose of 20 ng mRNA per 20,000 cells. After 24 h, luciferase assays ( Figure 9A ) and cell viability assays ( Figure 9B ) were performed to analyze luciferase expression and toxicity. Luciferase assay data were normalized to C12-200. Some of the evaluated LNPs performed better than the C12-200 LNP (e.g., E10i-494 and E10s-494), while two LNPs comprising branched ionizable lipids significantly outperformed the C12-2000 LNP.

[0460] The present disclosure further describes the use of a mouse tumor model, in which Nu / J mice were inoculated with CAL-27 cells in the right flank and allowed the tumors to grow for 2 weeks. Subsequently, five exemplary LNPs encapsulating luciferase mRNA (including two LNPs comprising branched ionizable lipids and three LNPs comprising linear ionizable lipids) were injected into the tumors at a dose of 0.1 mg / kg, and certain mice were administered PBS as a control. After sacrificing the mice, major organs and tumors were collected and fluorescence imaging ( Figure 10A - 10B ) was performed. The results provided herein show that the signal of the best-performing LNP comprising a branched ionizable lipid (i.e., E10i-494) was more than 10-fold greater than the signal of the LNP comprising C12-200.

[0461] The present disclosure further describes the use of the LNPs of the present disclosure in viability assays (i.e., killing assays) using the CAL-27 and OECM-1 cell lines, where OECM-1 cells represent an HPV-negative squamous cell carcinoma cell line. Exemplary LNPs used in the studies described herein include p53 cargo. In one aspect, p53 represents an ideal target for LNP-mediated inhibitory therapy because more than 70% of oral squamous cell carcinomas have mutated or downregulated p53. A series of mRNA doses (i.e., 5, 20, 50, 100, and 250 ng / μL) were used at different time intervals (i.e., 24 h or 48 h), and overall viability ( Figure 11A - 11D ) was measured. After 24 and 48 h, low viability (i.e., cell killing) was observed by administering exemplary LNPs comprising at least partially encapsulated p53 mRNA.

[0462] Example 6: Stem cell reprogramming

[0463] The present disclosure further provides exemplary data related to the use of the LNPs described herein for reprogramming stem cells (e.g., induced pluripotent stem cells (iPSCs)). iPSCs are derived from skin or blood cells that have been reprogrammed into an embryonic-like pluripotent state, such that they are capable of developing into any type of human cell source required for therapy. For example, iPSCs can differentiate into blood cells to create new cancer-free blood for leukemia patients.

[0464] mRNA cargo transfection of iPSCs allows for the expression of certain biomolecules of interest and potentially differentiation into cell lines of interest (e.g., neurons and / or muscle cells). In the experiments described herein, iPSCs were transfected with mRNA at least partially encapsulated in exemplary LNPs of the present disclosure, the LNPs comprising an ionizable lipid prepared from 494 and 200 polyamine nuclei, and LNPs comprising C12-200 were used as a positive control.

[0465] Initial potency screening of exemplary LNPs was performed using the LNPs of the present disclosure comprising luciferase mRNA (20 ng / 15,000 cells), and luciferase expression ( Figure 12A ) and viability ( Figure 12B ) were measured. Comparable viability was observed for each exemplary LNP, while certain LNPs (i.e., E4i-200, E4t-200, and E4s-200) exhibited higher relative fluorescence.

[0466] Dose-response luciferase luminescence ( Figure 13A ) and viability ( Figure 13B) Experiment. LNP E4i-200 performed best in terms of relative luminescence. The E4i-200 LNP was re-formulated with mCherry. iPSC-SV20 cells were seeded in a 24-well plate and left overnight, then treated with E4i-LNP containing mCherry. Flow cytometry was performed to measure the percentage of successfully transfected cells, and the cells were imaged by fluorescence microscopy to show the mCherry signal( Figure 14A - 14H ).

[0467] A time-point study was conducted where iPSCs (or controls) transfected with mCherry were harvested at 24 h( Figure 15A and 15E ), 48 h( Figure 15B and 15F ), 72 h( Figure 15C and 15G ) and 96 h( Figure 15D and 15H ). The results provided herein show that the mCherry signal remained at a high intensity within 48 hours as determined by FAC analysis.

[0468] Example 7: CAR-T cell and CAR natural killer (NK) cell therapies

[0469] In another aspect, the present disclosure relates to the use of the LNPs of the present disclosure in CAR-T and CAR-NK therapies.

[0470] The experiments described herein utilized LNPs comprising ionizable lipids prepared from 494 and 200 polyamine cores. Initial screening of the LNPs was performed using an exemplary LNP comprising luciferase mRNA, which was incubated in activated primary T cells (1:1 CD4+:CD8+) from healthy human donors, where the concentration of luciferase was 200 ng mRNA / 60,000 cells. Luciferase expression( Figure 16A ) and cell viability( Figure 16B ) were measured after 24 h, where it was found that E8i-200 and E10s-200 LNPs were superior to the B10 LNP formulation and had the lowest toxicity.

[0471] The formulation of the LNP components of the best-performing LNP identified in the screening described herein was modified to match the formulation used for B10 LNP (i.e., ionizable lipid:DOPE:cholesterol:C14PEG2000 was 40:30:25:2.5), and the relative luminescence( Figure 17A ) and viability( Figure 17B ) of the exemplary LNP in primary T cells were measured. LNP E8i-200 performed best in this experiment, with a luminescence intensity almost 6 times that of B10 and a negligible change in viability.

[0472] The present disclosure further describes the evaluation of exemplary LNPs for transfecting NK-92MI cells (i.e., immortalized human natural killer cells that self-express IL-2). In these experiments, LNPs (200 ng mRNA / 60,000 cells) containing luciferase mRNA were incubated with NK-92MI cells, and luciferase expression was measured after 24 h. Certain exemplary LNPs comprising branched ionizable lipids (e.g., E6i-200 and E8i-200) were significantly superior to LNPs comprising C12-200, demonstrating the utility of the LNPs of the present disclosure in transfecting immune cells (e.g., T cells and NK cells). Figure 18 )

[0473] Sequence Listing

[0474] SEQ ID NO:1

[0475] ususasCAGCCACGUCUACAGCAGUUUUAGAgcuagaaauagcAAGUUAAAAUAAGGCUAGUCCGUUAUCAacuugaaaaaguggcaccgagucggugcusususu

[0476] SEQ ID NO:2

[0477] CGGTTTACTCTGACCCATTTC

[0478] SEQ ID NO:3

[0479] GGGCTTTCTACAAGCTTACC

[0480] Enumerated Embodiments

[0481] The following exemplary embodiments are provided, and their numbers should not be construed as designating an order of importance:

[0482] Embodiment 1 provides an ionizable lipid compound of formula (I), or a salt, solvate, stereoisomer or isotopic configuration thereof:

[0483]

[0484] Wherein:

[0485] R 1a and R 1b are each independently

[0486] R 2a , R 2b , R 2c , R 2d, R 2e , R 2f , R 2g and R 2h each independently is selected from the group consisting of H, optionally substituted C1-C 12 alkyl, optionally substituted C2-C 12 heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C2-C 12 alkenyl, optionally substituted C2-C 12 alkynyl, optionally substituted C6-C 10 aryl and optionally substituted C2-C 10 heteroaryl;

[0487] R 3a , R 3b and R 3c each occurrence independently is selected from the group consisting of H, wherein no more than one of R

[0488] 3a , R 3b and R 3c 3c is H;

[0489] R 4a , R 4b , R 4c and R 4d each occurrence (if any) independently is selected from the group consisting of optionally substituted C1-C 12 alkyl, halogen, CN and NO2;

[0490] R 5 each occurrence independently is selected from the group consisting of optionally substituted C1-C3 alkyl, optionally substituted C3-C 12 cycloalkyl, optionally substituted C6-C 10 aryl and optionally substituted C2-C 10 heteroaryl;

[0491] R 6 each occurrence independently is selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C 12 cycloalkyl, C2-C 12 heterocycloalkyl, optionally substituted C6-C 12 aralkyl, optionally substituted C6-C 12 aryl, optionally substituted C2-C 12 heteroaryl, C(=O)R a , C(=O)OR a , and C(=O)N(R a )(Rb ) a group consisting of;

[0492] Each occurrence of L is independently selected from the group consisting of a bond, -(optionally substituted C1-C 12 alkylene)-X-, -(optionally substituted C2-C 12 alkenylene)-X-, -(optionally substituted C1-C 12 alkynylene)-X-, -(optionally substituted C1-C 12 heteroalkylene)-X-, optionally substituted C3-C8 cycloalkylene, and optionally substituted C2-C8 heterocycloalkylene;

[0493] Each occurrence of X (if present) is independently selected from the group consisting of a bond, -N(R 3c )-, and -O-;

[0494] Each occurrence of Y (if present) is independently selected from the group consisting of a bond, -N(R a )-, and -O-;

[0495] Each occurrence of Z is C1-C 24 alkylene,

[0496] wherein the C1-C 24 alkylene in each occurrence of Z is independently substituted by at least one substituent selected from the group consisting of C1-C 12 alkyl and C1-C 12 haloalkyl, and

[0497] wherein the C1-C 24 alkylene in each occurrence of Z is independently optionally further substituted;

[0498] R a and R b Each occurrence is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 aralkyl, optionally substituted phenyl, optionally substituted C2-C8 heteroaryl, C(=O)R c , C(=O)OR c and C(=O)N(R c )(R d );

[0499] R c and R d Each occurrence is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12The group consisting of aralkyl, optionally substituted phenyl, and optionally substituted C2-C8 heteroaryl; and

[0500] Each occurrence of m is independently an integer selected from the group consisting of 1, 2, 3, and 4.

[0501] Embodiment 2 provides the compound of Embodiment 1, wherein at least one of the following applies:

[0502] (a) At least one selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h is H;

[0503] (b) At least two selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H;

[0504] (c) At least three selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H;

[0505] (d) At least four selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H;

[0506] (e) At least five selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H;

[0507] (f) At least one selected from the group consisting of R2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least six in the group consisting of are H;

[0508] (g) Selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least seven in the group consisting of are H; and

[0509] (h) Each of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h is H.

[0510] Embodiment 3 provides a compound of Embodiment 1 or 2, wherein each occurrence of L is independently selected from the group consisting of Ls, and the Ls are independently selected from the group consisting of -(CH2) 1-10 -, -(CH2) 2-10 NR 3c -, -(CH2) 2-10 O-, -(CH2) 1-3 -CH(OR a )-(CH2) 1-3 -, piperazinyl and cyclohexyl groups.

[0511] Embodiment 4 provides a compound of any one of Embodiments 1 - 3, wherein each occurrence of L is independently selected from the group consisting of -CH2-, -(CH2)2-, -(CH2)3-, -(CH2) 10 -, -(CH2)2O-, -(CH2)3O-, -CH2CH(OR a )CH2-, -(CH2)2NR 3c -, the group consisting of.

[0512] Embodiment 5 provides a compound of any one of Embodiments 1 - 4, wherein the compound of formula (I) is selected from the group consisting of:

[0513]

[0514]

[0515] Embodiment 6 provides a compound of any one of Embodiments 1-5, wherein each occurrence of R 4a 、R 4b 、R 4c and R 4d is independently H each time it appears.

[0516] Embodiment 7 provides a compound of any one of Embodiments 1-6, wherein each occurrence of R 5 is independently methyl.

[0517] Embodiment 8 provides a compound of any one of Embodiments 1-7, wherein each occurrence of R 6 is independently H.

[0518] Embodiment 9 provides a compound of any one of Embodiments 1-8, wherein each occurrence of Z is independently:

[0519]

[0520] wherein,

[0521] each occurrence of R 7a 、R 7b 、R 7c and R 7d is independently selected from the group consisting of H, C1-C6 alkyl, and C1-C6 haloalkyl,

[0522] wherein at least one of R 7a 、R 7b 、R 7c and R 7d is not H; and

[0523] each occurrence of o is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

[0524] Embodiment 10 provides a compound of Embodiment 9, wherein each occurrence of R 7a 、R 7b 、R 7c and R 7d is independently selected from the group consisting of H and methyl.

[0525] Embodiment 11 provides a compound of any one of Embodiments 1-10, wherein each occurrence of Z is independently selected from - (CH2) 4-10 -CH(CH3)-*, - (CH2) 4-10 -C(CH3)2-*, and - (CH2) 4-10-CH(CH3)-CH2-* group.

[0526] Embodiment 12 provides a compound of any one of Embodiments 1-11, wherein each occurrence of R 3a , R 3b and R 3c is independently selected from the group consisting of

[0527] group.

[0528] Embodiment 13 provides a compound of any one of Embodiments 1-12, wherein each occurrence of the optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted aralkyl, optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted cycloalkylene and optionally substituted heterocycloalkylene (if present) is independently optionally substituted with at least one substituent selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, C1-C3 haloalkoxy, phenoxy, halogen, CN, NO2, OH, N(R’)(R”), C(=O)R’, C(=O)OR’, OC(=O)OR’, C(=O)N(R’)(R”), S(=O)2N(R’)(R”), N(R’)C(=O)R”, N(R’)S(=O)2R”, C2-C8 heteroaryl and phenyl optionally substituted with at least one halogen, wherein each occurrence of R’ and R” is independently selected from the group consisting of H, C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, benzyl and phenyl.

[0529] Embodiment 14 provides a compound of any one of Embodiments 1-13, selected from the group consisting of:

[0530]

[0531]

[0532]

[0533]

[0534]

[0535] Embodiment 15 provides a lipid nanoparticle (LNP) composition, comprising:

[0536] (a) At least one ionizable lipid compound of formula (I) or a salt, solvate, stereoisomer or isotopic configurational isomer thereof:

[0537] wherein:

[0538]

[0539] wherein:

[0540] R 1a and R 1b are each independently

[0541] R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are each independently selected from the group consisting of H, optionally substituted C1-C 12 alkyl, optionally substituted C2-C 12 heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C2-C 12 alkenyl, optionally substituted C2-C 12 alkynyl, optionally substituted C6-C 10 aryl and optionally substituted C2-C 10 heteroaryl;

[0542] R 3a 、R 3b and R 3c each occurrence is independently selected from the group consisting of H, wherein no more than one of R

[0543] 3a 、R 3b 3c and R 4a is H;

[0544] R 4a 、R 4b 、R 4c and R 4d each occurrence (if any) is independently selected from the group consisting of optionally substituted C1-C 12 alkyl, halogen, CN and NO2;

[0545] R 5 each occurrence is independently selected from the group consisting of optionally substituted C1-C3 alkyl, optionally substituted C3-C 12A group consisting of cycloalkyl, optionally substituted C6-C 10 aryl, and optionally substituted C2-C 10 heteroaryl;

[0546] Each occurrence of R 6 is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C 12 cycloalkyl, C2-C 12 heterocycloalkyl, optionally substituted C6-C 12 aralkyl, optionally substituted C6-C 12 aryl, optionally substituted C2-C 12 heteroaryl, C(=O)R a C(=O)OR a and C(=O)N(R a )(R b ).

[0547] Each occurrence of L is independently selected from the group consisting of a bond, -(optionally substituted C1-C 12 alkylene)-X-, -(optionally substituted C2-C 12 alkenylene)-X-, -(optionally substituted C1-C 12 alkynylene)-X-, -(optionally substituted C1-C 12 heteroalkylene)-X-, optionally substituted C3-C8 cycloalkylene, and optionally substituted C2-C8 heterocycloalkylene;

[0548] Each occurrence of X (if present) is independently selected from the group consisting of a bond, -N(R 3c )- and -O-;

[0549] Each occurrence of Y (if present) is independently selected from the group consisting of a bond, -N(R a )- and -O-;

[0550] Each occurrence of Z is C1-C 24 alkylene,

[0551] wherein the C1-C 24 alkylene in each occurrence of Z is independently substituted by at least one substituent selected from the group consisting of C1-C 12 alkyl and C1-C 12 haloalkyl, and

[0552] wherein the C1-C 24 alkylene in each occurrence of Z is independently optionally further substituted;

[0553] R a and R bEach occurrence of is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl, optionally substituted C2-C8 heteroaryl, C(=O)R c , C(=O)OR c and C(=O)N(R c )(R d );

[0554] R c and R d Each occurrence of is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl and optionally substituted C2-C8 heteroaryl; and

[0555] Each occurrence of m is an integer independently selected from the group consisting of 1, 2, 3 and 4;

[0556] (b) at least one neutral lipid;

[0557] (c) cholesterol; and

[0558] (d) at least one conjugated lipid.

[0559] Embodiment 16 provides the LNP of Embodiment 15, wherein the LNP further comprises:

[0560] (e) at least one nucleic acid and / or therapeutic agent cargo, wherein the cargo is at least partially encapsulated therein.

[0561] Embodiment 17 provides the LNP of Embodiment 15 or 16, wherein at least one of the following applies:

[0562] (a) at least one selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h is H;

[0563] (b) at least one selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R2h At least two in the group consisting of are H;

[0564] (c) Selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least three in the group consisting of are H;

[0565] (d) Selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least four in the group consisting of are H;

[0566] (e) Selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least five in the group consisting of are H;

[0567] (f) Selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least six in the group consisting of are H;

[0568] (g) Selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h At least seven in the group consisting of are H; and

[0569] (h) Each of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h is H.

[0570] Embodiment 18 provides the LNP of any one of Embodiments 15 - 17, wherein each occurrence of L is independently selected from the group consisting of L, and L is independently selected from the group consisting of -(CH2) 1-10 -, -(CH2) 2-10 NR 3c -, -(CH2) 2-10 O-, -(CH2) 1-3 -CH(OR a )-(CH2) 1-3 -, piperazinyl and cyclohexyl groups.

[0571] Embodiment 19 provides the LNP of any one of Embodiments 15 - 18, wherein each occurrence of L is independently selected from the group consisting of -CH2-, -(CH2)2-, -(CH2)3-, -(CH2) 10 -, -(CH2)2O-, -(CH2)3O-, -CH2CH(OR a )CH2-, -(CH2)2NR 3c -, group.

[0572] Embodiment 20 provides the LNP of any one of Embodiments 15 - 19, wherein the compound of formula (I) is selected from the group consisting of:

[0573]

[0574]

[0575] Embodiment 21 provides the LNP of any one of Embodiments 15 - 20, wherein R 4a , R 4b , R 4c and R 4d each occurrence is independently H.

[0576] Embodiment 22 provides the LNP of any one of Embodiments 15 - 21, wherein each occurrence of R 5 is independently methyl.

[0577] Embodiment 23 provides the LNP of any one of Embodiments 15 - 22, wherein each occurrence of R 6 is independently H

[0578] Embodiment 24 provides the LNP of any one of Embodiments 15 - 23, wherein each occurrence of Z is independently:

[0579]

[0580] Among them,

[0581] R 7a 、R 7b 、R 7c and R 7d each occurrence of is independently selected from the group consisting of H, C1-C6 alkyl, and C1-C6 haloalkyl.

[0582] Among them, R 7a 、R 7b 、R 7c and R 7d at least one of is not H; and

[0583] each occurrence of o is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

[0584] Embodiment 25 provides the LNP of Embodiment 24, wherein each occurrence of R 7a 、R 7b 、R 7c and R 7d is independently selected from the group consisting of H and methyl.

[0585] Embodiment 26 provides the LNP of any one of Embodiments 15-25, wherein each occurrence of Z is independently selected from the group consisting of -(CH2) 4-10 -CH(CH3)-*, -(CH2) 4-10 -C(CH3)2-*, and -(CH2) 4-10 -CH(CH3)-CH2-*.

[0586] Embodiment 27 provides the LNP of any one of Embodiments 15-26, wherein each occurrence of R 3a 、R 3b and R 3c is independently selected from the group consisting of

[0587]

[0588] consisting of.

[0589] Embodiment 28 provides the LNP of any one of Embodiments 15-27, wherein each occurrence of the optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted aralkyl, optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted cycloalkylene and optionally substituted heterocycloalkylene (if present) is independently optionally substituted by at least one substituent selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, C1-C3 haloalkoxy, phenoxy, halogen, CN, NO2, OH, N(R’)(R”), C(=O)R’, C(=O)OR’, OC(=O)OR’, C(=O)N(R’)(R”), S(=O)2N(R’)(R”), N(R’)C(=O)R”, N(R’)S(=O)2R”, C2-C8 heteroaryl and phenyl optionally substituted by at least one halogen, wherein each occurrence of R’ and R” is independently selected from the group consisting of H, C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, benzyl and phenyl.

[0590] Embodiment 29 provides the LNP of any one of Embodiments 15-28, which is selected from the group consisting of:

[0591]

[0592]

[0593]

[0594]

[0595]

[0596] Embodiment 30 provides the LNP of any one of Embodiments 15-29, wherein at least one ionizable lipid of formula (I) accounts for about 10 mol% to about 90 mol% of the LNP.

[0597] Embodiment 31 provides the LNP of any one of Embodiments 15-30, wherein at least one ionizable lipid of formula (I) accounts for about 35 mol% or about 40 mol% of the LNP.

[0598] Embodiment 32 provides the LNP of any one of Embodiments 15-31, wherein at least one neutral lipid of formula (I) accounts for about 1 mol% to about 40 mol% of the LNP.

[0599] Embodiment 33 provides an LNP of any one of Embodiments 15 - 32, wherein at least one neutral lipid of formula (I) accounts for about 16 mol% or about 30 mol% of the LNP.

[0600] Embodiment 34 provides an LNP of any one of Embodiments 15 - 33, wherein at least one neutral lipid comprises at least one selected from the group consisting of dioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylcholine (DSPC), and dioleoylphosphatidylcholine (DOPC).

[0601] Embodiment 35 provides an LNP of any one of Embodiments 15 - 34, wherein at least one neutral lipid comprises dioleoylphosphatidylethanolamine (DOPE).

[0602] Embodiment 36 provides an LNP of any one of Embodiments 15 - 35, wherein cholesterol accounts for about 20 mol% to about 75 mol% of the LNP.

[0603] Embodiment 37 provides an LNP of any one of Embodiments 15 - 36, wherein cholesterol accounts for about 25 mol% or about 46.5 mol% of the LNP.

[0604] Embodiment 38 provides an LNP of any one of Embodiments 15 - 37, wherein at least one conjugated lipid accounts for about 0.1 mol% to about 15 mol% of the LNP.

[0605] Embodiment 39 provides an LNP of any one of Embodiments 15 - 38, wherein at least one conjugated lipid accounts for about 2.5 mol% of the LNP.

[0606] Embodiment 40 provides an LNP of any one of Embodiments 15 - 39, wherein at least one conjugated lipid comprises 1,2 - dimyristoyl - rac - glycerol - 3 - methoxypolyethylene glycol - 2000 (DMG - PEG 2000 )

[0607] Embodiment 41 provides an LNP of any one of Embodiments 15 - 40, wherein the molar ratio (a):(b):(c):(d) of the LNP is about 35:16:46.5:2.5 or about 40:30:25:2.5.

[0608] Embodiment 42 provides an LNP of any one of Embodiments 16 - 41, wherein the nucleic acid molecule is a therapeutic agent.

[0609] Embodiment 43 provides an LNP of any one of Embodiments 16 - 42, wherein the nucleic acid molecule is at least one selected from the group consisting of RNA and DNA.

[0610] Embodiment 44 provides the LNP of any one of Embodiments 16 - 43, wherein the nucleic acid molecule is at least one selected from the group consisting of mRNA, cDNA, miRNA, siRNA, and modified RNA.

[0611] Embodiment 45 provides the LNP of any one of Embodiments 42 - 44, wherein the nucleic acid is mRNA.

[0612] Embodiment 46 provides the LNP of Embodiment 45, wherein the mass ratio of (a) of the LNP to mRNA is from about 20:1 to about 5:1 (w / w), optionally wherein the mass ratio of (a) of the LNP to mRNA is about 10:1.

[0613] Embodiment 47 provides the LNP of Embodiment 45 or 46, wherein the mRNA encodes a chimeric antigen receptor (CAR).

[0614] Embodiment 48 provides the LNP of Embodiment 47, wherein the CAR specifically binds to a surface antigen of a pathogenic cell or a tumor cell.

[0615] Embodiment 49 provides the LNP of Embodiment 48, wherein the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD5RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligand, B7-H6, IL13R-α2, MUC1, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGEA1, HAL-A2 NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, fetal AchR, NKG2D ligand, TEM1 and TEM8.

[0616] Embodiment 50 provides the LNP of Embodiment 45 or 46, wherein the mRNA encodes an enzyme.

[0617] Embodiment 51 provides the LNP of any one of Embodiments 45-46 and 49, wherein the mRNA encodes a clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein, optionally, wherein the CRISPR-associated protein is Cas9.

[0618] Embodiment 52 provides a pharmaceutical composition comprising the lipid nanoparticle (LNP) of any one of Embodiments 15-51 and at least one pharmaceutically acceptable carrier.

[0619] Embodiment 53 provides the pharmaceutical composition of Embodiment 52, wherein the composition further comprises at least one adjuvant.

[0620] Embodiment 54 provides a method for treating, preventing, and / or ameliorating a disease in a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) of any one of Embodiments 16-51 and / or at least one pharmaceutical composition of Embodiment 52 or 53.

[0621] Embodiment 55 provides the method of Embodiment 54, wherein the disease is selected from the group consisting of cancer, autoimmune diseases, cardiovascular diseases, and neurological diseases.

[0622] Embodiment 56 provides the method of Embodiment 55, wherein the cancer is at least one selected from the group consisting of oral cancer, pancreatic cancer, colorectal cancer, bladder cancer, breast cancer, prostate cancer, kidney cancer, hepatocellular carcinoma, lung cancer, ovarian cancer, cervical cancer, gastric cancer, esophageal cancer, head and neck cancer, melanoma, neuroendocrine cancer, CNS cancer, brain cancer, bone cancer, soft tissue sarcoma, non-small cell lung cancer, small cell lung cancer, or colon cancer.

[0623] Embodiment 57 provides the method of Embodiment 54 or 56, wherein the subject is further administered at least one additional agent or therapy for treating, preventing, and / or ameliorating the subject's cancer.

[0624] Embodiment 58 provides the method of any one of Embodiments 54-57, wherein the subject is a mammal.

[0625] Embodiment 59 provides the method of Embodiment 58, wherein the mammal is a human.

[0626] Embodiment 60 provides a method for delivering a nucleic acid or a therapeutic agent to the liver of a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) of any one of Embodiments 16-51 and / or at least one pharmaceutical composition of Embodiment 52 or 53.

[0627] Embodiment 61 provides a method for preparing a modified immune cell or its precursor, the method comprising contacting the immune cell or precursor with a lipid nanoparticle (LNP) of any one of Embodiments 16-51 and / or at least one pharmaceutical composition of Embodiment 52 or 53.

[0628] Embodiment 62 provides the method of Embodiment 61, wherein the modified immune cell or its precursor is an αβ T cell, a γδ T cell, a CD8+ T cell, a CD4+ helper T cell, a CD4+ regulatory T cell, an NK T cell, an NK cell, and any combination thereof.

[0629] Embodiment 63 provides the method of Embodiment 62, wherein the modified immune cell or its precursor is a T cell, optionally wherein the T cell is a CD4+ T cell.

[0630] Embodiment 64 provides the method of Embodiment 62, wherein the modified immune cell or its precursor is a NK cell.

[0631] The terms and expressions used herein are used as descriptive terms and not of limitation, and the use of such terms and expressions is not intended to exclude any equivalents of the features shown and described or portions thereof, but it should be recognized that various modifications are possible within the scope of the embodiments of the present application. Accordingly, it is to be understood that although the present application describes specific embodiments and alternative features, those of ordinary skill in the art can make modifications and variations to the compositions, methods and concepts disclosed herein, and such modifications and variations are considered to be within the scope of the embodiments of the present application.

Claims

1. An ionizable lipid compound of formula (I), or a salt, solvate, stereoisomer or isotopic configurational isomer thereof: Wherein, R 1a and R 1b each independently is R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h each independently is selected from the group consisting of H, optionally substituted C1-C 12 alkyl, optionally substituted C2-C 12 heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C2-C 12 alkenyl, optionally substituted C2-C 12 alkynyl, optionally substituted C6-C 10 aryl and optionally substituted C2-C 10 heteroaryl; R 3a , R 3b and R 3c Each occurrence of is independently selected from H, The group composed of wherein R 3a , R 3b and R 3c is not more than one being H; If present, R 4a , R 4b , R 4c and R 4d each occurrence of which is independently selected from the group consisting of optionally substituted C1-C 12 alkyl, halogen, CN and NO2; R 5 Each occurrence of is independently selected from the group consisting of optionally substituted C1-C3 alkyl, optionally substituted C3-C 12 cycloalkyl, optionally substituted C6-C 10 aryl, and optionally substituted C2-C 10 heteroaryl; R 6 Each occurrence of is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C 12 cycloalkyl, C2-C 12 heterocycloalkyl, optionally substituted C6-C 12 aralkyl, optionally substituted C6-C 12 aryl, optionally substituted C2-C 12 heteroaryl, C(=O)R a , C(=O)OR a , and C(=O)N(R a )(R b ); Each occurrence of L is independently selected from the group consisting of a bond, -(optionally substituted C1-C 12 alkylene)-X-, -(optionally substituted C2-C 12 alkenylene)-X-, -(optionally substituted C1-C 12 alkynylene)-X-, -(optionally substituted C1-C 12 heteroalkylene)-X-, optionally substituted C3-C8 cycloalkylene, and optionally substituted C2-C8 heterocycloalkylene; If present, each occurrence of X is independently selected from the group consisting of a bond, -N(R 3c )-, and -O-; If present, each occurrence of Y is independently selected from the group consisting of a bond, -N(R a )-, and -O-; Each occurrence of Z is C1-C 24 an alkylene group, wherein, in each occurrence of Z, C1-C 24 alkylene is independently substituted by at least one substituent selected from the group consisting of C1-C 12 alkyl and C1-C 12 haloalkyl, and wherein, in each occurrence of Z, C1-C 24 alkylene is independently optionally further substituted; R a and R b each occurrence of which is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl, optionally substituted C2-C8 heteroaryl, C(=O)R c , C(=O)OR c and C(=O)N(R c )(R d ); R c and R d each occurrence of which is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl, and optionally substituted C2-C8 heteroaryl; and Each occurrence of m is independently an integer selected from the group consisting of 1, 2, 3 and 4.

2. The compound according to claim 1, wherein at least one of the following applies: (a) at least one selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h is H; (b) selected from at least two of the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H; (c) selected from at least three of the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g , and R 2h are H; (d) selected from at least four of the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H; (e) selected from at least five of the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H; (f) selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g , and R 2h ; at least six of which are H (g) selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h ; and at least seven of the group consisting of are H; and (h)R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h each of which is H.

3. The compound according to claim 1 or 2, wherein each occurrence of L is independently selected from the group consisting of L, which is independently selected from the group consisting of -(CH2) 1-10 -, -(CH2) 2-10 NR 3c -, -(CH2) 2-10 O-, -(CH2) 1-3 -CH(OR a )-(CH2) 1-3 -, piperazinyl and cyclohexyl groups.

4. A compound according to any one of claims 1 - 3, wherein each occurrence of L is independently selected from the group consisting of -CH2-, -(CH2)2-, -(CH2)3-, -(CH2) 10 -, -(CH2)2O-, -(CH2)3O-, -CH2CH(OR a )CH2-, -(CH2)2NR 3c -, and the group consisting of.

5. The compound according to any one of claims 1-4, wherein the compound of formula (I) is selected from the group consisting of:

6. The compound according to any one of claims 1-5, wherein each occurrence of R 4a , R 4b , R 4c and R 4d is independently H.

7. The compound according to any one of claims 1-6, wherein each occurrence of R 5 is independently methyl.

8. A compound according to any one of claims 1-7, wherein each occurrence of R 6 is independently H.

9. The compound according to any one of claims 1-8, wherein each occurrence of Z is independently: Wherein, R 7a 、R 7b 、R 7c and R 7d Each occurrence of is independently selected from the group consisting of H, C1-C6 alkyl, and C1-C6 haloalkyl. wherein, R 7a , R 7b , R 7c and R 7d at least one of which is not H; and Each occurrence of o is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12.

10. The compound according to claim 9, wherein each occurrence of R 7a , R 7b , R 7c and R 7d is independently selected from the group consisting of H and methyl.

11. A compound according to any one of claims 1 - 10, wherein each occurrence of Z is independently selected from the group consisting of -(CH2) 4-10 -CH(CH3)-*, -(CH2) 4-10 -C(CH3)2-*, and -(CH2) 4-10 -CH(CH3)-CH2-*.

12. The compound according to any one of claims 1-11, wherein each occurrence of R 3a , R 3b and R 3c is independently selected from the group consisting of .

13. The compound according to any one of claims 1-12, wherein if present, each occurrence of an optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted aralkyl, optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted cycloalkylene and optionally substituted heterocycloalkylene is independently optionally substituted with at least one substituent selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, C1-C3 haloalkoxy, phenoxy, halogen, CN, NO2, OH, N(R’)(R”), C(=O)R’, C(=O)OR’, OC(=O)OR’, C(=O)N(R’)(R”), S(=O)2N(R’)(R”), N(R’)C(=O)R”, N(R’)S(=O)2R”, C2-C8 heteroaryl and phenyl optionally substituted with at least one halogen, wherein each occurrence of R’ and R” is independently selected from the group consisting of H, C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, benzyl and phenyl.

14. The compound according to any one of claims 1-13, which is selected from the group consisting of:

15. A lipid nanoparticle (LNP) composition comprising: (f) at least one ionizable lipid compound having the structure of formula (I) or a salt, solvate, stereoisomer or isotopic configurational isomer thereof: Wherein: R 1a and R 1b each independently is R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h each independently is selected from the group consisting of H, optionally substituted C1-C 12 alkyl, optionally substituted C2-C 12 heteroalkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C2-C 12 alkenyl, optionally substituted C2-C 12 alkynyl, optionally substituted C6-C 10 aryl, and optionally substituted C2-C 10 heteroaryl; R 3a , R 3b and R 3c Each occurrence of is independently selected from H, The group composed of wherein R 3a , R 3b and R 3c are not more than one being H; If present, R 4a , R 4b , R 4c and R 4d each occurrence of is independently selected from the group consisting of optionally substituted C1-C 12 alkyl, halogen, CN and NO2; R 5 Each occurrence of is independently selected from the group consisting of optionally substituted C1-C3 alkyl, optionally substituted C3-C 12 cycloalkyl, optionally substituted C6-C 10 aryl, and optionally substituted C2-C 10 heteroaryl; R 6 Each occurrence of is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C 12 cycloalkyl, C2-C 12 heterocycloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted C6-C 12 aryl, optionally substituted C2-C 12 heteroaryl, C(=O)R a , C(=O)OR a , and C(=O)N(R a )(R b ); Each occurrence of L is independently selected from the group consisting of a bond, -(optionally substituted C1-C 12 alkylene)-X-, -(optionally substituted C2-C 12 alkenylene)-X-, -(optionally substituted C1-C 12 alkynylene)-X-, -(optionally substituted C1-C 12 heteroalkylene)-X-, optionally substituted C3-C8 cycloalkylene, and optionally substituted C2-C8 heterocycloalkylene; If present, each occurrence of X is independently selected from the group consisting of a bond, -N(R 3c )-, and -O-; If present, each occurrence of Y is independently selected from the group consisting of a bond, -N(R a )-, and -O-; Each occurrence of Z is C1-C 24 an alkylene group, wherein, in each occurrence of Z, C1-C 24 alkylene is independently substituted by at least one substituent selected from the group consisting of C1-C 12 alkyl and C1-C 12 haloalkyl, and wherein, in each occurrence of Z, C1-C 24 alkylene is independently optionally further substituted; R a and R b each occurrence of which is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl, optionally substituted C2-C8 heteroaryl, C(=O)R c , C(=O)OR c and C(=O)N(R c )(R d ); R c and R d each occurrence of is independently selected from the group consisting of H, optionally substituted C1-C6 alkyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C1-C6 haloalkyl, optionally substituted C6-C 12 arylalkyl, optionally substituted phenyl, and optionally substituted C2-C8 heteroaryl; and Each occurrence of m is independently an integer selected from the group consisting of 1, 2, 3 and 4; (g) at least one neutral lipid; (h) cholesterol; and (i) at least one conjugated lipid.

16. The LNP according to claim 15, wherein the LNP further comprises: (j) at least one nucleic acid and / or therapeutic agent cargo, wherein the cargo is at least partially encapsulated therein.

17. The LNP according to claim 15 or 16, wherein at least one of the following applies: (a) At least one selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h is H; (b) selected from at least two of the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H; (c) at least three selected from the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h are H; (d) selected from at least four of the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H; (e) selected from at least five of the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h are H; (f) selected from at least six in the group consisting of R 2a , R 2b , R 2c , R 2d , R 2e , R 2f , R 2g and R 2h are H; (g) selected from the group consisting of R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h ; and at least seven of the group consisting of are H; and (h)R 2a 、R 2b 、R 2c 、R 2d 、R 2e 、R 2f 、R 2g and R 2h each is H.

18. The LNP according to any one of claims 15 - 17, wherein each occurrence of L is independently selected from the group consisting of L, and the L is independently selected from the group consisting of -(CH2) 1-10 -, -(CH2) 2-10 NR 3c -, -(CH2) 2-10 O-, -(CH2) 1-3 -CH(OR a )-(CH2) 1-3 -, piperazinyl and cyclohexyl groups.

19. The LNP according to any one of claims 15-18, wherein each occurrence of L is independently selected from the group consisting of -CH2-, -(CH2)2-, -(CH2)3-, -(CH2) 10 -, -(CH2)2O-, -(CH2)3O-, -CH2CH(OR a )CH2-, -(CH2)2NR 3c -, the group consisting of 20. The LNP according to any one of claims 15-19, wherein the compound of formula (I) is selected from the group consisting of:

21. The LNP according to any one of claims 15-20, wherein each occurrence of R 4a , R 4b , R 4c and R 4d is independently H.

22. The LNP according to any one of claims 15-21, wherein each occurrence of R 5 is independently methyl.

23. The LNP according to any one of claims 15-22, wherein each occurrence of R 6 is independently H.

24. The LNP according to any one of claims 15 - 23, wherein each occurrence of Z is independently: wherein, R 7a 、R 7b 、R 7c and R 7d each occurrence is independently selected from the group consisting of H, C1-C6 alkyl, and C1-C6 haloalkyl. wherein, R 7a , R 7b , R 7c and R 7d at least one of which is not H; and each occurrence of o is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

25. The LNP according to claim 24, wherein each occurrence of R 7a , R 7b , R 7c and R 7d is independently selected from the group consisting of H and methyl.

26. The LNP according to any one of claims 15-25, wherein each occurrence of Z is independently selected from the group consisting of -(CH2) 4-10 -CH(CH3)-*, -(CH2) 4-10 -C(CH3)2-*, and -(CH2) 4-10 -CH(CH3)-CH2-*.

27. The LNP according to any one of claims 15-26, wherein each occurrence of R 3a , R 3b and R 3c is independently selected from the group consisting of .

28. The LNP according to any one of claims 15 - 27, wherein if present, each occurrence of the optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted aralkyl, optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted cycloalkylene, and optionally substituted heterocycloalkylene is independently optionally substituted with at least one substituent selected from the group consisting of C1 - C6 alkyl, C3 - C8 cycloalkyl, C1 - C6 haloalkyl, C1 - C3 haloalkoxy, phenoxy, halogen, CN, NO2, OH, N(R’)(R”), C(=O)R’, C(=O)OR’, OC(=O)OR’, C(=O)N(R’)(R”), S(=O)2N(R’)(R”), N(R’)C(=O)R”, N(R’)S(=O)2R”, C2 - C8 heteroaryl, and phenyl optionally substituted with at least one halogen, wherein each occurrence of R’ and R” is independently selected from the group consisting of H, C1 - C6 alkyl, C3 - C8 cycloalkyl, C1 - C6 haloalkyl, benzyl, and phenyl.

29. The LNP according to any one of claims 15 - 28, selected from the group consisting of:

30. The LNP according to any one of claims 15 - 29, wherein at least one ionizable lipid of formula (I) accounts for about 10 mol% to about 90 mol% of the LNP.

31. The LNP according to any one of claims 15 - 30, wherein at least one ionizable lipid of formula (I) accounts for about 35 mol% or about 40 mol% of the LNP.

32. The LNP according to any one of claims 15 - 31, wherein at least one neutral lipid of formula (I) accounts for about 1 mol% to about 40 mol% of the LNP.

33. The LNP according to any one of claims 15 - 32, wherein at least one neutral lipid of formula (I) accounts for about 16 mol% or about 30 mol% of the LNP.

34. The LNP according to any one of claims 15 - 33, wherein the at least one neutral lipid comprises at least one selected from the group consisting of dioleoyl phosphatidylethanolamine (DOPE), distearoyl phosphatidylcholine (DSPC), and dioleoyl phosphatidylcholine (DOPC).

35. The LNP according to any one of claims 15 - 34, wherein the at least one neutral lipid comprises dioleoyl phosphatidylethanolamine (DOPE).

36. The LNP according to any one of claims 15 - 35, wherein the cholesterol accounts for about 20 mol% to about 75 mol% of the LNP.

37. The LNP according to any one of claims 15 - 36, wherein the cholesterol accounts for about 25 mol% or about 46.5 mol% of the LNP.

38. The LNP according to any one of claims 15 - 37, wherein the at least one conjugated lipid accounts for about 0.1 mol% to about 15 mol% of the LNP.

39. The LNP according to any one of claims 15 - 38, wherein the at least one conjugated lipid accounts for about 2.5 mol% of the LNP.

40. The LNP according to any one of claims 15-39, wherein the at least one conjugated lipid comprises 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000 ).

41. The LNP according to any one of claims 15 - 40, wherein the molar ratio (a):(b):(c):(d) of the LNP is about 35:16:46.5:2.5 or about 40:30:25:2.

5.

42. The LNP according to any one of claims 16 - 41, wherein the nucleic acid molecule is a therapeutic agent.

43. The LNP according to any one of claims 16 - 42, wherein the nucleic acid molecule is at least one selected from the group consisting of RNA and DNA.

44. The LNP according to any one of claims 16 - 43, wherein the nucleic acid molecule is at least one selected from the group consisting of mRNA, cDNA, miRNA, siRNA, and modified RNA.

45. The LNP according to any one of claims 42 - 44, wherein the nucleic acid is mRNA.

46. The LNP according to claim 45, wherein the mass ratio of (a) of the LNP to mRNA is about 20:1 to about 5:1 (w / w), optionally wherein the mass ratio of (a) of the LNP to mRNA is about 10:

1.

47. The LNP according to claim 45 or 46, wherein the mRNA encodes a chimeric antigen receptor (CAR).

48. The LNP according to claim 47, wherein the CAR specifically binds to a surface antigen of a pathogenic cell or a tumor cell.

49. The LNP according to claim 48, wherein the surface antigen is selected from the group consisting of CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD19, CD20, CD22, CD25, CD26, CD27, CD28, CD30, CD33, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD123, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD5RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, CCR7, k light chain, ROR1, ErbB2, ErbB3, ErbB4, EGFR vIII, carcinoembryonic antigen, EGP2, EGP40, mesothelin, TAG72, PSMA, NKG2D ligand, B7-H6, IL13R-α2, MUC1, MUC1, VEGF-A, Tem8, FAP, EphA2, HER2, MUC16, CA9, GD2, GD3, HMW-MAA, CD171, Lewis Y, G250 / CALX, HLA-AI MAGE A1, HAL-A2NY-ESO-1, PSC1, folate receptor-α, 8H9, NCAM, VEGF, 5T4, fetal AchR, NKG2D ligand, TEM1, and TEM8.

50. The LNP according to claim 45 or 46, wherein the mRNA encodes an enzyme.

51. The LNP according to any one of claims 45-46 and 49, wherein the mRNA encodes a clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein, optionally, wherein the CRISPR-associated protein is Cas9.

52. A pharmaceutical composition comprising the lipid nanoparticle (LNP) according to any one of claims 15-51 and at least one pharmaceutically acceptable carrier.

53. The pharmaceutical composition according to claim 52, wherein the composition further comprises at least one adjuvant.

54. A method of treating, preventing, and / or ameliorating a disease in a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) according to any one of claims 16-51 and / or at least one pharmaceutical composition according to claim 52 or 53.

55. The method according to claim 54, wherein the disease is selected from the group consisting of cancer, autoimmune diseases, cardiovascular diseases, and neurological diseases.

56. The method according to claim 55, wherein the cancer is at least one selected from the group consisting of oral cancer, pancreatic cancer, colorectal cancer, bladder cancer, breast cancer, prostate cancer, kidney cancer, hepatocellular carcinoma, lung cancer, ovarian cancer, cervical cancer, gastric cancer, esophageal cancer, head and neck cancer, melanoma, neuroendocrine cancer, CNS cancer, brain cancer, bone cancer, soft tissue sarcoma, non-small cell lung cancer, small cell lung cancer, or colon cancer.

57. The method according to claim 54 or 56, wherein the subject is further administered at least one additional agent or therapy for treating, preventing, and / or ameliorating the cancer of the subject.

58. The method according to any one of claims 54-57, wherein the subject is a mammal.

59. The method according to claim 58, wherein the mammal is a human.

60. A method of delivering a nucleic acid or therapeutic agent to the liver of a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) according to any one of claims 16-51 and / or at least one pharmaceutical composition according to claim 52 or 53.

61. A method of preparing a modified immune cell or a precursor thereof, the method comprising contacting the immune cell or precursor with a lipid nanoparticle (LNP) according to any one of claims 16-51 and / or at least one pharmaceutical composition according to claim 52 or 53.

62. The method according to claim 61, wherein the modified immune cell or its precursor is an αβ T cell, a γδ T cell, a CD8+ T cell, a CD4+ helper T cell, a CD4+ regulatory T cell, an NK T cell, an NK cell, and any combination thereof.

63. The method according to claim 62, wherein the modified immune cell or its precursor is a T cell, optionally wherein the T cell is a CD4+ T cell.

64. The method according to claim 62, wherein the modified immune cell or its precursor is an NK cell.

Images