Agents for modulating expression

Abstract

Provided herein is an agent that targets a nucleic acid (e.g., processed mRNA) that can modulate the expression of a protein encoded by the nucleic acid, for example by modulating the level of the nucleic acid. In aspects, provided herein are compositions, methods, kits, and systems related to agents that modulate protein expression by targeting nucleic acid molecules encoding the proteins.

Description

[0001] Cross-reference

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 349,659, filed Jun. 7, 2022, which is hereby incorporated by reference in its entirety. SUMMARY OF THE INVENTION

[0003] In some aspects, provided herein is a method of reducing the expression of UBE3A protein in mammalian cells having a duplication, overexpression, or gain-of-function mutation of the UBE3A gene encoding the UBE3A protein, the method comprising contacting the mammalian cells with an agent or a vector encoding the agent, wherein the agent reduces the level of processed mRNA encoding the UBE3A protein in the mammalian cells.

[0004] In some instances, the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the sequence shown in any one of SEQ ID NOs: 93-120.

[0005] In some instances, the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of each mRNA transcript listed in Table 2.

[0006] In some instances, the agent comprises an antisense oligomer.

[0007] In some instances, the agent comprises an antisense oligomer having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0008] In some aspects, provided herein is a method of modulating the expression of the UBE3A gene encoding the UBE3A protein in mammalian cells, the method comprising contacting the mammalian cells with an agent or a vector encoding the agent, wherein the agent comprises a polynucleotide sequence comprising an antisense oligomer having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0009] In some instances, the antisense oligomer comprises a backbone modification, a modified sugar moiety, or a combination thereof.

[0010] In some instances, the antisense oligomer comprises a phosphorothioate linkage or a phosphorodiamidate linkage.

[0011] In some instances, the antisense oligomer comprises a phosphorodiamidate morpholino, a locked nucleic acid, a peptide nucleic acid, a 2'-O-methyl moiety, a 2'-fluoro moiety, a 2'-O-methoxyethyl moiety, or a 2'-NMA moiety.

[0012] In some cases, the antisense oligomer comprises at least one modified sugar moiety.

[0013] In some cases, the antisense oligomer comprises at least one, two, three, four, five or six modified nucleosides at the 5' end of the antisense oligomer.

[0014] In some cases, the antisense oligomer comprises one, two, three, four, five or six modified nucleosides at the 5' end of the antisense oligomer.

[0015] In some cases, the antisense oligomer comprises one, two, three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 5' end of the antisense oligomer.

[0016] In some cases, the antisense oligomer comprises at least one, two, three, four, five or six modified nucleosides at the 3' end of the antisense oligomer.

[0017] In some cases, the antisense oligomer comprises one, two, three, four, five or six modified nucleosides at the 3' end of the antisense oligomer.

[0018] In some cases, the antisense oligomer comprises one, two, three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3' end of the antisense oligomer.

[0019] In some cases, the antisense oligomer comprises three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 5' end of the antisense oligomer; three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3' end of the antisense oligomer; and phosphorothioate linkages between any two adjacent nucleosides of the antisense oligomer.

[0020] In some cases, the antisense oligomer comprises: a 5' region consisting of three, four, five or six linked nucleosides; a central region consisting of eight, nine, ten, eleven or twelve linked nucleosides; and a 3' region consisting of three, four, five or six linked nucleosides; wherein each of the three, four, five or six linked nucleosides in the 5' region and each of the three, four, five or six linked nucleosides in the 3' region comprises a modified sugar moiety, and wherein each of the eight, nine, ten, eleven or twelve linked nucleosides in the central region is a deoxyribonucleoside.

[0021] In some cases, the antisense oligomer consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases.

[0022] In some cases, the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

[0023] In some cases, the vector comprises a viral vector encoding the agent.

[0024] In some cases, the viral vector comprises an adenovirus vector, an adeno - associated virus (AAV) vector, a lentivirus vector, a herpes simplex virus (HSV) vector, or a retrovirus vector.

[0025] In some cases, the antisense oligomer comprises a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

[0026] In some cases, the antisense oligomer comprises a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

[0027] In some cases, the antisense oligomer comprises a sequence having 100% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

[0028] In some cases, the antisense oligomer consists of a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

[0029] In some cases, the antisense oligomer consists of a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

[0030] In some cases, the antisense oligomer consists of a sequence having 100% identity to the sequence shown in any of SEQ ID NO: 1-92.

[0031] In some cases, the method reduces the level of processed mRNA encoding the UBE3A protein in mammalian cells.

[0032] In some cases, the level of processed mRNA encoding the UBE3A protein in mammalian cells contacted with an agent or a vector is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same cells that have not been contacted with the agent or the vector.

[0033] In some cases, the level of processed mRNA encoding the UBE3A protein in mammalian cells contacted with an agent or a vector is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same mammalian cells that have not been contacted with the agent or the vector.

[0034] In some cases, the method reduces the level of UBE3A protein in mammalian cells.

[0035] In some cases, the level of UBE3A protein in mammalian cells that have been contacted with an agent or vehicle is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same cells that have not been contacted with the agent or vehicle.

[0036] In some cases, the level of UBE3A protein in mammalian cells that have been contacted with an agent or vehicle is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same cells that have not been contacted with the agent or vehicle.

[0037] In some cases, the method includes contacting an agent or vehicle with a population of mammalian cells.

[0038] In some cases, the agent reduces the level of processed mRNA encoding UBE3A protein in a population of mammalian cells by up to about 75%, up to about 70%, up to about 60%, up to about 50%, up to about 40%, up to about 30% or up to about 20% compared to the same population of mammalian cells that have not been contacted with the agent or vehicle.

[0039] In some cases, the agent reduces the level of UBE3A protein in a mammalian cell population by up to about 75%, up to about 70%, up to about 60%, up to about 50%, up to about 40%, up to about 30%, or up to about 20% compared to an otherwise identical mammalian cell population that has not been contacted with the agent or carrier.

[0040] In some cases, the mammalian cells are ex vivo.

[0041] In some cases, the mammalian cells are in vivo.

[0042] In some cases, the genome of the mammalian cell has a duplication of a genomic region encompassing the UBE3A gene that encodes the UBE3A protein.

[0043] In some cases, the mammalian cell is a human cell, and the genome of the cell has a duplication of chromosome 15q11.2-q13.1.

[0044] In some cases, the mammalian cells are obtained from a human subject suffering from Dup15q syndrome or are descendants of sample cells obtained from a human subject.

[0045] In some aspects, the present disclosure provides an antisense oligomer comprising a sequence having at least 80% identity to a sequence shown in any one of SEQ ID NOs: 1-92.

[0046] In some cases, the antisense oligomer comprises a backbone modification, a modified sugar moiety, or a combination thereof.

[0047] In some cases, the antisense oligomer comprises phosphorothioate linkages or phosphorodiamidate linkages.

[0048] In some cases, the antisense oligomer comprises phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl moiety, 2'-fluoro moiety, 2'-O-methoxyethyl moiety, or 2'-NMA moiety.

[0049] In some cases, the antisense oligomer comprises at least one modified sugar moiety.

[0050] In some cases, the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

[0051] In some cases, the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

[0052] In some cases, the antisense oligomer comprises one, two, three, four, five, or six 2'-O-methoxyethyl-modified nucleosides at the 5' end of the antisense oligomer.

[0053] In some cases, the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at the 3' end of the antisense oligomer.

[0054] In some cases, the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at the 3' end of the antisense oligomer.

[0055] In some cases, the antisense oligomer comprises one, two, three, four, five, or six 2'-O-methoxyethyl-modified nucleosides at the 3' end of the antisense oligomer.

[0056] In some cases, the antisense oligomer comprises three, four, five, or six 2'-O-methoxyethyl-modified nucleosides at the 5' end of the antisense oligomer; three, four, five, or six 2'-O-methoxyethyl-modified nucleosides at the 3' end of the antisense oligomer; and phosphorothioate linkages between any two adjacent nucleosides of the antisense oligomer.

[0057] In some cases, the antisense oligomer comprises: a 5' region consisting of three, four, five, or six linked nucleosides; a central region consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3' region consisting of three, four, five, or six linked nucleosides; wherein each of the three, four, five, or six linked nucleosides in the 5' region and each of the three, four, five, or six linked nucleosides in the 3' region comprises a modified sugar moiety, and wherein each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside.

[0058] In some cases, the antisense oligomer consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases, or 18 to 20 nucleobases.

[0059] In some cases, the antisense oligomer comprises a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

[0060] In some cases, the antisense oligomer comprises a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

[0061] In some cases, the antisense oligomer comprises a sequence having 100% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

[0062] In some cases, the antisense oligomer consists of a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

[0063] In some cases, the antisense oligomer consists of a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

[0064] In some cases, the antisense oligomer consists of a sequence having 100% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

[0065] In some cases, the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

[0066] In some cases, the antisense oligomer is a modified oligonucleotide consisting of the sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

[0067] In some cases, the antisense oligomer is configured to reduce the level of the processed mRNA transcript encoding the UBE3A protein in the mammalian cell population after contact with the population.

[0068] In some cases, the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same mammalian cell population that has not been contacted with the antisense oligomer.

[0069] In some cases, the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same cells that have not been contacted with the antisense oligomer.

[0070] In some cases, the antisense oligomer is configured to reduce the level of processed mRNA encoding the UBE3A protein in the population by up to about 75%, up to about 70%, up to about 60%, up to about 50%, up to about 40%, up to about 30%, or up to about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0071] In some cases, the antisense oligomer is configured to reduce the level of UBE3A protein in the mammalian cell population.

[0072] In some cases, the antisense oligomer is configured to reduce the level of UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0073] In some cases, the antisense oligomer is configured to reduce the level of UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0074] In some cases, the antisense oligomer is configured to reduce the level of UBE3A protein in the population of mammalian cells by up to about 75%, up to about 70%, up to about 60%, up to about 50%, up to about 40%, up to about 30%, or up to about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0075] In some cases, the mammalian cells are ex vivo.

[0076] In some cases, the mammalian cells are in vivo.

[0077] In some cases, the genome of the mammalian cell has a duplication of the genomic region encompassing the UBE3A gene that encodes the UBE3A protein.

[0078] In some cases, the mammalian cells are human cells.

[0079] In some cases, the genome of the mammalian cell has a duplication of chromosome 15q11.2-q13.1.

[0080] In some cases, the mammalian cells are obtained from a human subject suffering from Dup15q syndrome or are descendants of sample cells obtained from a human subject.

[0081] In some aspects, the present disclosure provides a pharmaceutical composition comprising: (a) a pharmaceutically acceptable excipient or carrier; and (b) an antisense oligomer as disclosed herein.

[0082] In some aspects, the present disclosure provides a pharmaceutical composition comprising: (a) a pharmaceutically acceptable excipient or carrier; and (b) an agent or a vector encoding the agent, wherein the agent is configured to reduce the level of the processed mRNA transcript encoding the UBE3A protein in the mammalian cell upon contact with the mammalian cell.

[0083] In some cases, the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the sequence shown in any one of SEQ ID NOs: 93-120.

[0084] In some cases, the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of each mRNA transcript listed in Table 2.

[0085] In some cases, the agent comprises an antisense oligomer.

[0086] In some cases, the antisense oligomer has at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

[0087] In some cases, the pharmaceutical composition comprises a carrier, and wherein the carrier comprises a viral vector encoding the agent.

[0088] In some cases, the viral vector includes an adenovirus vector, an adeno-associated virus (AAV) vector, a lentivirus vector, a herpes simplex virus (HSV) vector, or a retrovirus vector.

[0089] In some cases, the antisense oligomer comprises a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0090] In some cases, the antisense oligomer comprises a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0091] In some cases, the antisense oligomer comprises a sequence having 100% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0092] In some cases, the antisense oligomer consists of a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0093] In some cases, the antisense oligomer consists of a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0094] In some cases, the antisense oligomer consists of a sequence having 100% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0095] In some cases, the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

[0096] In some cases, the antisense oligomer is a modified oligonucleotide consisting of the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

[0097] In some cases, the agent is configured to reduce the level of processed mRNA encoding the UBE3A protein in the mammalian cell population upon contact with the mammalian cell population.

[0098] In some cases, the antisense oligomer is configured to reduce the level of processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same population of mammalian cells that have not been contacted with the agent or carrier.

[0099] In some cases, the agent is configured to reduce the level of processed mRNA encoding the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same population of mammalian cells that have not been contacted with the agent or carrier.

[0100] In some cases, the agent is configured to reduce the level of processed mRNA encoding the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0101] In some cases, the agent is configured to reduce the level of the UBE3A protein in the population.

[0102] In some cases, the agent is configured to reduce the level of UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% as compared to the same population of mammalian cells that have not been contacted with the agent or the vehicle.

[0103] In some cases, the agent is configured to reduce the level of UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% as compared to the same population of mammalian cells that have not been contacted with the agent or the vehicle.

[0104] In some cases, the agent is configured to reduce the level of UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% as compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0105] In some cases, the mammalian cells are ex vivo. In some cases, the mammalian cells are in vivo. In some cases, the genome of the mammalian cells has a duplication of a genomic region encompassing the UBE3A gene encoding the UBE3A protein.

[0106] In some cases, the mammalian cells are human cells. In some cases, the genome of the mammalian cells has a duplication of chromosome 15q11.2-q13.1.

[0107] In some cases, the mammalian cells are obtained from a human subject suffering from Dup15q syndrome or are descendants of sample cells obtained from a human subject.

[0108] In some cases, the pharmaceutical composition is formulated for intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, cisterna magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal administration, subretinal injection, topical application, implantation, or intravenous injection.

[0109] In some cases, the pharmaceutical composition is formulated for intrathecal injection.

[0110] In some cases, the pharmaceutically acceptable excipient or carrier includes artificial cerebrospinal fluid.

[0111] In some cases, the pharmaceutical composition further comprises a second therapeutic agent.

[0112] In some cases, the second therapeutic agent comprises a small molecule, an antisense oligomer, or a gene editing molecule.

[0113] In some aspects, provided herein is a method of treating a disease or condition in a subject in need thereof or reducing the likelihood of the subject developing the disease or condition by reducing the expression of UBE3A protein in the cells of the subject, the method comprising contacting the pharmaceutical composition disclosed herein with the cells of the subject.

[0114] In some cases, the disease or condition is associated with overexpression of the UBE3A gene encoding the UBE3A protein or a gain-of-function mutation.

[0115] In some cases, the genome of the cells of the subject has at least one extra copy of the UBE3A gene encoding the UBE3A protein.

[0116] In some cases, the genome of the cells of the subject has a duplication of the genomic region encompassing the UBE3A gene encoding the UBE3A protein.

[0117] In some cases, the genome of the cells of the subject has a duplication of chromosome 15q11.2-q13.1.

[0118] In some cases, the disease or condition includes Dup15q syndrome, autism spectrum disorder, epilepsy, or intellectual disability.

[0119] In some cases, the subject is a human. In some cases, the subject is a fetus, embryo or child. In some cases, the cells are ex vivo.

[0120] In some cases, the method comprises administering a pharmaceutical composition to a subject by: intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, cisterna magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal injection, subretinal injection, topical application, implantation or intravenous injection.

[0121] In some cases, the method comprises administering a pharmaceutical composition to a subject by intrathecal injection.

[0122] In some cases, the method treats a disease or condition.

[0123] Incorporated by reference

[0124] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0125] The novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained from the following detailed description that sets forth illustrative embodiments, in which the principles of the present disclosure are utilized, and the accompanying drawings thereof:

[0126] Figures 1A to 1D Shows the concentration-response curves (CRCs) of each of 22 exemplary ASOs according to some embodiments of the present disclosure, as measured by the percentage of knockdown of the human UBE3A gene in cells treated with the corresponding ASO.

[0127] Figures 2A to 2B Is a histogram showing the effect of various controls on the knockdown of UBE3A mRNA.

[0128] Figures 3A to 3B Is a histogram showing the effect of an exemplary ASO at two different concentrations (6.3 μM and 20 μM, respectively) on the knockdown of UBE3A mRNA levels at day 7, day 10, and day 14 of treatment.

[0129] Figures 3C to 3D Is a histogram showing the effect of a test ASO at two different concentrations (6.3 μM and 20 μM, respectively) on the reduction of UBE3A protein expression at day 7, day 10, and day 14 of treatment.

[0130] Figures 4A to 4DHistogram showing the fold change in mRNA and protein expression in F-Dup and corrected neuronal cells. Figure 4A Relative UBE3A mRNA expression in F-Dup and corrected neuronal cells on day 11 of differentiation (normalized to corrected neuronal cells) is shown. Figure 4B Relative UBE3A protein expression in F-Dup and corrected neuronal cells on day 11 of differentiation (normalized to corrected neuronal cells) is shown. Figure 4C Relative UBE3A mRNA expression in F-Dup and corrected neuronal cells on day 22 of differentiation (normalized to corrected neuronal cells) is shown. Figure 4D Relative UBE3A protein expression in F-Dup and corrected neuronal cells on day 22 of differentiation (normalized to corrected neuronal cells) is shown.

[0131] Figures 5A to 5B Shows UBE3A protein expression levels on F-Dup neurons at day 7 and day 10 of ASO treatment for exemplary ASOs at 6.3 μM ( Figure 5A ) and 20 μM ( Figure 5B ) at day 7, day 10, and day 14 of treatment.

[0132] Figure 6 Illustration of a timeline for the time neurons spend in culture, the duration of ASO treatment, and the duration of media change. DETAILED DESCRIPTION

[0133] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0134] Certain Terms

[0135] Unless otherwise provided with specific definitions, the nomenclature, procedures, and techniques used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques are available for chemical synthesis and chemical analysis.

[0136] Unless otherwise noted, the following terms have the following meanings:

[0137] "Administer" can mean providing an agent to an animal and includes, but is not limited to, administration by a medical professional and self-administration. "Improve" means a reduction, slowing, stopping, or reversal of at least one measure of the severity of a symptom or condition. The severity of the measure can be determined by subjective or objective measurements known to those skilled in the art.

[0138] "Animal" can refer to human or non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including but not limited to monkeys and chimpanzees.

[0139] "Antisense oligomer" can mean an oligomeric compound capable of hybridizing to a target nucleic acid through hydrogen bonding. Examples of antisense oligomers include single-stranded and double-stranded compounds such as antisense oligonucleotides, siRNA, shRNA, and ssRNA.

[0140] "Antisense inhibition" or "inhibition" can mean a decrease in the level of a target nucleic acid in the presence of an antisense oligomer complementary to the target nucleic acid compared to the level of the target nucleic acid or in the absence of the antisense oligomer.

[0141] "Antisense mechanism" can refer to all those mechanisms involving hybridization of a compound to a target nucleic acid, where the result or effect of the hybridization is target degradation or target occupancy, accompanied by stalling of cellular mechanisms involved in, for example, transcription or splicing. The antisense oligomers provided herein can be "antisense" to the target nucleic acid, meaning that the antisense oligomer is capable of hybridizing to the target nucleic acid through hydrogen bonding.

[0142] "Antisense oligonucleotide" can mean a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid.

[0143] "Base complementarity" can refer to the ability of the nucleobases of an antisense oligonucleotide to precisely base pair (i.e., hybridize) with the corresponding nucleobases in a target nucleic acid, and is mediated by Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding between the corresponding nucleobases.

[0144] "Bicyclic sugar" can mean a furanose ring modified by bridging through two atoms. Bicyclic sugars are modified sugars.

[0145] "Bicyclic nucleoside" (also referred to as "BNA") can mean a nucleoside having a sugar moiety that contains a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.

[0146] "Cap structure" or "terminal cap moiety" can mean a chemical modification that has been incorporated at either end of an antisense oligomer. "cEt" or "constrained ethyl" can mean a bicyclic nucleoside having a sugar moiety that contains a bridge connecting the 4'-carbon and the 2'-carbon, where the bridge has the formula: 4'-CH(CH3)-0-2'

[0147] "Constrained ethyl nucleoside" (also referred to as cEt nucleoside) can mean a nucleoside containing a bicyclic sugar moiety that contains a 4'-CH(CH3)-0-2' bridge.

[0148] "Chimeric antisense oligomer" can mean an antisense oligomer having at least two chemically distinct regions, with multiple subunits at each position.

[0149] "Complementarity" can mean the ability of base pairing between the nucleobases of a first nucleic acid and a second nucleic acid.

[0150] "Adjacent nucleobases" can mean nucleobases that are adjacent to each other.

[0151] "Diluent" can mean a composition that lacks pharmacological activity but is pharmaceutically necessary or desired. For example, in an injectable drug, the diluent can be a liquid, such as a saline solution.

[0152] In the context of modulating activity or treating or preventing a condition, "effective amount" can mean an amount of an agent administered to an individual in need of such modulation, treatment, or prevention, either as a single dose or as part of a series of doses, which amount is effective for modulating the effect, or for treating, preventing, or ameliorating the condition. Depending on the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, the assessment of the individual's health status, and other relevant factors, the effective amount can vary from individual to individual.

[0153] "Efficacy" or "potency", which may be used interchangeably herein, can mean the ability to produce a desired effect.

[0154] "Expression" can include all processes by which the information encoded by a gene is converted into structures that are present and operative in a cell. Such structures include, but are not limited to, the products of transcription and translation.

[0155] "Gapmer" can mean a chimeric antisense oligomer in which an internal region having multiple nucleosides that support RNase H cleavage is positioned between outer regions having one or more nucleosides, wherein the nucleosides constituting the internal region are chemically different from the one or more nucleosides constituting the outer regions. The internal region can be referred to as the "gap", and the outer regions can be referred to as the "wings".

[0156] "Hybridization" can mean the annealing of complementary nucleic acid molecules. In certain embodiments, the complementary nucleic acid molecules include, but are not limited to, antisense oligomers and target nucleic acids. In certain embodiments, the complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

[0157] "Individual" can mean a human or non-human animal selected for treatment or therapy.

[0158] "Inhibiting UBE3A" or "suppressing UBE3A" can mean reducing the level or expression of UBE3A mRNA and / or UBE3A. In certain embodiments, the level of UBE3A mRNA and / or the level of UBE3A protein is inhibited in the presence of an antisense oligomer targeting UBE3A (including an antisense oligonucleotide targeting UBE3A), as compared to the expression of UBE3A mRNA and / or the level of UBE3A protein in the absence of an antisense oligomer of UBE3A, such as an antisense oligonucleotide.

[0159] "Inhibiting expression or activity" can refer to a decrease or blockage of expression or activity and does not necessarily indicate a complete elimination of expression or activity.

[0160] "Internucleoside linkage" can refer to a chemical bond between nucleosides.

[0161] "Intracisternal" or "ICM" injection or delivery can refer to injecting an agent or pharmaceutical composition provided herein into the subarachnoid space filled with cerebrospinal fluid (CSF) between the cerebellum and the dorsal medulla.

[0162] "Linked nucleosides" can refer to adjacent nucleosides linked together by an internucleoside linkage.

[0163] "UBE3A antisense oligomer" can mean an antisense oligomer targeting UBE3A mRNA.

[0164] "Mismatch" or "non-complementary nucleobase" can refer to a situation where a nucleobase of a first nucleic acid cannot pair with the corresponding nucleobase of a second nucleic acid or a target nucleic acid.

[0165] "Modified internucleoside linkage" can refer to a substitution or any alteration relative to a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond).

[0166] "Modified nucleobase" can refer to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. "Unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0167] "Modified nucleoside" can refer to a nucleoside independently having a modified sugar moiety and / or a modified nucleobase.

[0168] "Modified nucleotide" can refer to a nucleotide independently having a modified sugar moiety, a modified internucleoside linkage, and / or a modified nucleobase.

[0169] "Modified antisense oligonucleotide" can refer to an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and / or a modified nucleobase.

[0170] "Modified sugar" may refer to substitutions and / or alterations relative to a native sugar moiety.

[0171] "Monomer" may refer to an individual unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified. "Motif" means the pattern of unmodified and modified nucleosides in an antisense oligomer.

[0172] "Native sugar moiety" may refer to the sugar moiety seen in DNA (2'-H) or RNA (2'-OH).

[0173] "Naturally occurring internucleoside linkage" may refer to a 3' to 5' phosphodiester linkage.

[0174] "Non-complementary nucleobases" may refer to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise support hybridization.

[0175] "Nucleic acid" may refer to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).

[0176] "Nucleobase" may mean a heterocyclic moiety capable of base pairing with the base of another nucleic acid. "Nucleobase complementarity" may refer to a nucleobase capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobases refer to the nucleobases of an antisense oligomer capable of base pairing with the nucleobases of its target nucleic acid. For example, if the nucleobase at a certain position of an antisense oligomer can form a hydrogen bond with the nucleobase at a certain position of a target nucleic acid, the position of the hydrogen bond formation between the oligonucleotide and the target nucleic acid is considered complementary to the said nucleobase pair.

[0177] "Nucleobase sequence" may refer to the order of adjacent nucleobases independent of any sugar, linkage, and / or nucleobase modification.

[0178] "Nucleoside" may refer to a nucleobase linked to a sugar.

[0179] "Nucleoside analogs" can include those structures that are used to replace the sugar or the sugar and base, and are not necessarily the linkages at one or more positions of an oligomeric compound, such as, for example, nucleoside analogs having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclic or tricyclic sugar mimetics, e.g., non-furanose units. Nucleotide analogs include those structures that are used to replace the nucleoside and the linkages at one or more positions of an oligomeric compound, such as, for example, peptide nucleic acid or morpholino (morpholino or other non-phosphodiester linkages connected by -N(H)-C(=0)-0-). Sugar replacements overlap with the slightly broader term nucleoside analogs, but are only intended to indicate the replacement of the sugar unit (furanose ring). The tetrahydropyran ring provided herein is an illustration of an example of a sugar replacement, in which the furanosyl group has been replaced by a tetrahydropyranyl ring system. "Analog" can refer to a group that is replaced by a sugar, nucleobase, and / or internucleoside linkage. In general, an analog can be used to replace the sugar or the sugar-nucleoside internucleoside linkage combination, and the nucleobase is retained to hybridize to the selected target.

[0180] "Nucleotide" can refer to a nucleoside having a phosphate group covalently linked to the sugar moiety of the nucleoside.

[0181] "Oligomeric compound" or "oligomer", which can be used interchangeably herein, can refer to a polymer of linked monomeric subunits capable of hybridizing to at least one region of a nucleic acid molecule.

[0182] "Oligonucleotide" can refer to a polymer of linked nucleosides, each of which can be independently modified or unmodified from each other.

[0183] "Parenteral administration" can refer to administration by injection (e.g., bolus) or infusion. Parenteral administration can include subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, such as intrathecal, intraventricular, or cisterna magna administration.

[0184] "Peptide" can refer to a molecule formed by linking at least two amino acids with an amide bond. Without limitation, as used herein, peptide refers to polypeptide and protein.

[0185] "Agent" can refer to a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeting UBE3A is an agent.

[0186] "Pharmaceutical composition" can refer to a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition can contain an antisense oligonucleotide and a sterile aqueous solution.

[0187] "Pharmaceutically acceptable salt" can refer to a physiologically and pharmaceutically acceptable salt of a pharmaceutically active ingredient (e.g., an antisense oligomer provided herein), such as a salt that retains the desired biological activity of the active ingredient and does not impart undesired toxicological effects.

[0188] "Phosphorothioate linkage" may refer to a linkage between nucleosides that modifies a phosphodiester bond by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0189] "Segment" may mean a specified number of adjacent (i.e., linked) nucleobases in a nucleic acid. In certain embodiments, the segment is a specified number of adjacent nucleobases in a target nucleic acid. In certain embodiments, the segment is a specified number of adjacent nucleobases in an antisense oligomer.

[0190] "Prevent" may mean delaying or stopping the onset or development of a disease or syndrome for a period of time, from minutes to days, weeks to months, or indefinitely.

[0191] "Therapeutically effective amount" may mean the amount of an agent that provides a therapeutic or prophylactic benefit to an animal.

[0192] "Ribonucleotide" may mean a nucleotide having a hydroxyl group at the 2'-position of the sugar moiety of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents.

[0193] "Segment" is defined as a smaller portion or sub-portion of a region within a target nucleic acid.

[0194] "Targeting" or "targeted" may mean the process by which an antisense oligomer is designed and selected to hybridize specifically to a target nucleic acid and induce a desired effect.

[0195] "Target nucleic acid", "target RNA", "target RNA transcript", and "nucleic acid target" may all mean a nucleic acid capable of being targeted by an antisense oligomer. In certain embodiments, the target nucleic acid is a UBE2A nucleic acid.

[0196] "Target region" may mean a portion of a target nucleic acid targeted by one or more antisense oligomers.

[0197] "Target segment" may mean the nucleotide sequence of a target nucleic acid targeted by an antisense oligomer. The "5'-target site" refers to the most 5'-terminal nucleotide of the target segment. The "3'-target site" refers to the most 3'-terminal nucleotide of the target segment.

[0198] "Therapeutically effective amount" may mean the amount of an agent that provides a therapeutic benefit to an individual. "Treat" may refer to administering a composition to effect a change or improvement in a disease or syndrome.

[0199] "Unmodified nucleobase" may mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0200] "Unmodified nucleotide" can mean a nucleotide consisting of a naturally occurring nucleobase, sugar moiety, and internucleoside linkage. In certain embodiments, the unmodified nucleotide is an RNA nucleotide (i.e., β-D-ribonucleoside) or a DNA nucleotide (i.e., β-D-deoxyribonucleoside).

[0201] "Wing segment" can mean a plurality of nucleosides that are modified to confer oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to in vivo nuclease degradation.

[0202] Generally, the present disclosure relates to agents (e.g., antisense oligomers, such as antisense oligonucleotides), compositions, kits, and methods for modulating the level of UBE3A in mammalian cells. In some cases, the agents provided herein modulate the level of an mRNA transcript that encodes the processing of the UBE3A protein in mammalian cells. In some cases, the present disclosure provides agents, compositions, kits, and methods for reducing the expression of the UBE3A protein in mammalian cells, where UBE3A is overexpressed, for example, in mammalian cells having a duplication, overexpression, or gain-of-function mutation of the UBE3A gene that encodes the UBE3A protein.

[0203] Target nucleic acid, target region, and nucleotide sequence

[0204] Ubiquitin-protein ligase E3A (UBE3A), also known as E6AP ubiquitin-protein ligase (E6AP), is an enzyme involved in targeting proteins for degradation within the cell. In humans, the UBE3A protein is encoded by the UBE3A gene. The UBE3A gene is located on the long (q) arm of chromosome 15 at position 15q11.2 between positions 11 and 13. In cells, the UBE3A protein can attach ubiquitin to a protein for degradation via the ubiquitin-proteasome degradation mechanism. After ubiquitin tagging, the protein can be recognized and digested by the proteasome. In humans, both copies of the UBE3A gene are normally active in most tissues of the body. However, in most neurons, only the maternal copy of the UBE3A gene is typically active.

[0205] The nucleotide sequences encoding UBE3A include, but are not limited to, the complementary sequences of positions 25333728 to 25439056 of GENBANK accession number NC_000015.10, or the complementary sequences of positions 556325..658147 of GENBANK accession number NG_002690.1. The nucleotide sequences encoding UBE3A include, but are not limited to, those listed in Table 1. The nucleotide sequences encoding UBE3A include, but are not limited to, those of any of the mRNA transcripts listed in Table 2. It should be understood that the sequences shown in each SEQ ID NO in Table 1 and the examples contained herein are independent of any modifications to the sugar moiety, internucleoside linkages, or nucleobases. Thus, the antisense oligomers defined by SEQ ID NO may independently contain one or more modifications to the sugar moiety, internucleoside linkages, or nucleobases.

[0206] In some cases, the agents provided herein (e.g., antisense oligomers) comprise a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the sequence shown in any of SEQ ID NOs: 93 - 120. In some cases, the agents provided herein (e.g., antisense oligomers) comprise a polynucleotide sequence that is at least 85%, 90%, 95%, 98%, or 100% complementary to at least 8 contiguous nucleic acids of the sequence shown in any of SEQ ID NOs: 93 - 120. In some cases, the agents provided herein (e.g., antisense oligomers) comprise a polynucleotide sequence that is 100% complementary to at least 8 contiguous nucleic acids of the sequence shown in any of SEQ ID NOs: 93 - 120.

[0207] In some cases, the agents provided herein (e.g., antisense oligomers) comprise a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the mRNA transcripts listed in Table 2. In some cases, the agents provided herein (e.g., antisense oligomers) comprise a polynucleotide sequence that is at least 85%, 90%, 95%, 98%, or 100% complementary to at least 8 contiguous nucleic acids of the mRNA transcripts listed in Table 2. In some cases, the agents provided herein (e.g., antisense oligomers) comprise a polynucleotide sequence that is 100% complementary to at least 8 contiguous nucleic acids of the mRNA transcripts listed in Table 2.

[0208] In certain embodiments, the target region is a structurally defined region of a target nucleic acid. For example, the target region can encompass the 3’UTR, 5’UTR, exons, introns, exon / intron junctions, coding regions, translation initiation regions, translation termination regions, or other defined nucleic acid regions. The structurally defined regions of UBE3A can be obtained by accession numbers from sequence databases such as NCBI, and such information is incorporated herein by reference. In certain embodiments, the target region encompasses the sequence from the 5’ target site of one target segment within the target region to the 3’ target site of another target segment within the same target region.

[0209] Targeting can include determining at least one target segment that hybridizes to the antisense oligomer such that a desired effect occurs (e.g., degradation of the mRNA transcript containing the at least one target segment). In certain embodiments, the desired effect is a reduction in the level of the mRNA target nucleic acid. In certain embodiments, the desired effect is a reduction in the level of the protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[0210] The target region can contain one or more target segments. Multiple target segments within the target region can overlap. Alternatively, they can be non-overlapping. In certain embodiments, the target segments within the target region are separated by no more than about 300 nucleotides. In certain embodiments, the target segments within the target region are separated by a plurality of nucleotides on the target nucleic acid, and the plurality of nucleotides are, are about, no more than, no more than about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides, or a range defined by any two of the foregoing values. In certain embodiments, the target segments within the target region are separated by no more than or no more than about 5 nucleotides on the target nucleic acid. In certain embodiments, the target segments are adjacent. The target region encompasses a range defined by a starting nucleic acid, which is either the 5’ target site or the 3’ target site listed herein.

[0211] In some embodiments, hybridization occurs between the antisense oligomers disclosed herein and the UBE3A nucleic acid. The most common hybridization mechanism involves hydrogen bonding between complementary nucleobases of nucleic acid molecules (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding).

[0212] Hybridization can occur under different conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0213] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the antisense oligomers provided herein can specifically hybridize to the UBE3A nucleic acid.

[0214] Table 1. Certain UBE3A nucleic acid sequences targeted by the agents provided herein

[0215]

[0216]

[0217] Table 2. Certain UBE3A mRNA transcripts targeted by the agents provided herein

[0218]

[0219]

[0220] *The sequences of the listed transcripts can be retrieved by searching for the transcript ID on e! Ensembl (useast.ensembl.org / index.html).

[0221] Antisense oligomers

[0222] In some aspects, the agents provided herein are antisense oligomers. The antisense oligomers provided herein can include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense oligomers, antisense oligonucleotides, and siRNA.

[0223] In certain embodiments, the antisense oligomer has a nucleobase sequence that, when written in the 5' to 3' direction, contains the reverse complementary sequence of the target segment of the target nucleic acid that it is designed to target. In certain such embodiments, the antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, contains the reverse complementary sequence of the target segment of the target nucleic acid that it is designed to target.

[0224] In some cases, the agents provided herein comprise an antisense oligomer, and the antisense oligomer comprises a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NO: 1-92. In some cases, the agents provided herein comprise an antisense oligomer, and the antisense oligomer comprises a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer comprises a sequence having 100% identity to the sequence shown in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer consists of a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer consists of a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NO: 1-92. In some cases, the antisense oligomer consists of a sequence having 100% identity to the sequence shown in any one of SEQ ID NO: 1-92.

[0225] In some cases, the agents provided herein comprise antisense oligomers, and the antisense oligomers comprise a sequence shown in any one of SEQ ID NOs: 1-92, with 0 to 4 nucleic acid substitutions. In some cases, the agents provided herein comprise antisense oligomers, and the antisense oligomers comprise a sequence shown in any one of SEQ ID NOs: 1-92, with 0 to 3 nucleic acid substitutions. In some cases, the agents provided herein comprise antisense oligomers, and the antisense oligomers comprise a sequence shown in any one of SEQ ID NOs: 1-92, with 0 to 2 nucleic acid substitutions. In some cases, the agents provided herein comprise antisense oligomers, and the antisense oligomers comprise a sequence shown in any one of SEQ ID NOs: 1-92, with 0 to 1 nucleic acid substitution.

[0226] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:1. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:1.

[0227] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:2. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:2.

[0228] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:3. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:3.

[0229] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:4. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:4.

[0230] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:5. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:5.

[0231] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:6. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:6.

[0232] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:7. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:7.

[0233] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:8. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:8.

[0234] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:9. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:9.

[0235] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:10. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:10.

[0236] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:11. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:11.

[0237] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:12. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:12.

[0238] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:13. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:13.

[0239] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 14. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 14.

[0240] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 15. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 15.

[0241] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 16. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 16.

[0242] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 17. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 17.

[0243] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 18. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 18.

[0244] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 19. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 19.

[0245] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 20. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 20.

[0246] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:21. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:21.

[0247] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:22. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:22.

[0248] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:23. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:23.

[0249] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:24. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:24.

[0250] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:25. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:25.

[0251] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:26. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:26.

[0252] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:27. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:27.

[0253] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:28. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:28.

[0254] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:29. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:29.

[0255] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:30. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:30.

[0256] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:31. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:31.

[0257] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:32. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:32.

[0258] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:33. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:33.

[0259] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:34. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:34.

[0260] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 35. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 35.

[0261] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 36. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 36.

[0262] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 37. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 37.

[0263] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 38. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 38.

[0264] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 39. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 39.

[0265] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 40. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 40.

[0266] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 41. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 41.

[0267] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 42. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 42.

[0268] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 43. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 43.

[0269] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 44. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 44.

[0270] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 45. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 45.

[0271] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 46. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 46.

[0272] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 47. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 47.

[0273] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 48. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 48.

[0274] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 49. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 49.

[0275] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 50. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 50.

[0276] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 51. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 51.

[0277] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 52. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 52.

[0278] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 53. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 53.

[0279] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 54. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 54.

[0280] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO: 55. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO: 55.

[0281] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:56. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:56.

[0282] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:57. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:57.

[0283] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:58. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:58.

[0284] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:59. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:59.

[0285] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:60. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:60.

[0286] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:61. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:61.

[0287] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:62. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:62.

[0288] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:63. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:63.

[0289] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:64. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:64.

[0290] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:65. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:65.

[0291] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:66. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:66.

[0292] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:67. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:67.

[0293] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:68. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:68.

[0294] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:69. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:69.

[0295] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:70. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:70.

[0296] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:71. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:71.

[0297] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:72. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:72.

[0298] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:73. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:73.

[0299] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:74. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:74.

[0300] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:75. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:75.

[0301] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:76. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:76.

[0302] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:77. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:77.

[0303] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:78. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:78.

[0304] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:79. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:79.

[0305] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:80. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:80.

[0306] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:81. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:81.

[0307] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:82. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:82.

[0308] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:83. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:83.

[0309] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:84. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:84.

[0310] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:85. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:85.

[0311] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:86. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:86.

[0312] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:87. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:87.

[0313] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:88. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:88.

[0314] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:89. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:89.

[0315] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:90. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:90.

[0316] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:91. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:91.

[0317] In some cases, the antisense oligomers provided herein comprise a sequence having at least 90%, 92%, 95%, 98% or 100% identity to the sequence of SEQ ID NO:92. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:92.

[0318] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:1 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:1 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:1 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:1 with 0 to 1 nucleic acid substitution.

[0319] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:2 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:2 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:2 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:2 with 0 to 1 nucleic acid substitution.

[0320] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:3 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:3 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:3 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:3 with 0 to 1 nucleic acid substitution.

[0321] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:4 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:4 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:4 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:4 with 0 to 1 nucleic acid substitution.

[0322] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:5 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:5 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:5 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:5 with 0 to 1 nucleic acid substitution.

[0323] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:6 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:6 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:6 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:6 with 0 to 1 nucleic acid substitution.

[0324] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:7 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:7 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:7 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:7 with 0 to 1 nucleic acid substitution.

[0325] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:8, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:8, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:8, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:8, with 0 to 1 nucleic acid substitution.

[0326] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:9, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:9, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:9, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:9, with 0 to 1 nucleic acid substitution.

[0327] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:10, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:10, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:10, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:10, with 0 to 1 nucleic acid substitution.

[0328] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:11, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:11, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:11, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:11, with 0 to 1 nucleic acid substitution.

[0329] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:12 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:12 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:12 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:12 with 0 to 1 nucleic acid substitution.

[0330] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:13 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:13 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:13 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:13 with 0 to 1 nucleic acid substitution.

[0331] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:14 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:14 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:14 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:14 with 0 to 1 nucleic acid substitution.

[0332] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:15 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:15 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:15 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:15 with 0 to 1 nucleic acid substitution.

[0333] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:16, having from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:16, having from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:16, having from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:16, having from 0 to 1 nucleic acid substitution.

[0334] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:17, having from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:17, having from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:17, having from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:17, having from 0 to 1 nucleic acid substitution.

[0335] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:18, having from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:18, having from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:18, having from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:18, having from 0 to 1 nucleic acid substitution.

[0336] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:19, having from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:19, having from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:19, having from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:19, having from 0 to 1 nucleic acid substitution.

[0337] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:20 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:20 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:20 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:20 with 0 to 1 nucleic acid substitution.

[0338] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:21 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:21 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:21 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:21 with 0 to 1 nucleic acid substitution.

[0339] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:22 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:22 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:22 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:22 with 0 to 1 nucleic acid substitution.

[0340] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:23 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:23 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:23 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:23 with 0 to 1 nucleic acid substitution.

[0341] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:24 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:24 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:24 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:24 with 0 to 1 nucleic acid substitution.

[0342] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:25 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:25 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:25 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:25 with 0 to 1 nucleic acid substitution.

[0343] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:26 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:26 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:26 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:26 with 0 to 1 nucleic acid substitution.

[0344] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:27 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:27 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:27 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:27 with 0 to 1 nucleic acid substitution.

[0345] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:28, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:28, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:28, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:28, with 0 to 1 nucleic acid substitution.

[0346] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:29, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:29, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:29, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:29, with 0 to 1 nucleic acid substitution.

[0347] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:30, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:30, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:30, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:30, with 0 to 1 nucleic acid substitution.

[0348] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:31, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:31, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:31, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:31, with 0 to 1 nucleic acid substitution.

[0349] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:32, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:32, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:32, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:32, with 0 to 1 nucleic acid substitution.

[0350] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:33, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:33, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:33, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:33, with 0 to 1 nucleic acid substitution.

[0351] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:34, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:34, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:34, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:34, with 0 to 1 nucleic acid substitution.

[0352] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:35, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:35, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:35, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:35, with 0 to 1 nucleic acid substitution.

[0353] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:36, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:36, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:36, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:36, with 0 to 1 nucleic acid substitution.

[0354] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:37, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:37, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:37, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:37, with 0 to 1 nucleic acid substitution.

[0355] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:38, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:38, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:38, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:38, with 0 to 1 nucleic acid substitution.

[0356] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:39, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:39, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:39, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:39, with 0 to 1 nucleic acid substitution.

[0357] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:40 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:40 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:40 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:40 with 0 to 1 nucleic acid substitution.

[0358] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:41 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:41 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:41 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:41 with 0 to 1 nucleic acid substitution.

[0359] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:42 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:42 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:42 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:42 with 0 to 1 nucleic acid substitution.

[0360] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:43 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:43 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:43 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:43 with 0 to 1 nucleic acid substitution.

[0361] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:44 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:44 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:44 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:44 with 0 to 1 nucleic acid substitution.

[0362] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:45 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:45 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:45 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:45 with 0 to 1 nucleic acid substitution.

[0363] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:46 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:46 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:46 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:46 with 0 to 1 nucleic acid substitution.

[0364] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:47 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:47 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:47 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:47 with 0 to 1 nucleic acid substitution.

[0365] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:48 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:48 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:48 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:48 and have from 0 to 1 nucleic acid substitution.

[0366] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:49 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:49 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:49 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:49 and have from 0 to 1 nucleic acid substitution.

[0367] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:50 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:50 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:50 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:50 and have from 0 to 1 nucleic acid substitution.

[0368] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:51 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:51 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:51 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:51 and have from 0 to 1 nucleic acid substitution.

[0369] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:52 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:52 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:52 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:52 with 0 to 1 nucleic acid substitution.

[0370] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:53 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:53 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:53 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:53 with 0 to 1 nucleic acid substitution.

[0371] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:54 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:54 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:54 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:54 with 0 to 1 nucleic acid substitution.

[0372] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:55 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:55 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:55 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:55 with 0 to 1 nucleic acid substitution.

[0373] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:56 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:56 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:56 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:56 with 0 to 1 nucleic acid substitution.

[0374] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:57 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:57 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:57 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:57 with 0 to 1 nucleic acid substitution.

[0375] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:58 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:58 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:58 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:58 with 0 to 1 nucleic acid substitution.

[0376] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:59 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:59 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:59 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:59 with 0 to 1 nucleic acid substitution.

[0377] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:60 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:60 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:60 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:60 with 0 to 1 nucleic acid substitution.

[0378] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:61 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:61 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:61 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:61 with 0 to 1 nucleic acid substitution.

[0379] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:62 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:62 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:62 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:62 with 0 to 1 nucleic acid substitution.

[0380] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:63 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:63 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:63 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:63 with 0 to 1 nucleic acid substitution.

[0381] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:64 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:64 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:64 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:64 with 0 to 1 nucleic acid substitution.

[0382] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:65 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:65 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:65 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:65 with 0 to 1 nucleic acid substitution.

[0383] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:66 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:66 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:66 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:66 with 0 to 1 nucleic acid substitution.

[0384] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:67 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:67 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:67 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:67 with 0 to 1 nucleic acid substitution.

[0385] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:68 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:68 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:68 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:68 and have from 0 to 1 nucleic acid substitution.

[0386] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:69 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:69 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:69 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:69 and have from 0 to 1 nucleic acid substitution.

[0387] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:70 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:70 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:70 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:70 and have from 0 to 1 nucleic acid substitution.

[0388] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:71 and have from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:71 and have from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:71 and have from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:71 and have from 0 to 1 nucleic acid substitution.

[0389] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:72 with from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:72 with from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:72 with from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:72 with from 0 to 1 nucleic acid substitution.

[0390] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:73 with from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:73 with from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:73 with from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:73 with from 0 to 1 nucleic acid substitution.

[0391] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:74 with from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:74 with from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:74 with from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:74 with from 0 to 1 nucleic acid substitution.

[0392] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:75 with from 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:75 with from 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:75 with from 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:75 with from 0 to 1 nucleic acid substitution.

[0393] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:76 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:76 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:76 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:76 with 0 to 1 nucleic acid substitution.

[0394] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:77 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:77 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:77 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:77 with 0 to 1 nucleic acid substitution.

[0395] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:78 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:78 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:78 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:78 with 0 to 1 nucleic acid substitution.

[0396] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:79 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:79 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:79 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:79 with 0 to 1 nucleic acid substitution.

[0397] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:80 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:80 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:80 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:80 with 0 to 1 nucleic acid substitution.

[0398] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:81 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:81 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:81 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:81 with 0 to 1 nucleic acid substitution.

[0399] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:82 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:82 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:82 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:82 with 0 to 1 nucleic acid substitution.

[0400] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:83 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:83 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:83 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:83 with 0 to 1 nucleic acid substitution.

[0401] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:84, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:84, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:84, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:84, with 0 to 1 nucleic acid substitution.

[0402] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:85, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:85, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:85, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:85, with 0 to 1 nucleic acid substitution.

[0403] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:86, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:86, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:86, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:86, with 0 to 1 nucleic acid substitution.

[0404] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:87, with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:87, with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:87, with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:87, with 0 to 1 nucleic acid substitution.

[0405] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:88 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:88 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:88 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:88 with 0 to 1 nucleic acid substitution.

[0406] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:89 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:89 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:89 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:89 with 0 to 1 nucleic acid substitution.

[0407] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:90 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:90 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:90 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:90 with 0 to 1 nucleic acid substitution.

[0408] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:91 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:91 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:91 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:91 with 0 to 1 nucleic acid substitution.

[0409] In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:92 with 0 to 4 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:92 with 0 to 3 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:92 with 0 to 2 nucleic acid substitutions. In some cases, the antisense oligomers provided herein comprise the sequence of SEQ ID NO:92 with 0 to 1 nucleic acid substitution.

[0410] In certain embodiments, the antisense oligomers targeting the target nucleic acid are 12 to 30 subunits in length. In certain embodiments, the antisense oligomers targeting the target nucleic acid are 12 to 25 subunits in length. In certain embodiments, the antisense oligomers targeting the target nucleic acid are 12 to 22 subunits in length. In certain embodiments, the antisense oligomers targeting the target nucleic acid are 14 to 20 subunits in length. In certain embodiments, the antisense oligomers targeting the target nucleic acid are 15 to 25 subunits in length. In certain embodiments, the antisense oligomers targeting the target nucleic acid are 18 to 22 subunits in length. In certain embodiments, the antisense oligomers targeting the target nucleic acid are 19 to 21 subunits in length. In certain embodiments, the antisense oligomers are 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 30, 18 to 50, 19 to 30, 19 to 50, or 20 to 30 linked subunits in length.

[0411] In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 12 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 13 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 14 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 15 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 16 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 17 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 18 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 19 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 20 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 21 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 22 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 23 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 24 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 25 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 26 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 27 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 28 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 29 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 30 subunits. In certain embodiments, the antisense oligomer targeting a target nucleic acid has a length of 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80 linked subunits, or a range defined by any two of the above values. In certain embodiments, the antisense oligomer is an antisense oligonucleotide and the linked subunits are nucleosides.

[0412] The antisense oligomers provided herein may have nucleotides that are mismatched to the target sequence. For example, an antisense oligonucleotide 25 nucleobases in length may have 8 or 11 mismatched bases near the ends of the antisense oligonucleotide and still be able to direct specific cleavage of the target mRNA, although to a lesser extent than an antisense oligonucleotide without mismatches. In some cases, the antisense oligonucleotides provided herein are 12 to 30 subunits (e.g., nucleobases) in length, including subunits with 1 or 3 mismatches.

[0413] Chemically Modified Antisense Oligomers

[0414] In certain embodiments, the antisense oligomers provided herein have chemically modified subunits arranged in a pattern or motif to confer upon the antisense oligomers properties such as enhanced inhibitory activity, increased binding affinity for the target nucleic acid, or resistance to nuclease degradation in vivo.

[0415] In some instances, chimeric antisense oligomers are provided herein. For example, a chimeric antisense oligomer can contain at least one modified region to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of the chimeric antisense oligomer can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand in an RNA:DNA duplex.

[0416] In some instances, the antisense oligomers provided herein have a spacer-polymer motif. Antisense oligomers having a spacer-polymer motif can be considered chimeric antisense oligomers. In a spacer-polymer, an internal region having a plurality of nucleotides that support RNase H cleavage is positioned between outer regions having a plurality of nucleotides with nucleosides that are chemically different from the internal region. In the case of an antisense oligonucleotide having a spacer-polymer motif, the gap segment generally serves as a substrate for endonuclease cleavage, while the wing segments contain modified nucleosides. In certain embodiments, the regions of the spacer-polymer are distinguished by the type of sugar moiety that makes up each different region. Types of sugar moieties that can be used to distinguish the regions of the spacer-polymer can include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides can include 2'-MOE and 2'-O-CH3, etc.), and bicyclic sugar-modified nucleosides (such bicyclic sugar-modified nucleosides can include those having a 4'-(CH2)n-O-2' bridge (where n = 1 or n = 2) and 4'-CH2-O-CH2-2'). In certain embodiments, the wing includes a number of modified sugar moieties, including for example 2'-MOE. In certain embodiments, the wing includes a number of modified and unmodified sugar moieties. In certain embodiments, the wing includes various combinations of 2'-MOE nucleosides and 2'-deoxynucleosides.

[0417] Each distinct region may contain a uniform sugar moiety, variant, or alternating sugar moieties. The wing-gap-wing motif is often described as "X-Y-Z", where "X" represents the length of the 5' wing, "Y" represents the length of the gap, and "Z" represents the length of the 3' wing. "X" and "Z" may contain uniform variants or alternating sugar moieties. In certain embodiments, "X" and "Y" include one or more 2'-deoxynucleosides. "Y" may contain 2'-deoxynucleosides. As used herein, the configuration of the spacer oligomer described as "X-Y-Z" is such that the gap is directly adjacent to each of the 5' wing and the 3' wing. Thus, there are no intervening nucleotides between the 5' wing and the gap, or between the gap and the 3' wing. Any of the antisense oligomers described herein may have a spacer oligomer motif. In certain embodiments, "X" and "Z" are the same; in other cases, they are different.

[0418] In some cases, the spacer oligomers provided herein include, for example, 20-mers having a motif of 5-10-5, in the form of "X-Y-Z" as described herein. In certain embodiments, the spacer oligomers provided herein include, for example, 19-mers having a motif of 5-9-5, in the form of "X-Y-Z" as described herein. In certain embodiments, the spacer oligomers provided herein include, for example, 18-mers having a motif of 5-8-5, in the form of "X-Y-Z" as described herein. In certain embodiments, the spacer oligomers provided herein include, for example, 18-mers having a motif of 4-8-6, in the form of "X-Y-Z" as described herein. In certain embodiments, the spacer oligomers provided herein include, for example, 18-mers having a motif of 6-8-4, in the form of "X-Y-Z" as described herein. In certain embodiments, the spacer oligomers provided herein include, for example, 18-mers having a motif of 5-7-6, in the form of "X-Y-Z" as described herein.

[0419] In some cases, the antisense oligomer comprises: a 5' region (e.g., the "X" portion discussed above) consisting of three, four, five, or six linked nucleosides; a central region (e.g., the "Y" portion discussed above) consisting of eight, nine, ten, eleven, or twelve linked nucleosides; and a 3' region (e.g., the "Z" portion discussed above) consisting of three, four, five, or six linked nucleosides. In some cases, each of the three, four, five, or six linked nucleosides in the 5' region and each of the three, four, five, or six linked nucleosides in the 3' region comprise a modified sugar moiety, and each of the eight, nine, ten, eleven, or twelve linked nucleosides in the central region is a deoxyribonucleoside. In some cases, the modified sugar moiety includes a 2'-O-methyl moiety, a 2'-fluoro moiety, a 2'-O-methoxyethyl moiety, or a 2'-NMA moiety or any combination thereof. In some cases, one or more nucleosides in the 5' and 3' regions further comprise other modifications disclosed herein. In some cases, all nucleosides in the 5' and 3' regions further comprise other modifications disclosed herein.

[0420] Complementarity

[0421] When a sufficient number of nucleobases in a polynucleotide (e.g., an antisense oligomer) can hydrogen bond with the corresponding nucleobases in a target nucleic acid, the agents provided herein can have a polynucleotide sequence complementary to the target nucleic acid, whereby the desired effect (e.g., antisense inhibition of a target nucleic acid, such as a UBE3A nucleic acid) can occur.

[0422] Non-complementary nucleobases between the agent (e.g., an antisense oligomer) and the target nucleic acid can be tolerated as long as the agent (e.g., an antisense oligomer) remains capable of specifically hybridizing to the target nucleic acid. In addition, the agent (e.g., an antisense oligomer) can hybridize to one or more segments of the target nucleic acid such that intervening or adjacent segments do not participate in the hybridization event (e.g., loop structures, mismatches, or hairpin structures).

[0423] In certain embodiments, an agent provided herein (e.g., an antisense oligomer) or a designated portion thereof is or is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a UBE3A nucleic acid, a target region, a target segment or a designated portion thereof. The percentage of complementarity of an antisense oligomer to a target nucleic acid can be determined using conventional methods, such as using the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The percentage of homology, sequence identity or complementarity can be determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.) using default settings, which program uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

[0424] In certain embodiments, an agent provided herein (e.g., an antisense oligomer) or a designated portion thereof is completely complementary (i.e., 100% complementary) to a target nucleic acid or a designated portion thereof. For example, an agent provided herein (e.g., an antisense oligomer) can be completely complementary to a UBE3A nucleic acid, or its target region, or target segment or target sequence. As used herein, "completely complementary" can mean that each nucleobase of the antisense oligomer can base pair precisely with the corresponding nucleobase of the target nucleic acid.

[0425] The position of a non-complementary nucleobase can be at the 5' end or the 3' end of the antisense oligomer. Alternatively, one or more non-complementary nucleobases can be at internal positions of the antisense oligomer. When there are two or more non-complementary nucleobases, they can be adjacent (i.e., contiguous) or non-adjacent. In one embodiment, the non-complementary nucleobases are located in the wing segments of a spacer polymer antisense oligonucleotide.

[0426] In certain embodiments, an antisense oligomer provided herein that is of length 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleobases or less contains no more than 4, no more than 3, no more than 2 or no more than 1 nucleobase that is non-complementary relative to the target nucleic acid or a designated portion thereof.

[0427] In certain embodiments, the antisense oligomers provided herein that are of a length of or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases contain no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleobase that is non-complementary to the target nucleic acid or a designated portion thereof.

[0428] The agents provided herein (e.g., antisense oligomers) can also include those that are complementary to a portion of the target nucleic acid. As used herein, "portion" can refer to a defined number of contiguous (i.e., linked) nucleobases within a region or segment of the target nucleic acid. "Portion" can also refer to a defined number of contiguous nucleobases in the antisense oligomer. In certain embodiments, the agent (e.g., antisense oligomer) is at least 8 nucleobases partially complementary to the target segment. In certain embodiments, the agent (e.g., antisense oligomer) is at least 9 nucleobases partially complementary to the target segment. In certain embodiments, the agent (e.g., antisense oligomer) is at least 10 nucleobases partially complementary to the target segment. In certain embodiments, the agent (e.g., antisense oligomer) is at least 11 nucleobases partially complementary to the target segment. In certain embodiments, the agent (e.g., antisense oligomer) is at least 12 nucleobases partially complementary to the target segment. In certain embodiments, the agent (e.g., antisense oligomer) is at least 13 nucleobases partially complementary to the target segment. In certain embodiments, the agent (e.g., antisense oligomer) is at least 14 nucleobases partially complementary to the target segment. In certain embodiments, the agent (e.g., antisense oligomer) is at least 15 nucleobases partially complementary to the target segment. Also encompassed are antisense oligomers that are at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobases partially complementary to the target segment or within a range defined by any two of these values.

[0429] The agents provided herein (e.g., antisense oligomers) can also have a defined percentage of identity with a specific nucleotide sequence SEQ ID NO or a portion thereof. As used herein, an antisense oligomer is the same as a sequence disclosed herein if it has the same nucleobase pairing ability. For example, an RNA containing uracil instead of thymine in a disclosed DNA sequence will be considered the same as the DNA sequence because both uracil and thymine pair with adenine. Also encompassed are shortened and lengthened forms of the antisense oligomers described herein and oligomers having bases that are not the same as those of the antisense oligomers provided herein. The non-identical bases can be adjacent to each other or dispersed throughout the antisense oligomer. The percentage of identity of an antisense oligomer is calculated based on the number of bases having the same base pairing relative to the sequence to which it is compared.

[0430] In certain embodiments, an agent (e.g., an antisense oligomer) or a portion thereof is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an agent (e.g., an antisense oligomer) or SEQ ID NO disclosed herein, or a portion thereof.

[0431] In certain embodiments, a portion of an agent (e.g., an antisense oligomer) is compared to an equal length portion in a target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobase portion is compared to an equal length portion in a target nucleic acid.

[0432] In certain embodiments, a portion of an antisense oligonucleotide is compared to an equal length portion in a target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobase portion is compared to an equal length portion in a target nucleic acid.

[0433] Modification

[0434] In some embodiments, compared to a naturally occurring nucleotide (or the native form of an antisense oligomer) having the same or a comparable polynucleotide sequence, the antisense oligomers provided herein may have one or more chemical modifications. Modifications to the antisense oligomers encompass substitutions or alterations to internucleoside linkages, sugar moieties or nucleobases. Modified antisense oligomers may be superior to the native form because they have desired properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases or increased inhibitory activity.

[0435] Chemically modified nucleosides can also be used to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Thus, comparable results can often be obtained with shorter antisense oligomers having such chemically modified nucleosides.

[0436] A nucleoside can be a base-sugar combination. The nucleobase (also called a base) portion of a nucleoside can be a heterocyclic base portion in its native form. A nucleotide is a nucleoside that further includes a phosphate group covalently linked to the sugar moiety of the nucleoside. For those nucleosides that include a furanose sugar, the phosphate group can be linked to the 2’, 3’ or 5’ hydroxyl portion of the sugar. An oligonucleotide is formed by covalently linking adjacent nucleosides to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are often considered to form the internucleoside linkages of the oligonucleotide.

[0437] Modified internucleoside linkages

[0438] The naturally occurring internucleoside linkages of RNA and DNA are 3'-to-5' phosphodiester linkages. The antisense oligomers provided herein can have one or more modified, i.e., non-naturally occurring, internucleoside linkages. Antisense oligomers having one or more modified internucleotide linkages can have desired properties such as, for example, enhanced cellular uptake, enhanced affinity for the target nucleic acid, and increased stability in the presence of nucleases.

[0439] Oligonucleotides having modified internucleoside linkages can include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate.

[0440] In certain embodiments, the antisense oligomers targeting UBE3A nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are dispersed throughout the antisense oligomer. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In certain embodiments, each internucleoside linkage of the antisense oligomer is a phosphorothioate internucleoside linkage.

[0441] Modified sugar moieties

[0442] The antisense oligomers provided herein can contain one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides can confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense oligomer. In certain embodiments, the nucleoside comprises a chemically modified furanose ring moiety.

[0443] Examples of chemically modified furanose rings include, but are not limited to, adding substituents (including 5' and 2' substituents); bridging non-annular atoms of the ring to form a bicyclic nucleic acid (BNA); replacing the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (wherein R, R1, and R2 are each independently H, C1-C 12 alkyl, or a protecting group); and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl-substituted nucleosides (see PCT International Application WO 2008 / 101157 for other disclosed 5',2'-disubstituted nucleosides); or replacing the ribosyl ring oxygen atom with S, with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005); or alternatively 5'-substitution of BNA (see PCT International Application WO 2007 / 134181, wherein LNA is substituted, for example, with a 5'-methyl or 5'-vinyl group).

[0444] Examples of nucleosides having modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, 2'-NMA, and 2'-O(CH2)2OCH3 substituents. Substituents at the 2'-position may also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C 10 alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-O-N(R m )(R n )、O-CH2-C(=O)-N(R m )(R n ) and O-CH2-C(=O)-N(R l )-(CH2)2-N(R m )(R n ), where each R l 、R m and R n is independently H, or substituted or unsubstituted C1-C 10 alkyl.

[0445] As used herein, "bicyclic nucleoside" may refer to a modified nucleoside comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides that contain a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense oligomers provided herein include one or more bicyclic nucleosides that contain a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, one of those described below: U.S. Patent Nos. 7,399,845, 8,278,283, U.S. Patent Applications 7,696,345, 7,427,672, 8,278,426, 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207, 7,399,845, 7,547,684, 7,741,457, and 7,696,345; U.S. Patent Nos.; U.S. Patent Publication No. US2008-0039618; and Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc, 2007, 129(26)8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol, 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243. Each of the foregoing bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, a-L-ribofuranose and β-D-ribofuranose (see PCT International Application PCT / DK98 / 00393, published as WO 99 / 14226 on March 25, 1999). In certain embodiments, the bicyclic sugar moiety of the BNA nucleoside includes, but is not limited to, that described in U.S. Patent No. 11,129,844.

[0446] The synthesis and preparation of the methyleneoxy (4'-CH2-O-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine, and uracil have been described, as well as their oligomerization and nucleic acid recognition properties (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630).

[0447] As used herein, "4'-2' bicyclic nucleoside" or "4'-to-2' bicyclic nucleoside" may refer to a bicyclic nucleoside that includes a furanose ring and a bridge that links two carbon atoms of the furanose ring, the bridge linking the 2'-carbon atom and the 4'-carbon atom of the sugar ring.

[0448] As used herein, "monocyclic nucleoside" may refer to a nucleoside that includes a modified sugar moiety and the sugar moieties are not bicyclic sugar moieties. In certain embodiments, the sugar moiety or sugar moiety analog of the nucleoside is modified or substituted at any position.

[0449] As used herein, "2'-modified sugar" may mean a furanosyl sugar modified at the 2'-position. In certain embodiments, such modifications include substitutions selected from the group consisting of: halides, including but not limited to, substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2'-modification is selected from substituents including but not limited to the following: O[(CH2) n O] m CH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n F, O(CH2) n ONH2, OCH2C(=O)N(H)CH3 and O(CH2) n ON[(CH2) n CH3]2, where n and m are from 1 to about 10. Other 2'-substituents may also be selected from: C1-C 12An alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, a group for modifying pharmacokinetic properties, or a group for modifying the pharmacodynamic properties of an antisense oligomer, and other substituents having similar properties. In certain embodiments, the modified nucleoside comprises a 2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitutions have been described as having improved binding affinities compared to unmodified nucleosides and other modified nucleosides such as 2'-O-methyl, O-propyl and O-aminopropyl. It has also been shown that oligonucleotides having 2'-MOE substituents are antisense inhibitors of gene expression and have promising characteristics for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[0450] As used herein, "2'-NMA" may mean -O-CH2-C(=O)-NH-CH3 replacing the 2'-OH group of the ribosyl sugar moiety. A "2'-NMA sugar moiety" or "2'-NMA moiety" is a sugar moiety having a 2'-O-CH2-C(=O)-NH-CH3 group replacing the 2'-OH group of the ribosyl sugar moiety. Unless otherwise specified, the 2'-NMA sugar moiety is in the β-D configuration. "NMA" may mean O-N-methylacetamide.

[0451] As used herein, a "2'-NMA nucleoside" may mean a nucleoside comprising a 2'-NMA sugar moiety.

[0452] As used herein, "2'-F" may refer to a nucleoside comprising a sugar that contains a fluorine group at the 2' position.

[0453] As used herein, "2'-OMe" or "2'-OCH3" or "2'-O-methyl" each may refer to a nucleoside comprising a sugar that contains an -OCH3 group at the 2' position of the sugar ring.

[0454] As used herein, "MOE" or "2'-MOE" or "2'-OCH2CH2OCH3" or "2'-O-methoxyethyl" each refers to a nucleoside containing a sugar, the sugar containing an -OCH2CH2OCH3 group at the 2' position of the sugar ring.

[0455] In certain embodiments, one or more of the plurality of nucleosides are modified. In certain embodiments, the oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA). In certain embodiments, the oligonucleotide comprises a mixture of one or more ribonucleosides (RNA) and deoxyribonucleosides (DNA).

[0456] Many other bicyclic and tricyclic sugar replacement ring systems are also known in the art and can be used to modify nucleosides for incorporation into antisense oligomers (see, for example, the review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.

[0457] Methods for preparing modified sugars are well known to those skilled in the art.

[0458] In nucleotides having a modified sugar moiety, the nucleobase moiety (natural nucleobase moiety, modified nucleobase moiety or a combination thereof) remains hybridized to the appropriate nucleic acid target.

[0459] In certain embodiments, the antisense oligomer comprises one or more nucleosides having a modified sugar moiety. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE-modified nucleosides are arranged in a spacer polymer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH3)-0-2') bridging group. In certain embodiments, the (4'-CH(CH3)-0-2')-modified nucleosides are arranged in the wings of the entire spacer polymer motif.

[0460] "5'-methylcytosine" can mean cytosine modified with a methyl group attached to the 5' position. 5'-methylcytosine is a modified nucleobase.

[0461] "5'-methyluracil" can mean uracil modified with a methyl group attached to the 5' position. 5'-methyluracil is a modified nucleobase.

[0462] "5'-methylthymine" can mean thymine modified with a methyl group attached to the 5' position. 5'-methylthymine is a modified nucleobase.

[0463] In some cases, the antisense oligomers provided herein include 5'-methylcytosine, 5'-methyluracil, 5'-methylthymine, or a combination thereof. In some cases, each cytosine in the antisense oligomer is methylated, i.e., has a methyl group attached to the 5'-position. In some cases, each uracil in the antisense oligomer is methylated, i.e., has a methyl group attached to the 5'-position. In some cases, the antisense oligomer has 1, 2, 3, 4, 5, 6, 7, 8 or more 5'-methylcytosines. In some cases, the antisense oligomer has 1, 2, 3, 4, 5, 6, 7, 8 or more 5'-methyluracils. In some cases, the antisense oligomer has both methylcytosine and methyluracil.

[0464] Drug Compositions and Methods of Treatment

[0465] In some aspects, the present disclosure provides a pharmaceutical composition comprising an agent of the present disclosure, such as an antisense oligomer, or a vector encoding the agent.

[0466] A pharmaceutical composition or formulation comprising an agent (e.g., an antisense oligomer) described herein or a vector encoding the agent and used in any of the described methods can be prepared according to conventional techniques well known in the pharmaceutical industry and are described in the published literature. In some embodiments, a pharmaceutical composition or formulation for treating a subject comprises an effective amount of any antisense oligomer described herein or a pharmaceutically acceptable salt, solvate, hydrate, or ester thereof. A pharmaceutical formulation comprising an antisense oligomer may further comprise a pharmaceutically acceptable excipient, diluent, or carrier.

[0467] In some cases, when provided at the maximum dose level (the maximum concentration upon in vitro delivery, the maximum dose upon in vivo delivery, without causing significant adverse effects to cells or subjects), the antisense oligomers provided herein have a moderate level of efficiency in reducing the level of UBE3A transcript (e.g., antisense oligomers) in cells, capable of reducing the UBE3A transcript level by up to 75%, up to 70%, up to 65%, up to 60%, up to 55%, up to 50%, up to 45%, up to 40%, up to 35%, up to 30%, up to 20%, or about 25% to about 75%, about 30% to about 70%, about 35% to about 65%, about 40% to about 60%, or about 45% to about 55%. Without wishing to be bound by certain theories, the antisense oligomers provided herein with a moderate level of UBE3A knockdown efficiency may have desirable therapeutic applications. The moderate level of knockdown efficiency of the antisense oligomers may indicate that the antisense oligomers target sequences that are not present in all UBE3A transcripts, sequences that are inaccessible to the antisense oligomers at a given time, or both. For example, an antisense oligomer provided herein that can achieve about 50% maximum UBE3A knockdown efficiency in cells may target sequences that are present in only 50% of the UBE3A transcripts in the cells. Alternatively or additionally, it may be that half of the time the target site of the antisense oligomer on the UBE3A transcript is occupied by another protein complex, or the antisense oligomer is physically inaccessible. Since an abnormally low level of UBE3A protein may also lead to pathological conditions, antisense oligomers administered appropriately are required in therapeutic applications to reduce the UBE3A transcript without causing adverse effects due to excessive reduction of the UBE3A transcript level. By using the antisense oligomers provided herein with a moderate level of knockdown efficiency, an upper limit can be set on the amount of UBE3A knockdown by the antisense oligomers. Therefore, the upper limit on the amount of UBE3A knockdown can create a safety buffer, preventing the antisense oligomers from excessively reducing the UBE3A transcript when the antisense oligomers are administered to a subject in need of reducing the UBE3A level, e.g., a subject having a duplication, overexpression, or gain-of-function mutation of the UBE3A gene, or an increased activity or expression level of the UBE3A protein.

[0468] The agents (e.g., antisense oligomers) or carriers provided herein can be mixed with pharmaceutically acceptable active or inert substances to prepare pharmaceutical compositions or formulations. Agents targeting UBE3A nucleic acids (e.g., antisense oligomers) can be used in pharmaceutical compositions by combining the agent with a suitable pharmaceutically acceptable diluent or carrier. Pharmaceutically acceptable diluents can include phosphate buffered saline (PBS), artificial cerebrospinal fluid (aCSF), normal saline, or any other suitable solution.

[0469] In some cases, the compositions and methods provided herein relate to carriers encoding the agents provided herein. In some cases, the carrier includes a viral vector encoding the agent. In some cases, the viral vector includes an adenoviral vector, an adeno-associated virus (AAV) vector, a lentiviral vector, a herpes simplex virus (HSV) viral vector, or a retroviral vector.

[0470] Pharmaceutically acceptable salts are suitable for contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and are commensurate with a reasonable benefit / risk ratio. (See, e.g., S.M. Berge, et al., J. Pharmaceutical Sciences, 66:1-19 (1977), incorporated herein by reference for this purpose). These salts can be prepared in situ during the final isolation and purification of the compound, or separately by reacting the free base with a suitable organic acid. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts formed by the reaction of an amino group with an inorganic acid (such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or with an organic acid (such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid) or by using other documented methods (such as ion exchange). Other pharmaceutically acceptable salts include adipates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, citrates, cyclopentanepropionates, digluconates, dodecyl sulfates, ethanesulfonates, formates, fumarates, glucoheptanoates, glycerophosphates, glucuronates, hemisulfates, heptanoates, hexanoates, hydroiodides, 2-hydroxyethanesulfonates, lactates, lactobionates, laurates, lauryl sulfates, malates, maleates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, oxalates, palmitates, pamoates, pectates, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propionates, stearates, succinates, sulfates, tartrates, thiocyanates, p-toluenesulfonates, undecanoates, valerates, etc. Representative alkali metal or alkaline earth metal salts include sodium salts, lithium salts, potassium salts, calcium salts, magnesium salts, etc. Where appropriate, other pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using relative ions (such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates).

[0471] In some embodiments, the composition is formulated into any one of a number of possible dosage forms, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. In an embodiment, the composition is formulated as a suspension in an aqueous, non-aqueous, or mixed medium. The aqueous suspension may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers. In an embodiment, the pharmaceutical formulation or composition of the present disclosure includes but is not limited to solutions, emulsions, microemulsions, foams, or formulations containing liposomes (e.g., cationic or non-cationic liposomes).

[0472] The pharmaceutical compositions or formulations described herein may contain one or more penetration enhancers, carriers, excipients, or other active or inactive ingredients that are suitable and known to those skilled in the art or described in the published literature. In an embodiment, the liposomes also include sterically stabilized liposomes, such as liposomes containing one or more specialized lipids. These specialized lipids result in liposomes having an increased circulation lifetime. In an embodiment, the sterically stabilized liposomes contain one or more glycolipids or are derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. In some embodiments, surfactants are included in the pharmaceutical formulation or composition. The use of surfactants in pharmaceutical products, formulations, and emulsions is well known in the art. In an embodiment, the present disclosure employs penetration enhancers to achieve effective delivery of antisense oligonucleotides, for example, to assist in diffusion across cell membranes and / or enhance the permeability of lipophilic drugs. In some embodiments, the penetration enhancer is a surfactant, fatty acid, bile salt, chelating agent, or non-chelating non-surfactant.

[0473] In some embodiments, the pharmaceutical formulation contains multiple agents (e.g., antisense oligomers). In an embodiment, the agent (e.g., antisense oligomer) or the vector encoding the agent is administered in combination with another drug or therapeutic agent.

[0474] A pharmaceutical composition containing an antisense oligomer may encompass any pharmaceutically acceptable salt, ester, or salt of such an ester, or any other oligonucleotide that is capable of (directly or indirectly) providing a bioactive metabolite or its residue when administered to an animal (including a human). Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of antisense oligomers. Suitable pharmaceutically acceptable salts include but are not limited to sodium salts and potassium salts.

[0475] The prodrug may include the incorporation of additional nucleosides at one or both ends of the antisense oligomer, which are cleaved by endogenous nucleases in the body to form the active antisense oligomer.

[0476] The antisense oligomers disclosed herein can be covalently linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the resulting antisense oligomers. Conjugate groups can include cholesterol moieties and lipid moieties. Additional conjugate groups can include carbohydrates, phospholipids, biotin, phenazines, folic acid, phenanthridines, anthraquinones, acridines, fluoresceins, rhodamines, coumarins, and dyes.

[0477] The antisense oligomers of the present disclosure can also be modified to have one or more stabilizing groups, which are typically attached to one or both ends of the antisense oligomer to enhance properties such as, for example, nuclease stability. Cap structures are included among the stabilizing groups. These terminal modifications can protect antisense oligomers with terminal nucleic acids from exonuclease degradation and can assist with delivery and / or localization within cells. The cap can be present at the 5'-end (5'-cap), or at the 3'-end (3'-cap), or can be present at both ends. Cap structures can include, for example, inverted deoxyabasic caps. Other 3' and 5'-stabilizing groups that can be used to cap one or both ends of an antisense oligomer to confer nuclease stability can include those disclosed in WO 03 / 004602 published on January 16, 2003.

[0478] Any of the compositions provided herein can be administered to an individual. "Individual" can be used interchangeably with "subject" or "patient". An individual can be a mammal, such as a human or an animal, such as a non-human primate, rodent, rabbit, rat, mouse, horse, donkey, goat, cat, dog, cow, pig, or sheep. In an embodiment, the individual is a human. In an embodiment, the individual is a fetus, embryo, or child. In some embodiments, the compositions provided herein are administered to isolated cells.

[0479] In some embodiments, the compositions provided herein are administered to an individual as a method of treating a disease or disorder. In certain embodiments, the individual has a neurological disorder. In some cases, the individual has a disease or disorder associated with an overexpression level or activity level of the UBE3A protein. In some cases, the diseases or disorders for which the compositions provided herein are applicable are related to the duplication, overexpression, or gain-of-function mutation of the UBE3A gene, for example, duplication of chromosome 15q11.2-q13.1, Dup15q syndrome.

[0480] Dup15q syndrome is one of the most common genetic variants associated with autism spectrum disorder (ASD), and is associated with duplications of chromosome 15q11.2-q13.1. This chromosomal region includes the imprinted Prader-Willi / Angelman syndrome critical region (PWACR), ubiquitin protein ligase E3A (UBE3A), small nuclear ribonucleoprotein polypeptide N (SNRPN), and three GABAA receptor genes (GABRB3, GABRA5, and GABRG3). Dup15q syndrome can include two major types of 15q11.2-13.1 duplications: (1) isodicentric chromosome 15 (idic(15)), resulting in two additional maternally-derived copies on an extra chromosome in the proximal region including 15p and 15q11, most commonly producing four copies of the region, or (2) interstitial 15q duplication, in which an additional copy of the 15q11.2-q13.1 region appears on the same chromosome arm, typically producing three copies of the region and generally having a milder phenotype. Duplications of 15q11.2-q13.1 confer a significant risk of autism spectrum disorder, epilepsy, and intellectual disability to patients. Studies have shown that patients with Dup15q syndrome exhibit a variety of symptoms, including certain behavioral characteristics such as relatively weak motor skills, facial expressions, social smiling, and reciprocal social interactions. Patients with Dup15q syndrome may also exhibit unique electroencephalogram (EEG) characteristics in the form of high-amplitude spontaneous beta frequency (12-30 Hz) oscillations.

[0481] In certain embodiments, provided herein are methods for prophylactically or therapeutically reducing UBE3A expression in an individual. Certain embodiments include treating an individual by administering to the individual in need thereof a therapeutically effective amount of an agent (e.g., an antisense oligomer) or a vector encoding the agent that targets UBE3A nucleic acid.

[0482] In some embodiments, an individual has a genetic disease, such as any of the diseases described herein. In some embodiments, an individual is at risk of having a disease (such as any of the diseases described herein). In some embodiments, an individual is at increased risk of having a disease or disorder caused by insufficient protein amount or protein activity. If an individual is "at increased risk of having a disease or disorder caused by insufficient protein amount or protein activity", then the method involves prophylactic or therapeutic treatment. For example, an individual may be at increased risk of having such a disease or disorder due to a family history of the disease. Generally, individuals at increased risk of having such a disease or disorder benefit from therapeutic treatment (e.g., by preventing or delaying the onset or progression of the disease or disorder). In an embodiment, a fetus is treated in utero, for example, by administering the agent (e.g., an antisense oligomer) or a vector encoding the agent directly or indirectly (e.g., via the mother) to the fetus.

[0483] In one embodiment, administering a therapeutically effective amount of an antisense oligomer targeting UBE3A nucleic acid is accompanied by monitoring the UBE3A level in the individual to determine the individual's response to the administration of the antisense oligomer. A physician can determine the amount and duration of the therapeutic intervention based on the individual's response to the administration of the antisense oligomer.

[0484] In certain embodiments, administering an antisense oligomer targeting UBE3A nucleic acid results in a reduction in the processed mRNA encoding the UBE3A protein (e.g., UBE3A mRNA) and / or protein expression of at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range defined by any two of these values.

[0485] In some embodiments, the level of processed mRNA encoding the UBE3A protein (e.g., UBE3A mRNA) in cells that have been contacted with an agent or vehicle is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to otherwise identical cells that have not been contacted with the agent or vehicle.

[0486] In some embodiments, the level of processed mRNA encoding the UBE3A protein (e.g., UBE3A mRNA) in cells that have been contacted with an agent or vehicle is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to otherwise identical cells that have not been contacted with the agent or vehicle.

[0487] In some cases, the methods and compositions provided herein reduce the level of UBE3A protein in cells. In some embodiments, the level of UBE3A protein in cells contacted with an agent or vehicle is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to otherwise identical cells not contacted with the agent or vehicle. In some cases, the level of UBE3A protein in cells contacted with an agent or vehicle is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to otherwise identical cells not contacted with the agent or vehicle.

[0488] In certain embodiments, administration of an antisense oligomer targeting UBE3A nucleic acid results in improved cognitive function in an animal. In certain embodiments, administration of the UBE3A antisense oligomer improves cognitive function by at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range defined by any two of these values.

[0489] In certain embodiments, administration of an antisense oligomer targeting UBE3A nucleic acid results in improved motor function in an animal. In certain embodiments, administration of the UBE3A antisense oligomer improves cognitive function by at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range defined by any two of these values.

[0490] In certain embodiments, administration of an antisense oligomer targeting UBE3A nucleic acid results in improved anxiety in an animal. In certain embodiments, administration of a UBE3A antisense oligomer improves anxiety by at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range defined by any two of these values. In certain embodiments, administration of an antisense oligomer targeting UBE3A nucleic acid results in improved social interaction in an animal. In certain embodiments, administration of a UBE3A antisense oligomer improves social interaction by at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range defined by any two of these values. In certain embodiments, administration of an antisense oligomer targeting UBE3A nucleic acid results in reduced seizures. In certain embodiments, administration of a UBE3A antisense oligomer reduces seizures by at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%, or a range defined by any two of these values. In certain embodiments, administration of an antisense oligomer targeting UBE3A nucleic acid results in normalized EEG discharges.

[0491] In certain embodiments, a pharmaceutical composition comprising an antisense oligomer targeting UBE3A is used to prepare a medicament for treating a patient suffering from or predisposed to a disorder including Dup15q syndrome.

[0492] The suitable route for administering an agent (e.g., an antisense oligomer) of the present disclosure or a vector encoding the agent may vary depending on the cell type to which the agent or the vector needs to be delivered. The agent of the present invention or a vector encoding the agent can be administered parenterally to a patient, such as by intrathecal injection, intraventricular injection, cisterna magna injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, or intravenous injection.

[0493] In an embodiment, the antisense oligomer is administered together with one or more agents capable of facilitating the penetration of the subject antisense oligomer across the blood-brain barrier by any method known in the art. For example, the delivery of an agent by administering an adenoviral vector to motor neurons in muscle tissue is described in U.S. Patent No. 6,632,427, which is incorporated herein by reference. The direct delivery of a vector to the brain, such as the striatum, thalamus, hippocampus, or substantia nigra, is described in, for example, U.S. Patent No. 6,756,523, which is incorporated herein by reference.

[0494] In some embodiments, the antisense oligomer is linked or conjugated to an agent having the desired pharmaceutical or pharmacodynamic properties provided. In an embodiment, the antisense oligomer is conjugated to a substance known in the art to facilitate penetration or transport across the blood-brain barrier, such as an antibody to the transferrin receptor. In an embodiment, the antisense oligonucleotide is linked to a viral vector, such as to make the antisense oligomer more effective or to increase transport across the blood-brain barrier. In an embodiment, osmotic blood-brain barrier disruption is assisted by infusing a sugar, such as erythritol, xylitol, D(+) galactose, D(+) lactose, D(+) xylose, galactitol, inositol, L(-) fructose, D(-) mannitol, D(+) glucose, D(+) arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) raffinose, L(+) rhamnose, D(+) melibiose, D(-) ribose, adonitol, D(+) arabitol, L(-) arabitol, D(+) fucose, L(-) fucose, D(-) lyxose, L(+) lyxose, and L(-) lyxose, or an amino acid, such as glutamine, lysine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glycine, histidine, leucine, methionine, phenylalanine, proline, serine, threonine, tyrosine, valine, and taurine. Methods and materials for enhancing blood-brain barrier penetration are described in, for example, U.S. Patent Nos. 9,193,969, 4,866,042, 6,294,520, and 6,936,589, each of which is incorporated herein by reference.

[0495] In some embodiments, the improvement of the condition of a subject treated with the methods and compositions is evaluated using any method known and described in the art.

[0496] The effects of the agents provided herein (e.g., antisense oligomers) on the levels, activity, or expression of UBE3A nucleic acid or UBE3A protein can be tested in vitro in a variety of cell types. Exemplary cell types include, but are not limited to, Hela cells, HS02 cells, 293T cells, HepG2 cells, Hep3B cells, and primary hepatocytes.

[0497] In some aspects, provided herein are methods of treating cells with an agent (e.g., an antisense oligomer). When the cells reach about 60%-80% confluence in culture, the cells can be treated with an agent (e.g., an antisense oligomer) or a vector encoding the agent.

[0498] For example, antisense oligomers can be introduced into cultured cells with the aid of the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). The antisense oligomers can be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of the antisense oligomers and a LIPOFECTIN concentration of 2 μg / mL to 12 μg / mL per 100 nM antisense oligonucleotide. Antisense oligomers can also be introduced into cultured cells with the aid of LIPOFECTAMINE (Invitrogen, Carlsbad, CA). The antisense oligomers can be mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of the antisense oligonucleotide and a LIPOFECTAMINE concentration of 2 μg / mL to 12 μg / mL per 100 nM antisense oligonucleotide. Another agent that can be used to introduce antisense oligomers into cultured cells is TURBOFECT (Thermo Scientific, Carlsbad, CA).

[0499] In some cases, antisense oligomers are introduced into cultured cells via electroporation.

[0500] Antisense inhibition of UBE3A nucleic acid can be evaluated by measuring the level of UBE3A protein or the level of UBE3A mRNA transcript. The level of UBE3A mRNA transcript can be measured by conventional techniques in the art, such as real-time PCR. The protein level of UBE3A can be evaluated or quantified in a variety of ways well known in the art (such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assay, protein activity assay (e.g., caspase activity assay), immunohistochemistry, immunocytochemistry, or fluorescence-activated cell sorting (FACS)). Antibodies against the target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody production methods well known in the art.

[0501] In vivo testing of antisense oligomers

[0502] Antisense oligomers, such as antisense oligonucleotides, are tested in animals to evaluate their ability to inhibit the expression of UBE3A and produce phenotypic changes (such as improved behavior, motor function, and cognition). In certain embodiments, motor function is measured by the walking initiation assay, rotarod, grip strength, pole climbing, open field performance, balance beam, and hind paw footprint test of the animal. In certain embodiments, behavior is measured by the elevated plus maze and three-chamber social interaction. The test can be performed in normal animals or experimental models. After treatment with antisense oligonucleotides for a period of time, RNA can be isolated from CNS tissue or CSF, and changes in UBE3A nucleic acid expression can be measured.

[0503] Exemplary embodiments

[0504] [1] A method for reducing the expression of UBE3A protein in mammalian cells, the mammalian cells having a duplication, overexpression, or gain-of-function mutation of the UBE3A gene encoding the UBE3A protein, the method comprising contacting an agent or a vector encoding the agent with the mammalian cells, wherein the agent reduces the level of processed mRNA encoding the UBE3A protein in the mammalian cells.

[0505] [2] The method according to paragraph [1], wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the sequence shown in any one of SEQ ID NOs: 93 - 120.

[0506] [3] The method according to paragraph [1], wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of each mRNA transcript listed in Table 2.

[0507] [4] The method according to any one of paragraphs [1] to [3], wherein the agent comprises an antisense oligomer.

[0508] [5] The method according to paragraph [4], wherein the agent comprises an antisense oligomer having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0509] [6] A method of modulating the expression of the UBE3A gene encoding the UBE3A protein in mammalian cells, the method comprising contacting an agent or a vector encoding the agent with the mammalian cells, wherein the agent comprises a polynucleotide sequence comprising an antisense oligomer having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0510] [7] The method according to any one of paragraphs [4] to [6], wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety, or a combination thereof.

[0511] [8] The method according to any one of paragraphs [4] to [7], wherein the antisense oligomer comprises phosphorothioate linkages or phosphorodiamidate linkages.

[0512] [9] The method according to any one of paragraphs [4] to [8], wherein the antisense oligomer comprises phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl moiety, 2'-fluoro moiety, 2'-O-methoxyethyl moiety, or 2'-NMA moiety.

[0513]

[10] The method according to any one of paragraphs [4] to [9], wherein the antisense oligomer comprises at least one modified sugar moiety.

[0514]

[11] The method according to any one of paragraphs [4] to

[10] , wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

[0515]

[12] The method according to any one of paragraphs [4] to

[10] , wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

[0516]

[13] The method according to any one of paragraphs [4] to

[10] , wherein the antisense oligomer comprises one, two, three, four, five, or six 2'-O-methoxyethyl modified nucleosides at the 5' end of the antisense oligomer.

[0517]

[14] The method according to any one of paragraphs [4] to

[13] , wherein the antisense oligomer comprises at least one, two, three, four, five or six modified nucleosides at the 3'-end of the antisense oligomer.

[0518]

[15] The method according to any one of paragraphs [4] to

[13] , wherein the antisense oligomer comprises one, two, three, four, five or six modified nucleosides at the 3'-end of the antisense oligomer.

[0519]

[16] The method according to any one of paragraphs [4] to

[13] , wherein the antisense oligomer comprises one, two, three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer.

[0520]

[17] The method according to any one of paragraphs [4] to

[16] , wherein the antisense oligomer comprises three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 5'-end of the antisense oligomer; three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer; and phosphorothioate linkages between any two adjacent nucleosides of the antisense oligomer.

[0521]

[18] The method according to any one of paragraphs [4] to

[16] , wherein the antisense oligomer comprises:

[0522] a 5'-region consisting of three, four, five or six linked nucleosides;

[0523] a central region consisting of eight, nine, ten, eleven or twelve linked nucleosides; and

[0524] a 3'-region consisting of three, four, five or six linked nucleosides;

[0525] wherein each of the three, four, five or six linked nucleosides in the 5'-region and each of the three, four, five or six linked nucleosides in the 3'-region comprises a modified sugar moiety, and wherein each of the eight, nine, ten, eleven or twelve linked nucleosides in the central region is a deoxyribonucleoside.

[0526]

[19] A method according to any one of paragraphs [4] to

[18] , wherein the antisense oligomer consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases or 18 to 20 nucleobases.

[0527]

[20] A method according to any one of paragraphs [4] to

[16] , wherein the antisense oligomer is a modified oligonucleotide comprising a sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

[0528]

[21] A method according to any one of paragraphs [4] to

[16] , wherein the antisense oligomer is a modified oligonucleotide consisting of a sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

[0529]

[22] A method according to any one of paragraphs [1] to [6], wherein the vector comprises a viral vector encoding the agent.

[0530]

[23] A method according to paragraph

[22] , wherein the viral vector comprises an adenovirus vector, an adeno - associated virus (AAV) vector, a lentivirus vector, a herpes simplex virus (HSV) vector or a retrovirus vector.

[0531]

[24] A method according to any one of paragraphs [4] to

[23] , wherein the antisense oligomer comprises a sequence having at least 90% identity with a sequence shown in any one of SEQ ID NOs: 1 - 92.

[0532]

[25] A method according to any one of paragraphs [4] to

[23] , wherein the antisense oligomer comprises a sequence having 100% identity with a sequence shown in any one of SEQ ID NOs: 1 - 92.

[0533]

[26] A method according to any one of paragraphs [4] to

[23] , wherein the antisense oligomer consists of a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0534]

[27] A method according to any one of paragraphs [4] to

[23] , wherein the antisense oligomer consists of a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0535]

[28] A method according to any one of paragraphs [4] to

[23] , wherein the antisense oligomer consists of a sequence having 100% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0536]

[29] A method according to any one of paragraphs [6] to

[28] , wherein the method reduces the level of the processed mRNA encoding the UBE3A protein in the mammalian cell.

[0537]

[30] A method according to any one of paragraphs [1] to [5] or [7] to

[29] , wherein the level of the processed mRNA encoding the UBE3A protein in the mammalian cell contacted with the agent or the vector is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same cells that were not contacted with the agent or the vector.

[0538]

[31] The method according to any one of paragraphs [1] to [5] or [7] to

[29] , wherein the level of the processed mRNA encoding the UBE3A protein in the mammalian cells contacted with the agent or the carrier is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same mammalian cells that have not been contacted with the agent or the carrier.

[0539]

[32] The method according to any one of paragraphs [1] to

[31] , wherein the method reduces the level of the UBE3A protein in the mammalian cells.

[0540]

[33] The method according to paragraph

[32] , wherein the level of the UBE3A protein in the mammalian cells contacted with the agent or the carrier is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same cells that have not been contacted with the agent or the carrier.

[0541]

[34] The method according to paragraph

[32] , wherein the level of the UBE3A protein in the mammalian cells contacted with the agent or the carrier is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same cells that have not been contacted with the agent or the carrier.

[0542]

[35] The method according to any one of paragraphs [1] to

[34] , wherein the method comprises contacting the agent or the carrier with a population of mammalian cells.

[0543]

[36] The method according to paragraph

[35] , wherein the agent reduces the level of the processed mRNA encoding the UBE3A protein in the population of mammalian cells by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

[0544]

[37] The method according to paragraph

[35] or

[36] , wherein the agent reduces the level of the UBE3A protein in the population of mammalian cells by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of cells that have not been contacted with the agent or the carrier.

[0545]

[38] The method according to any one of paragraphs [1] to

[37] , wherein the mammalian cells are ex vivo.

[0546]

[39] The method according to any one of paragraphs [1] to

[37] , wherein the mammalian cells are in vivo.

[0547]

[40] The method according to any one of paragraphs [1] to

[39] , wherein the genome of the mammalian cells has a duplication of the genomic region encompassing the UBE3A gene encoding the UBE3A protein.

[0548]

[41] The method according to any one of paragraphs [1] to

[39] , wherein the mammalian cells are human cells, and wherein the genome of the mammalian cells has a duplication of chromosome 15q11.2-q13.1.

[0549]

[42] The method according to any one of paragraphs [1] to

[38] , wherein the mammalian cell is obtained from a human subject suffering from Dup15q syndrome or is a descendant of a sample cell obtained from the human subject.

[0550]

[43] An antisense oligomer comprising a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0551]

[44] The antisense oligomer according to paragraph

[43] , wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety, or a combination thereof.

[0552]

[45] The antisense oligomer according to paragraph

[43] or

[44] , wherein the antisense oligomer comprises phosphorothioate linkages or phosphorodiamidate linkages.

[0553]

[46] The antisense oligomer according to any one of paragraphs

[43] to

[45] , wherein the antisense oligomer comprises phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl moiety, 2'-fluoro moiety, 2'-O-methoxyethyl moiety, or 2'-NMA moiety.

[0554]

[47] The antisense oligomer according to any one of paragraphs

[43] to

[46] , wherein the antisense oligomer comprises at least one modified sugar moiety.

[0555]

[48] The antisense oligomer according to any one of paragraphs

[43] to

[47] , wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

[0556]

[49] The antisense oligomer according to any one of paragraphs

[43] to

[47] , wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

[0557]

[50] The antisense oligomer according to any one of paragraphs

[43] to

[47] , wherein the antisense oligomer comprises one, two, three, four, five, or six 2'-O-methoxyethyl modified nucleosides at the 5' end of the antisense oligomer.

[0558]

[51] The antisense oligomer according to any one of paragraphs

[43] to

[50] , wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at the 3' end of the antisense oligomer.

[0559]

[52] An antisense oligomer according to any one of paragraphs

[43] to

[50] , wherein the antisense oligomer comprises one, two, three, four, five or six modified nucleosides at the 3'-end of the antisense oligomer.

[0560]

[53] An antisense oligomer according to any one of paragraphs

[43] to

[50] , wherein the antisense oligomer comprises one, two, three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer.

[0561]

[54] An antisense oligomer according to any one of paragraphs

[43] to

[53] , wherein the antisense oligomer comprises three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 5'-end of the antisense oligomer; three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer; and phosphorothioate linkages between any two adjacent nucleosides of the antisense oligomer.

[0562]

[55] An antisense oligomer according to any one of paragraphs

[43] to

[53] , wherein the antisense oligomer comprises:

[0563] A 5'-region consisting of three, four, five or six linked nucleosides;

[0564] A central region consisting of eight, nine, ten, eleven or twelve linked nucleosides; and

[0565] A 3'-region consisting of three, four, five or six linked nucleosides;

[0566] wherein each of the three, four, five or six linked nucleosides in the 5'-region and each of the three, four, five or six linked nucleosides in the 3'-region comprises a modified sugar moiety, and wherein each of the eight, nine, ten, eleven or twelve linked nucleosides in the central region is a deoxyribonucleoside.

[0567]

[56] An antisense oligomer according to any one of paragraphs

[43] to

[55] , wherein the antisense oligomer consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases or 18 to 20 nucleobases.

[0568]

[57] An antisense oligomer according to any one of paragraphs

[43] to

[56] , wherein the antisense oligomer comprises a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0569]

[58] An antisense oligomer according to any one of paragraphs

[43] to

[56] , wherein the antisense oligomer comprises a sequence having 100% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0570]

[59] An antisense oligomer according to any one of paragraphs

[43] to

[56] , wherein the antisense oligomer consists of a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0571]

[60] An antisense oligomer according to any one of paragraphs

[43] to

[56] , wherein the antisense oligomer consists of a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0572]

[61] An antisense oligomer according to any one of paragraphs

[43] to

[56] , wherein the antisense oligomer consists of a sequence having 100% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

[0573]

[62] An antisense oligomer according to any one of paragraphs

[43] to

[56] , wherein the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

[0574]

[63] An antisense oligomer according to any one of paragraphs

[43] to

[56] , wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

[0575]

[64] An antisense oligomer according to any one of paragraphs

[43] to

[63] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA transcript encoding the UBE3A protein in the population after contact with a mammalian cell population.

[0576]

[65] The antisense oligomer according to paragraph

[64] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to an otherwise identical mammalian cell population not contacted with the antisense oligomer.

[0577]

[66] An antisense oligomer according to paragraph

[64] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0578]

[67] An antisense oligomer according to any one of paragraphs

[64] to

[66] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0579]

[68] An antisense oligomer according to any one of paragraphs

[64] to

[67] , wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population of mammalian cells.

[0580]

[69] An antisense oligomer according to paragraph

[68] , wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0581]

[70] An antisense oligomer according to paragraph

[68] , wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0582]

[71] An antisense oligomer according to any one of paragraphs

[64] to

[70] , wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0583]

[72] An antisense oligomer according to any one of paragraphs

[64] to

[71] , wherein the mammalian cell is ex vivo.

[0584]

[73] An antisense oligomer according to any one of paragraphs

[64] to

[71] , wherein the mammalian cell is in vivo.

[0585]

[74] An antisense oligomer according to any one of paragraphs

[64] to

[73] , wherein the genome of the mammalian cell has a duplication of a genomic region encompassing the UBE3A gene encoding the UBE3A protein.

[0586]

[75] An antisense oligomer according to any one of paragraphs

[64] to

[74] , wherein the mammalian cell is a human cell.

[0587]

[76] An antisense oligomer according to paragraph

[75] , wherein the genome of the mammalian cell has a duplication of chromosome 15q11.2-q13.1.

[0588]

[77] An antisense oligomer according to any one of paragraphs

[64] to

[76] , wherein the mammalian cell is obtained from a human subject suffering from Dup15q syndrome or is a descendant of a sample cell obtained from the human subject.

[0589]

[78] A pharmaceutical composition comprising:

[0590] (a) a pharmaceutically acceptable excipient or carrier; and

[0591] (b) an antisense oligomer according to any one of paragraphs

[43] to

[77] .

[0592]

[79] A pharmaceutical composition comprising:

[0593] (a) a pharmaceutically acceptable excipient or carrier; and

[0594] (b) an agent or a vector encoding the agent, wherein the agent is configured to reduce the level of a processed mRNA transcript encoding the UBE3A protein in the mammalian cell upon contact with the mammalian cell.

[0595]

[80] The pharmaceutical composition according to paragraph

[79] , wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the sequence shown in any one of SEQ ID NOs: 93 - 120.

[0596]

[81] The pharmaceutical composition according to paragraph

[79] , wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of each mRNA transcript listed in Table 2.

[0597]

[82] The pharmaceutical composition according to any one of paragraphs

[79] to

[81] , wherein the agent comprises an antisense oligomer.

[0598]

[83] The pharmaceutical composition according to paragraph

[82] , wherein the antisense oligomer has at least 80% identity with the sequence shown in any one of SEQ ID NO: 1-92.

[0599]

[84] The pharmaceutical composition according to any one of paragraphs

[79] to

[83] , which comprises the carrier, and wherein the carrier comprises a viral vector encoding the agent.

[0600]

[85] The pharmaceutical composition according to paragraph

[84] , wherein the viral vector comprises an adenovirus vector, an adeno-associated virus (AAV) vector, a lentivirus vector, a herpes simplex virus (HSV) vector or a retrovirus vector.

[0601]

[86] The pharmaceutical composition according to any one of paragraphs

[82] to

[85] , wherein the antisense oligomer comprises a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NO: 1-92.

[0602]

[87] The pharmaceutical composition according to any one of paragraphs

[82] to

[85] , wherein the antisense oligomer comprises a sequence having 100% identity with the sequence shown in any one of SEQ ID NO: 1-92.

[0603]

[88] The pharmaceutical composition according to any one of paragraphs

[82] to

[85] , wherein the antisense oligomer consists of a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NO: 1-92.

[0604]

[89] The pharmaceutical composition according to any one of paragraphs

[82] to

[85] , wherein the antisense oligomer consists of a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NO: 1-92.

[0605]

[90] The pharmaceutical composition according to any one of paragraphs

[82] to

[85] , wherein the antisense oligomer consists of a sequence having 100% identity with the sequence shown in any one of SEQ ID NO: 1-92.

[0606]

[91] The pharmaceutical composition according to paragraph

[82] , wherein the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

[0607]

[92] The pharmaceutical composition according to paragraph

[82] , wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

[0608]

[93] The pharmaceutical composition according to any one of paragraphs

[79] to

[92] , wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population after contact with a mammalian cell population.

[0609]

[94] The pharmaceutical composition according to paragraph

[93] , wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same mammalian cell population that has not been contacted with the agent or the carrier.

[0610]

[95] The pharmaceutical composition according to paragraph

[93] , wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

[0611]

[96] The pharmaceutical composition according to any one of paragraphs

[93] to

[95] , wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0612]

[97] The pharmaceutical composition according to any one of paragraphs

[93] to

[96] , wherein the agent is configured to reduce the level of the UBE3A protein in the population.

[0613]

[98] The pharmaceutical composition according to paragraph

[97] , wherein the agent is configured to reduce the level of the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

[0614]

[99] The pharmaceutical composition according to paragraph

[97] , wherein the agent is configured to reduce the level of the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

[0615]

[100] The pharmaceutical composition according to any one of paragraphs

[97] to

[99] , wherein the agent is configured to reduce the level of the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

[0616]

[101] The pharmaceutical composition according to any one of paragraphs

[79] to

[100] , wherein the mammalian cells are ex vivo.

[0617]

[102] The pharmaceutical composition according to any one of paragraphs

[79] to

[100] , wherein the mammalian cells are in vivo.

[0618]

[103] The pharmaceutical composition according to any one of paragraphs

[79] to

[102] , wherein the genome of the mammalian cells has a duplication of the genomic region encompassing the UBE3A gene encoding the UBE3A protein.

[0619]

[104] The pharmaceutical composition according to any one of paragraphs

[79] to

[103] , wherein the mammalian cells are human cells.

[0620]

[105] The pharmaceutical composition according to paragraph

[104] , wherein the genome of the mammalian cells has a duplication of chromosome 15q11.2-q13.1.

[0621]

[106] The pharmaceutical composition according to any one of paragraphs

[79] to

[99] , wherein the mammalian cells are obtained from a human subject suffering from Dup15q syndrome or are descendants of sample cells obtained from the human subject.

[0622]

[107] The pharmaceutical composition according to any one of paragraphs

[78] to

[106] , wherein the pharmaceutical composition is formulated for intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, cisterna magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal injection, subretinal injection, topical application, implantation or intravenous injection.

[0623]

[108] The pharmaceutical composition according to any one of paragraphs

[78] to

[106] , wherein the pharmaceutical composition is formulated for intrathecal injection.

[0624]

[109] The pharmaceutical composition according to any one of paragraphs

[78] to

[108] , wherein the pharmaceutically acceptable excipient or carrier includes artificial cerebrospinal fluid.

[0625]

[110] The pharmaceutical composition according to any one of paragraphs

[78] to

[109] , wherein the pharmaceutical composition further comprises a second therapeutic agent.

[0626]

[111] The pharmaceutical composition according to paragraph

[110] , wherein the second therapeutic agent comprises a small molecule, an antisense oligomer or a gene editing molecule.

[0627]

[112] A method of treating a disease or condition in a subject in need thereof or reducing the likelihood of the subject developing the disease or condition by reducing the expression of UBE3A protein in the cells of the subject, the method comprising contacting the cells of the subject with the pharmaceutical composition according to any one of paragraphs

[78] to

[111] .

[0628]

[113] The method according to paragraph

[112] , wherein the disease or condition is associated with overexpression of the UBE3A gene encoding the UBE3A protein or a gain-of-function mutation.

[0629]

[114] The method according to paragraph

[112] or

[113] , wherein the genome of the cells of the subject has at least one extra copy of the UBE3A gene encoding the UBE3A protein.

[0630]

[115] The method according to paragraph

[112] or

[114] , wherein the genome of the cells of the subject has a duplication of the genomic region encompassing the UBE3A gene encoding the UBE3A protein.

[0631]

[116] The method according to paragraph

[112] or

[115] , wherein the genome of the cells of the subject has a duplication of chromosome 15q11.2-q13.1.

[0632]

[117] The method according to any one of paragraphs

[112] to

[116] , wherein the disease or condition includes Dup15q syndrome, autism spectrum disorder, epilepsy or intellectual disability.

[0633]

[118] The method according to any one of paragraphs

[112] to

[117] , wherein the subject is a human.

[0634]

[119] The method according to any one of paragraphs

[112] to

[118] , wherein the subject is a fetus, embryo or child.

[0635]

[120] The method according to any one of paragraphs

[112] to

[119] , wherein the cells are ex vivo.

[0636]

[121] The method according to any one of paragraphs

[112] to

[119] , which comprises administering the pharmaceutical composition to the subject by: intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, cisterna magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal injection, subretinal injection, topical application, implantation or intravenous injection.

[0637]

[122] The method according to any one of paragraphs

[112] to

[119] , which comprises administering the pharmaceutical composition to the subject by intrathecal injection.

[0638]

[123] The method according to any one of paragraphs

[112] to

[122] , wherein the method treats the disease or condition.

[0639] Examples

[0640] The present disclosure will be illustrated more specifically by the following examples. However, it should be understood that the present disclosure is not limited in any way by these examples.

[0641] Example 1: Knockdown of the UBE3A gene in human cells.

[0642] In an experiment, the effect of compound molecules according to some embodiments of the present disclosure on human UBE3A mRNA transcripts was examined. The compound molecules were modified oligonucleotides listed in Table 3. Among the compound molecules examined, there were 22 test oligonucleotides according to some embodiments of the present disclosure, a no-template control (NTC) serving as a negative control ("N control"), and a positive control oligonucleotide ("P control") whose effect of knockdown on the UBE3A gene was known. As shown in the table, " / 52MOErX / " represents a 2-O-methoxyethyl-modified ribonucleoside X at the 5' end of the oligonucleotide, where X is A, T, G, or methylated cytosine (MeC); " / i2MOErX / " represents an internal 2-O-methoxyethyl-modified ribonucleoside X, where X is A, T, G, or MeC; " / 32MOErX / " represents a 2-O-methoxyethyl-modified ribonucleoside X at the 3' end of the oligonucleotide, where X is A, T, G, or MeC; the other nucleosides A, T, G, and C are deoxyribonucleosides; and "*" represents a phosphorothioate linkage between two adjacent nucleosides.

[0643] Table 3. List of compound molecules

[0644]

[0645]

[0646]

[0647]

[0648] Table 4. List of compound molecules

[0649]

[0650]

[0651]

[0652]

[0653]

[0654]

[0655] The experiment was conducted using HS02 (primary human fibroblasts) in 96-well plates. 8000 cells / well were seeded into the 96-well plates. 24 UBE3A-targeting ASOs (22 exemplary ASOs + 2 controls) were tested in an 8-point concentration-response curve (CRC) format. For example, 8 different concentrations of each ASO were tested, and the responses to the ASO treatments at different concentrations were measured and plotted. The two control ASOs included a positive control for evaluating the successful delivery of the ASO at 100 nM (“P control”) and a negative control, which was an ASO at 100 nM targeting a different gene, TUG1 (“N control”). For each cell plate, wells that received only the transfection reagent (“TF only”) were also reserved as another negative control for quality control (QC). All ASOs were delivered by transfection with lipofectamine 2000 (0.2 μl / well). The 22 exemplary ASOs were added to the cell culture medium at concentrations of 100 nM, 31.62 nM, 10 nM, 3.16 nM, 1.0 nM, 0.32 nM, 0.10 nM, or 0.032 nM.

[0656] In the same experiment, each ASO source plate was tested on replicate cell plates; the lysates of each cell well tested in duplicate were measured on the same qPCR plate.

[0657] Each cell well was treated with the respective ASO for 24 hours, followed by nuclear counting and potency measurement. To count the number of nuclei of the cells treated with the ASO, Hoechst 33342 (50 μg / mL, nuclear stain) at 20 μl / well was added for 30 minutes. After staining, the cells were imaged in real time using an IN Cell Analyzer 2200 (GE Healthcare) with a 10x objective lens, 4 fields of view per well were captured, and the captured images were automatically analyzed using Columbus software (PerkinElmer).

[0658] After imaging, cells were lysed using the lysis solution containing DNAse I (25 μl / well) and the stop solution (2.5 μl / well) from the TaqMan One-Step Cells-to-Ct Kit. The cell lysates were then subjected to qPCR testing: 15% of the cell lysate from each well was added to the TaqMan Master Mix in the TaqMan One-Step Cells-to-Ct Kit for qPCR reaction.

[0659] For the TaqMan assay, the Hs UBE3A assay 3 (FAM) was multiplexed with the Hs HPRT1 (VIC). After completion of the TaqMan qPCT assay, the 2 –ΔΔCt method was used to calculate the amount of UBE3A transcript, which was normalized to the measurement of the internal reference HPRT1, and then the change in gene expression compared to the control condition (100% expression) was determined.

[0660] Cell loss was below 0% only under the lipofectamine condition (TF only, orange), indicating some toxicity under the conditions of ASO transfection. To account for those differences, the data were normalized to the TUG1 ASO negative CTRL per plate. Cell loss for all tested ASOs was below 20% except for 4 wells, indicating low overall toxicity.

[0661] Figures 1A to 1D The CRC of each tested ASO (including 22 exemplary ASOs), as well as the potency (percentage of knockdown of UBE3A mRNA transcript) of the P control and N control, are shown.

[0662] Table 5 summarizes the average percentage of UBE3A knockdown and their respective EC50 for each of the tested ASOs (including P control and N control). Nonlinear regression (4-parameter) analysis was used to calculate the EC50 (half-maximal effective concentration). There were many ASOs (eight) for which the EC50 value could not be calculated because their CRC did not produce an S curve. They were marked as n.d. (not determined) in the table.

[0663] Table 5. Potency and EC50 of Tested ASOs

[0664]

[0665]

[0666] Sequence Listing

[0667] SEQ ID NO:1

[0668] CGCTTCATTCGGCTAGCTTC

[0669] SEQ ID NO:2

[0670] ATTCGGCTAGCTTCAATGTC

[0671] SEQ ID NO: 3

[0672] TCGCTTCATTCGGCTAGCTT

[0673] SEQ ID NO: 4

[0674] GCTTCATTCGGCTAGCTTCA

[0675] SEQ ID NO: 5

[0676] TCGGCTAGCTTCAATGT

[0677] SEQ ID NO:6

[0678] CATTCGGCTAGCTTCAATGT

[0679] SEQ ID NO:7

[0680] TCGGCTAGCTTCAATGTC

[0681] SEQ ID NO:8

[0682] CCGGACAAGTGCATCATCTA

[0683] SEQ ID NO:9

[0684] CCGGACAAGTGCATCATCT

[0685] SEQ ID NO:10

[0686] TCACATTCCACGTTAGGTGA

[0687] SEQ ID NO:11

[0688] CTTCTGGTCTGAATAAGTA

[0689] SEQ ID NO:12

[0690] CGGACAAGTGCATCATCTAT

[0691] SEQ ID NO:13

[0692] TGTACATGCGAATTCTATTG

[0693] SEQ ID NO:14

[0694] TCCATAGCGATCATCTCTAG

[0695] SEQ ID NO:15

[0696] TTCCGGCTTCCACATATAAG

[0697] SEQ ID NO:16

[0698] CATTCTCCGAATCTGGTC

[0699] SEQ ID NO:17

[0700] CCTTCCTGTTTTCATTTGTA

[0701] SEQ ID NO:18

[0702] CCTTTCTGTGTCTGGGCCAT

[0703] SEQ ID NO:19

[0704] CTCTTACAGATTTTTAACCT

[0705] SEQ ID NO: 20

[0706] TAGGTAACCTTTCTGTGTCT

[0707] SEQ ID NO: 21

[0708] GTGAACATACCAATATCTGG

[0709] SEQ ID NO:22

[0710] GTATGAGATGTAGGTAACC

[0711] SEQ ID NO:23

[0712] ACAGGTTGTCACACCAGTCT

[0713] SEQ ID NO:24

[0714] AGTATGAGATGTAGGTAACC

[0715] SEQ ID NO:25

[0716] AGCTGTGGCCATTCGGTGAC

[0717] SEQ ID NO:26

[0718] CAAGTATGAGATGTAGGTA

[0719] SEQ ID NO:27

[0720] GATAAGTGGTTTTCGACAAT

[0721] SEQ ID NO:28

[0722] CGGACAAGTGCATCATCTAT

[0723] SEQ ID NO:29

[0724] CCGGACAAGTGCATCATCT

[0725] SEQ ID NO:30

[0726] GTAACACTTTCACGCAAAA

[0727] SEQ ID NO:31

[0728] CATTCTCCGAATCTGGTC

[0729] SEQ ID NO:32

[0730] GGACAAGTGCATCATCTAT

[0731] SEQ ID NO:33

[0732] TCCATAGCGATCATCTCTAG

[0733] SEQ ID NO:34

[0734] AAGCTGTGGCCATTCGGT

[0735] SEQ ID NO:35

[0736] CCTTTCTGTGTCTGGGCCAT

[0737] SEQ ID NO:36

[0738] CCTTCCTGTTTTCATTTGTA

[0739] SEQ ID NO:37

[0740] ACATTCGGCTAGCTTCAATG

[0741] SEQ ID NO:38

[0742] TTCGGCTAGCTTCAATGTC

[0743] SEQ ID NO:39

[0744] TTCGGCTAGCTTCAATGT

[0745] SEQ ID NO:40

[0746] CTTACATTCGGCTAGCTTC

[0747] SEQ ID NO:41

[0748] CTTACATTCGGCTAGCTT

[0749] SEQ ID NO:42

[0750] ATTCGGCTAGCTTCAATGT

[0751] SEQ ID NO:43

[0752] TACCATATTTCGCCAAACT

[0753] SEQ ID NO:44

[0754] ACCTTTCTGTGTCTGGGCCA

[0755] SEQ ID NO:45

[0756] TCACATTCCACGTTAGGTG

[0757] SEQ ID NO:46

[0758] CGTGTCTTTCTGTGTCTGGG

[0759] SEQ ID NO:47

[0760] CTTACATTCGGCTAGCT

[0761] SEQ ID NO:48

[0762] TGTCTTTCTGTGTCTGGGCC

[0763] SEQ ID NO:49

[0764] CTTACCCGGCTTCCACATAT

[0765] SEQ ID NO:50

[0766] TTACATTCGGCTAGCTTCA

[0767] SEQ ID NO:51

[0768] ACATTCGGCTAGCTTCAAT

[0769] SEQ ID NO:52

[0770] TTTGTTGCAATAGGCTTGAC

[0771] SEQ ID NO:53

[0772] CATACCATATTTCGCCAAAC

[0773] SEQ ID NO:54

[0774] CTTACATTCGGCTAGCTTCA

[0775] SEQ ID NO:55

[0776] TCACATTCCACGTTAGGT

[0777] SEQ ID NO:56

[0778] ATACCATATTTCGCCAAACT

[0779] SEQ ID NO:57

[0780] CCGTGTCTTTCTGTGTCTGG

[0781] SEQ ID NO:58

[0782] GTCTTTCTGTGTCTGGGCCA

[0783] SEQ ID NO:59

[0784] AACCTTTCTGTGTCTGGGCC

[0785] SEQ ID NO:60

[0786] GTGTCTTTCTGTGTCTGGGC

[0787] SEQ ID NO:61

[0788] GTAGGTAACCTTTCTGTGTC

[0789] SEQ ID NO:62

[0790] ACATTCCACGTTAGGTGACA

[0791] SEQ ID NO:63

[0792] GTTGCAATAGGCTTGACTA

[0793] SEQ ID NO:64

[0794] CAGGTTGTCACACCAGTCT

[0795] SEQ ID NO:65

[0796] ACCATATTTCGCCAAACTTC

[0797] SEQ ID NO:66

[0798] CTTACCCGGACAAGTGCATC

[0799] SEQ ID NO:67

[0800] TTACCCGGACAAGTGCATC

[0801] SEQ ID NO:68

[0802] GGCCATTCGGTGACATCA

[0803] SEQ ID NO:69

[0804] TGATCTTTTACAAGCTGTGG

[0805] SEQ ID NO:70

[0806] AGCAAGTATGAGATGTAGG

[0807] SEQ ID NO:71

[0808] ACCATATTTCGCCAAACTT

[0809] SEQ ID NO:72

[0810] GGTAACCTTTCTGTGTCTGG

[0811] SEQ ID NO:73

[0812] ACAGGTTGTCACACCAGTC

[0813] SEQ ID NO:74

[0814] GTTGCAATAGGCTTGACT

[0815] SEQ ID NO:75

[0816] TGTGAACATACCAATATCTG

[0817] SEQ ID NO:76

[0818] ACTGTACATGCGAATTCTAT

[0819] SEQ ID NO:77

[0820] TTACCCGGACAAGTGCATCA

[0821] SEQ ID NO:78

[0822] TGTAGGTAACCTTTCTGTGT

[0823] SEQ ID NO:79

[0824] TTTCCCAGAACTCCCTAATC

[0825] SEQ ID NO:80

[0826] CAAGTATGAGATGTAGGT

[0827] SEQ ID NO:81

[0828] AAGCTGTGGCCATTCGGTG

[0829] SEQ ID NO:82

[0830] GGCCATTCGGTGACATCAGG

[0831] SEQ ID NO:83

[0832] TGCAATAGGCTTGACTA

[0833] SEQ ID NO:84

[0834] GGCCATTCGGTGACATCAG

[0835] SEQ ID NO:85

[0836] AGCTGTGGCCATTCGGTGA

[0837] SEQ ID NO:86

[0838] TCATTCTCCGAATCTGGTC

[0839] SEQ ID NO:87

[0840] GTAACACTTTCACGCAAAAA

[0841] SEQ ID NO:88

[0842] AGGTAACCTTTCTGTGTCTG

[0843] SEQ ID NO:89

[0844] TTTGTTGCAATAGGCTTGA

[0845] SEQ ID NO:90

[0846] ATTTCGCCAAACTTCTGAGG

[0847] SEQ ID NO:91

[0848] TCTCAAGGTAAGCTGAGCT

[0849] SEQ ID NO:92

[0850] TTCCCAGAACTCCCTAATCA

[0851] Example 2: In vivo ASO tolerance via intracerebroventricular (ICV) administration of antisense oligonucleotides (ASO).

[0852] This example illustrates an experiment conducted to test the in vivo tolerance of certain exemplary ASOs of the present disclosure in mice.

[0853] The effects of exemplary ASOs were examined via in vivo experiments by intracerebroventricular (ICV) administration to mice. Adult C57BL / 6 mice were surgically implanted with ICV cannulas. After surgical recovery, the mice received ICV injections of ASO or Dulbecco's phosphate buffered saline (DPBS) on day 0. Observations were made before dosing and at 1 hour, 2 hours, 4 hours, 24 hours, and 7 days after dosing. The animals were sacrificed 2 weeks after dosing. Terminal plasma, brain, liver, heart, and kidney tissues were collected and stored.

[0854] Adult male C57Bl / 6 mice were used in this study. After arrival, animals were housed one per polycarbonate cage and acclimated for at least 4 days before the start of the study. Animals were maintained on a 12 / 12 hr light / dark cycle and the room temperature (22 °C ± 2 °C) and humidity (approx. 50%) were kept. Animals had free access to food and water. Experiments were conducted according to a protocol approved by the Institutional Animal Care and Use Committee of Charles River Laboratories South San Francisco.

[0855] Administration formulations were prepared at appropriate concentrations to meet the target dose levels per mouse (e.g., 400 μg / mouse, 500 μg / mouse). All ASOs were formulated in DPBS and stored at -80 °C until the day of administration. Each animal test condition contained six animals and each animal received one intracerebroventricular injection consisting of 5 μl of the test sample according to the groupings shown in Table 6, except for groups 4, 14, and 25, which were removed from the study due to solubility issues. Group 1 was a control condition receiving only DPBS and group 2 was a positive control receiving tominersen, an antisense oligonucleotide therapeutic agent known to reduce the expression levels of huntingtin (HTT) and mutant huntingtin (mHTT). Groups 3 to 26 were experimental conditions using the designated ASOs.

[0856] Table 6. Animal test groups and conditions

[0857]

[0858] Surgical procedures

[0859] ICV cannulation surgery

[0860] Mice were anesthetized with isoflurane (2%, 800 ml / min O2). Bupivacaine was used for local analgesia and carprofen was used for perioperative / postoperative analgesia. Animals were placed in a stereotaxic frame ( Laboratory Instruments, USA). Surgery was performed using aseptic technique. The anterior-posterior (AP), medial-lateral (ML), and dorsal-ventral (DV) axes were zeroed at the bregma. The following coordinates were used for ICV infusion cannulation (PLASTICS Roanoke, Virginia: 0.3 mm AP from the dura mater, 1.0 mm lateral, 2.2 mm DV. Designate the location of the burr hole and drill it. The drill bit is only used to penetrate the bone and lower the infusion cannula into the lateral ventricle. Use two screws and dental acrylic resin to fix the ICV cannula. After surgery, provide the animals with food and water ad libitum. Any animals showing abnormal or adverse signs were not used in the study.

[0861] Pre- and post-operative care

[0862] Carprofen (5 mg / kg SC) was administered before surgery and provided to the animals in the drinking water (0.067 mg / ml) for 3 days after surgery. The animals were carefully monitored on the day of surgery and once daily for an additional 3 days after surgery.

[0863] ICV infusion (Day 0):

[0864] For at least 7 days after surgery, the animals were dosed according to the conditions presented in Table 7. The animals were dosed while conscious. The infusion cannula was placed into the ICV cannula and the test article was infused at a rate of 0.08 μl / sec. The infusion cannula was left in the guide cannula for an additional 30 seconds before removing and replacing the dummy stylet.

[0865] Table 7. ASO dosing protocol and infusion conditions via ICV

[0866]

[0867]

[0868] Behavioral observations

[0869] On the day of dosing, the animals were observed and scored according to Table 8 before dosing, 1 hour, 2 hours, 4 hours, 24 hours, and 1 week after dosing. Detailed clinical observations were recorded, including gait and other hindlimb deficits. Adverse events included ataxia, convulsions, changes in gait or coordination, and weight loss (15% or more).

[0870] Table 8. Behavioral scoring criteria

[0871]

[0872]

[0873] Humanitarian endpoints after dosing

[0874] After dosing, if the animals met the criteria presented in Table 9, the animals were euthanized prior to the scheduled euthanasia time point.

[0875] Table 9. Euthanasia time points after observing animal behavior

[0876] Timing schedule Observed behavior Within 2 hours after administration Convulsion score is 4 24 hours after administration Convulsion score is 2 or higher 24 hours after administration Motor score is 3 or 4 24 hours after administration Activity score is 1

[0877] Terminal sampling

[0878] Scheduled euthanasia and sample collection

[0879] Two weeks after dosing, the animals were deeply anesthetized with isoflurane. Next, blood was collected, and the animals were perfused through the heart with PBS, followed by tissue collection.

[0880] Early euthanasia and sample collection

[0881] In cases where animals needed to be euthanized before the scheduled euthanasia time point, tissues were collected. No tissues were collected from animals found dead (FD).

[0882] Statistical analysis and graphical representation of data

[0883] Data were plotted in Prism 9 for Windows (GraphPad Software, Inc.). Mixed-effects analysis was used to evaluate body weights between different time groups. Tukey's post-hoc test was applied for individual group comparisons. Statistical significance was set at p < 0.05.

[0884] In vivo results

[0885] Three ASOs (Compound_22, Compound_32, and Compound_21) did not go into solution during formulation. Therefore, these three treatment groups were not dosed as planned. The solubility of the other six ASOs (Tomisenan, Compound_23, Compound_25, Compound_26, Compound_12, and Compound_89) was only 80 mg / ml. Therefore, animals in these six treatment groups were dosed with 400 μg ASO per mouse instead of the planned 500 μg ASO per mouse. All other ASO administrations were carried out as planned.

[0886] Table 10 shows the number of animals that reached the early euthanasia criteria (early removal, or eTD) or were found dead (FD) after dosing in each treatment group.

[0887] Table 11 depicts the behavioral observation results at baseline, 1 hour, 2 hours, 4 hours, 24 hours, and 1 week after dosing. The abbreviations for the behavioral scoring criteria are shown in Table 8. Items marked with an asterisk indicate that the animals were found dead after 1 week.

[0888] Table 10. Number of animals dead or requiring early removal in each treatment group

[0889]

[0890] Table 11. Animal behavior scores after treatment

[0891]

[0892]

[0893]

[0894]

[0895]

[0896]

[0897] Example 3: UBE3A knockdown by ASO in F-Dup neurons at the mRNA and protein levels

[0898] The example shows an experiment to test the effect of certain exemplary ASOs of the present disclosure on UBE3A mRNA levels and protein expression levels in neuronal cells derived from human induced pluripotent stem cells (iPSCs), which are obtained from the dedifferentiated cells of a patient with Dup15q (F-Dup neurons).

[0899] After treating the neuronal cells with ten exemplary ASOs of the present disclosure, UBE3A knockdown was evaluated at the mRNA and protein levels. Human induced pluripotent stem cell-derived (hiPSC-derived) F-Dup neurons and corrected neurons (neuronal cells derived from human iPSCs, from a patient with Dup 15q but genetically "corrected" to remove the extra chromosome) were seeded at 150,000 cells / well in a 96-well plate. POS1 and POS2 targeting UBE3A were used as positive controls for qPCR. Scr GFP_ASO, scrP1, and NEAT1 ASO were used as negative controls for F-Dup and corrected untreated cells. scr Pq was only used as a negative control for qPCR.

[0900] The ASOs were performed by gynosis. The control ASO was used at a concentration of 5 μM for qPCR. The test and control ASOs were delivered at concentrations of approximately 6.33 μM and 20 μM. Each ASO plate source was tested in duplicate on the same cell plate, and the lysates of each cell well were tested in technical replicates on the same qPCR plate and also in a technical single test in a separate run.

[0901] hiPSC-derived F-Dup neurons and corrected neurons were cultured for approximately 21 days in total, and the culture medium was renewed every two or three days. Cells were treated with ASO starting from day 7 of the culture for seven days, after which the cells were cultured for another seven days in medium without ASO, including the day of transition from adding ASO to not adding ASO. Then these ASO-treated cells were harvested on day 14 of the culture or 7 days after the first ASO treatment, and subsequently harvested every two or three days, with a total of three lysates harvested thereafter. Specifically, cell lysates were harvested on days 7, 10, and 14 after the first day of ASO treatment, or equivalently on days 14, 17, and 21 of the total culture time, for qPCR and protein analysis. The washout phase of the culture began after the termination of ASO treatment and transition to using non-ASO medium, and lasted for 7 days.

[0902] Cell Lysate Preparation

[0903] Lysis was performed using RIPA lysis and extraction buffer (Thermo Fisher catalog number #89900) supplemented with Halt protease inhibitor cocktail (Thermo Fisher catalog number 1861278), 30 μl of buffer per well for each condition. Lysate preparation for qPCR analysis included using the lysis solution supplemented with DNase I (25 μl / well) and stop solution (2.5 μl / well) in the Invitrogen Cells-to-CT One-Step TaqMan Kit (ThermoFisher catalog number A25602).

[0904] Protein Quantification

[0905] The total protein level of cell lysates was quantified by assessing protein yield using the bicinchoninic acid (BCA) assay, which provides colorimetric detection and quantification of total protein. Two biological replicates were evaluated for each test ASO, positive and negative control ASOs, and untreated cells. The UBE3A protein level was quantified by Jess western blot. The primary antibody used was the UBE3A antibody from Proteintech (Proteintech catalog number 10344-1-AP) from rabbit host and diluted 1:10 in 10% goat serum. The secondary antibody used was anti-rabbit HRP secondary antibody, 1X. Each sample was normalized to the final concentration of total protein.

[0906] Sample Preparation for qPCR Analysis

[0907] Fifteen percent of the lysate volume prepared in each sample was used for qPCR reactions using TaqMan Master Mix in the Invitrogen Cells-to-CT One Step TaqMan Kit. The FAM-labeled human UBE3A probe was used simultaneously with the Applied Biosystems TM human RPLP0 (large ribosomal protein) endogenous control (VIC TM / TAMRA probe, Primer Limited).

[0908] Experimental setup

[0909] Ten ASOs were tested in duplicate at two concentrations (6.3 μM and 20 μM) in each cell plate. Seven cell plates were used. Each plate contained an ASO control at one concentration (5 μM) to normalize the qPCR data for each plate during data analysis. NEAT1 ASO, untreated and corrected without F-Dup were used as reference points for assessing ASO-induced knockdown. Two concentrations of all test ASOs and a set of controls (POS1, POS2, NEAT1 ASO, scr GFP_ASO, scr P1, F-Dup untreated and corrected untreated) were processed in the ProteinSimple Jess automated western blot instrument from Bio-Techne for protein quantification by protein separation and immunodetection.

[0910] Assay performance (mRNA) of controls and test ASOs on qPCR plates at day 7 and day 10 of treatment

[0911] The results of the UBE3A assay were consistent with high UBE3A knockdown levels and there was limited variability in the control ASO population. POS1 and POS2 knocked down >65% and >40% of UBE2A, respectively, relative to NEAT1 ASO, confirming successful ASO delivery, while NEAT1 ASO did not result in UBE3A mRNA knockdown. The positive control ASO had similar UBE3A mRNA knockdown levels on both day 7 and day 10 of treatment and thus indicated the presence of a distinct and stable effect.

[0912] Knockdown of UBE3A mRNA and protein levels was normalized to NEAT1 ASO at days 7, 10, and 14 of ASO treatment

[0913] Treatment with an ASO targeting UBE3A via gymnosis resulted in concentration-dependent UBE3A protein knockdown, and these test ASOs were normalized to NEAT1 ASO on days 7, 10, and 14 of ASO treatment (equivalent to days 0, 3, and 7 of washout, or days 14, 17, and 21 of culture time). Figures 3C to 3D ) The UBE3A mRNA knockdown effect increased only slightly on day 10, indicating that there may be abundant intracellular ASO at these concentrations (6.3 μM and 20 μM) on day 7. Figures 3A to 3B ) Compound_25 resulted in the highest UBE3A mRNA knockdown, while Compound_11 and Compound_20 resulted in the lowest UBE3A mRNA knockdown.

[0914] All test ASOs induced concentration- and time-dependent UBE3A protein knockdown, confirming the effects observed at the mRNA level. The data presented in the figures of this example represent the technical single mean + / - SD for each condition (biological replicates n = 2), corresponding to each treatment day.

[0915] With the extension of ASO treatment time, the knockdown of UBE3A protein gradually increased. By day 10 of treatment, all 10 exemplary test ASOs were able to knockdown 50% - 80% of UBE3A protein at 20 μM. By day 14 of treatment, all exemplary test ASOs induced >60% UBE3A protein knockdown at 20 μM concentration.

[0916] On day 10 of treatment, data points for Compound_34 (mRNA and protein) and Compound_17 (protein) at 6.3 μM were not obtained. On day 14 of treatment, data points for Compound_31 and Compound_34 (protein) at 20 μM were not collected. On day 7 of treatment, data points for NT-corrected (mRNA) at 6.3 μM were not collected.

[0917] Comparison of UBE3A mRNA and protein expression levels between F-Dup and corrected neurons

[0918] On day 11 of differentiation (equivalent to the day before the start of ASO treatment), the relative UBE3A mRNA expression levels between F-Dup 1-8 cells and F-Dup 1-8 corrected cells indicated a difference of approximately 2.5-fold. Figure 4A ) On day 11 of differentiation (equivalent to the day before the start of ASO treatment), the relative UBE3A protein expression levels between F-Dup 1-8 cells and F-Dup 1-8 corrected cells indicated a difference of approximately 1.25-fold. Figure 4B )

[0919] On days 19, 22, and 26 of differentiation, corresponding to days 14, 17, and 21 of culture, or days 0, 3, and 7 after termination of ASO treatment and use of non-ASO medium, the expression of UBE3A mRNA and UBE3A protein was evaluated. UBE3A mRNA was generally elevated in F-Dup1-8 cells. More specifically, the expression of UBE3A mRNA was increased approximately 2-fold in F-Dup1-8 cells relative to F-Dup1-8 corrected cells ( Figure 4C ); however, there was a smaller fold change in UBE3A protein expression levels between the two cell lines (between approximately 1.24-fold and approximately 1.6-fold) ( Figure 4D ). The difference in relative mRNA and protein expression may be explained by different regulatory pathways of the extra copies of UBE3A, or a shorter protein half-life to prevent over-accumulation in cells.

[0920] Figures 4A to 4D The data presented represent the mean + / − SD of technical replicates for each condition (biological replicates n = 2 - 4), corresponding to each day of differentiation. On day 19 of differentiation, mRNA data were not collected from corrected neurons.

[0921] UBE3A protein expression levels at days 7 and 10 of ASO treatment

[0922] ASO treatment via gymnosis using an ASO targeting UBE3A resulted in concentration-responsive and time-dependent UBE3A protein knockdown of the exemplary test ASO, which was normalized to NEAT1 ASO ( Figures 5A to 5B ). Protein expression levels were normalized to total protein output. The data represent the mean + / − SD of technical single replicates for each condition (biological replicates n = 2), corresponding to each day of treatment (NT = untreated). On day 10 of treatment, data points for compound_34 at 6.3 μM were not collected, or data points for compound_17 were not collected on days 10 and 14 of treatment. On day 14 of treatment, data points for compound_31 or compound_34 at 20 μM were not collected. D7, D10, and D14 in the schema represent days 7, 10, and 14 after ASO treatment (treatment days 7, 10, 14), respectively.

[0923] Table 12: Summary of results of 10 exemplary ASOs in rat and iPSC-derived neuron studies

[0924]

[0925] Table 13. Percentage summary of UBE3A knockdown results for RNA and protein

[0926]

[0927] Table 14. Detection Performance: Acceptance Criteria and Results of JESS Run (Protein)

[0928]

[0929] Table 15. Detection Performance: Acceptance Criteria and Results of JESS Run (Protein)

[0930]

[0931] Although the preferred embodiments of the present disclosure have been shown and described herein, it should be apparent to those of ordinary skill in the art that such embodiments are provided by way of example only. Many variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure may be employed in practicing the present disclosure. The following claims are intended to define the scope of the present disclosure and thereby cover the methods and structures within the scope of these claims and their equivalents.

Claims

1. A method for reducing the expression of UBE3A protein in mammalian cells, wherein the mammalian cells have a duplication, overexpression or gain-of-function mutation of the UBE3A gene encoding the UBE3A protein, and the method comprises contacting an agent or a vector encoding the agent with the mammalian cells, wherein the agent reduces the level of processed mRNA encoding the UBE3A protein in the mammalian cells.

2. The method according to claim 1, wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the sequence shown in any one of SEQ ID NOs: 93 - 120.

3. The method according to claim 1, wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of each mRNA transcript listed in Table 2.

4. The method according to claim 1, wherein the agent comprises an antisense oligomer.

5. The method according to claim 4, wherein the agent comprises an antisense oligomer having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1 - 92.

6. A method for regulating the expression of the UBE3A gene encoding the UBE3A protein in mammalian cells, the method comprising contacting an agent or a vector encoding the agent with the mammalian cells, wherein the agent comprises a polynucleotide sequence comprising an antisense oligomer having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1 - 92.

7. The method according to claim 4 or 6, wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety or a combination thereof.

8. The method according to claim 4 or 6, wherein the antisense oligomer comprises phosphorothioate linkages or phosphodiamidate linkages.

9. The method according to claim 4 or 6, wherein the antisense oligomer comprises phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl moiety, 2'-fluoro moiety, 2'-O-methoxyethyl moiety or 2'-NMA moiety.

10. The method according to claim 4 or 6, wherein the antisense oligomer comprises at least one modified sugar moiety.

11. The method according to claim 4 or 6, wherein the antisense oligomer comprises at least one, two, three, four, five or six modified nucleosides at the 5' end of the antisense oligomer.

12. The method according to claim 4 or 6, wherein the antisense oligomer comprises one, two, three, four, five or six modified nucleosides at the 5' end of the antisense oligomer.

13. The method according to claim 4 or 6, wherein the antisense oligomer comprises one, two, three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 5' end of the antisense oligomer.

14. The method according to claim 4 or 6, wherein the antisense oligomer comprises at least one, two, three, four, five or six modified nucleosides at the 3' end of the antisense oligomer.

15. The method according to claim 4 or 6, wherein the antisense oligomer comprises one, two, three, four, five or six modified nucleosides at the 3'-end of the antisense oligomer.

16. The method according to claim 4 or 6, wherein the antisense oligomer comprises one, two, three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer.

17. The method according to claim 4 or 6, wherein the antisense oligomer comprises three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 5'-end of the antisense oligomer; three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer; and phosphorothioate linkages between any two adjacent nucleosides of the antisense oligomer.

18. The method according to claim 4 or 6, wherein the antisense oligomer comprises: a 5'-region consisting of three, four, five or six linked nucleosides; a central region consisting of eight, nine, ten, eleven or twelve linked nucleosides; and a 3'-region consisting of three, four, five or six linked nucleosides; wherein each of the three, four, five or six linked nucleosides in the 5'-region and each of the three, four, five or six linked nucleosides in the 3'-region comprises a modified sugar moiety, and wherein each of the eight, nine, ten, eleven or twelve linked nucleosides in the central region is a deoxyribonucleoside.

19. The method according to claim 4 or 6, wherein the antisense oligomer consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases or 18 to 20 nucleobases.

20. The method according to claim 4 or 6, wherein the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

21. The method according to claim 4 or 6, wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence shown in any one of SEQ ID NOs: 154 - 189 or 192 - 247.

22. The method according to claim 1 or 6, wherein the vector comprises a viral vector encoding the agent.

23. The method according to claim 22, wherein the viral vector comprises an adenovirus vector, an adeno - associated virus (AAV) vector, a lentivirus vector, a herpes simplex virus (HSV) vector, or a retrovirus vector.

24. The method according to claim 4 or 6, wherein the antisense oligomer comprises a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

25. The method according to claim 4 or 6, wherein the antisense oligomer comprises a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

26. The method according to claim 4 or 6, wherein the antisense oligomer comprises a sequence having 100% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

27. The method according to claim 4 or 6, wherein the antisense oligomer consists of a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

28. The method according to claim 4 or 6, wherein the antisense oligomer consists of a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

29. The method according to claim 4 or 6, wherein the antisense oligomer consists of a sequence having 100% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

30. The method according to claim 6, wherein the method reduces the level of the processed mRNA encoding the UBE3A protein in the mammalian cell.

31. The method according to claim 1 or 29, wherein the level of the processed mRNA encoding the UBE3A protein in the mammalian cells contacted with the agent or the carrier is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same mammalian cells that have not been contacted with the agent or the carrier.

32. The method according to claim 1 or 29, wherein the level of the processed mRNA encoding the UBE3A protein in the mammalian cells contacted with the agent or the carrier is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same mammalian cells that have not been contacted with the agent or the carrier.

33. The method according to claim 1 or 29, wherein the method reduces the level of the UBE3A protein in the mammalian cells.

34. The method according to claim 32, wherein the level of the UBE3A protein in the mammalian cells contacted with the agent or the carrier is reduced by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same cells that have not been contacted with the agent or the carrier.

35. The method according to claim 32, wherein the level of the UBE3A protein in the mammalian cells contacted with the agent or the carrier is reduced by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same mammalian cells that have not been contacted with the agent or the carrier.

36. The method according to claim 1 or 6, wherein the method comprises contacting the agent or the carrier with a population of mammalian cells.

37. The method according to claim 35, wherein the agent reduces the level of the processed mRNA encoding the UBE3A protein in the population of mammalian cells by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

38. The method according to claim 35, wherein the agent reduces the level of the UBE3A protein in the mammalian cell population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20% compared to the same cell population that has not been contacted with the agent or the carrier.

39. The method according to claim 1 or 6, wherein the mammalian cells are ex vivo.

40. The method according to claim 1 or 6, wherein the mammalian cells are in vivo.

41. The method according to claim 1 or 6, wherein the genome of the mammalian cell has a duplication of the genomic region encompassing the UBE3A gene encoding the UBE3A protein.

42. The method according to claim 1 or 6, wherein the mammalian cells are human cells, and wherein the genome of the mammalian cell has a duplication of chromosome 15q11.2 - q13.

1.

43. The method according to claim 1 or 6, wherein the mammalian cells are obtained from a human subject suffering from Dup15q syndrome or are descendants of sample cells obtained from the human subject.

44. An antisense oligomer comprising a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NO: 1 - 92.

45. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises a backbone modification, a modified sugar moiety, or a combination thereof.

46. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises phosphorothioate linkages or phosphodiamidate linkages.

47. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises phosphorodiamidate morpholino, locked nucleic acid, peptide nucleic acid, 2'-O-methyl moiety, 2'-fluoro moiety, 2'-O-methoxyethyl moiety, or 2'-NMA moiety.

48. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises at least one modified sugar moiety.

49. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

50. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises one, two, three, four, five, or six modified nucleosides at the 5' end of the antisense oligomer.

51. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises one, two, three, four, five, or six 2'-O-methoxyethyl modified nucleosides at the 5' end of the antisense oligomer.

52. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises at least one, two, three, four, five, or six modified nucleosides at the 3' end of the antisense oligomer.

53. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises one, two, three, four, five or six modified nucleosides at the 3'-end of the antisense oligomer.

54. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises one, two, three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer.

55. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 5'-end of the antisense oligomer; three, four, five or six 2'-O-methoxyethyl modified nucleosides at the 3'-end of the antisense oligomer; and phosphorothioate linkages between any two adjacent nucleosides of the antisense oligomer.

56. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises: a 5'-region consisting of three, four, five or six linked nucleosides; a central region consisting of eight, nine, ten, eleven or twelve linked nucleosides; and a 3'-region consisting of three, four, five or six linked nucleosides; wherein each of the three, four, five or six linked nucleosides in the 5'-region and each of the three, four, five or six linked nucleosides in the 3'-region comprises a modified sugar moiety, and wherein each of the eight, nine, ten, eleven or twelve linked nucleosides in the central region is a deoxyribonucleoside.

57. The antisense oligomer according to claim 43, wherein the antisense oligomer consists of 8 to 50 nucleobases, 8 to 40 nucleobases, 8 to 35 nucleobases, 8 to 30 nucleobases, 8 to 25 nucleobases, 8 to 20 nucleobases, 8 to 15 nucleobases, 10 to 50 nucleobases, 10 to 40 nucleobases, 10 to 35 nucleobases, 10 to 30 nucleobases, 10 to 25 nucleobases, 10 to 20 nucleobases, 10 to 15 nucleobases, 12 to 50 nucleobases, 12 to 40 nucleobases, 12 to 35 nucleobases, 12 to 30 nucleobases, 12 to 25 nucleobases, 12 to 20 nucleobases, 12 to 15 nucleobases, 15 to 50 nucleobases, 15 to 40 nucleobases, 15 to 35 nucleobases, 15 to 30 nucleobases, 15 to 25 nucleobases, 15 to 20 nucleobases, 15 to 19 nucleobases, 15 to 18 nucleobases, 15 to 16 nucleobases, 16 to 20 nucleobases, 16 to 19 nucleobases, 16 to 18 nucleobases, 17 to 20 nucleobases, 17 to 19 nucleobases or 18 to 20 nucleobases.

58. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

59. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

60. The antisense oligomer according to claim 43, wherein the antisense oligomer comprises a sequence having 100% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

61. The antisense oligomer according to claim 43, wherein the antisense oligomer consists of a sequence having at least 80% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

62. The antisense oligomer according to claim 43, wherein the antisense oligomer consists of a sequence having at least 90% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

63. The antisense oligomer according to claim 43, wherein the antisense oligomer consists of a sequence having 100% identity to the sequence shown in any one of SEQ ID NOs: 1-92.

64. The antisense oligomer according to claim 43, wherein the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

65. The antisense oligomer according to claim 43, wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

66. The antisense oligomer according to claim 43, wherein the antisense oligomer is configured to reduce the level of the processed mRNA transcript encoding the UBE3A protein in the population after contact with a mammalian cell population.

67. The antisense oligomer according to claim 64, wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% as compared to the same population of mammalian cells that has not been contacted with the antisense oligomer.

68. The antisense oligomer according to claim 64, wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% as compared to the same population of mammalian cells that has not been contacted with the antisense oligomer.

69. The antisense oligomer according to claim 64, wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% as compared to the same population of mammalian cells that has not been contacted with the antisense oligomer.

70. The antisense oligomer according to claim 64, wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population of mammalian cells.

71. The antisense oligomer according to claim 68, wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

72. The antisense oligomer according to claim 68, wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

73. The antisense oligomer according to claim 64, wherein the antisense oligomer is configured to reduce the level of the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

74. The antisense oligomer according to claim 64, wherein the mammalian cells are ex vivo.

75. The antisense oligomer according to claim 64, wherein the mammalian cells are in vivo.

76. The antisense oligomer according to claim 64, wherein the genome of the mammalian cell has a duplication of a genomic region encompassing the UBE3A gene encoding the UBE3A protein.

77. The antisense oligomer according to claim 64, wherein the mammalian cell is a human cell.

78. The antisense oligomer according to claim 75, wherein the genome of the mammalian cell has a duplication of chromosome 15q11.2-q13.

1.

79. The antisense oligomer according to claim 64, wherein the mammalian cell is obtained from a human subject suffering from Dup15q syndrome or is a descendant of sample cells obtained from the human subject.

80. A pharmaceutical composition comprising: (a) a pharmaceutically acceptable excipient or carrier; and (b) the antisense oligomer according to any one of claims 43 to 77.

81. A pharmaceutical composition comprising: (a) a pharmaceutically acceptable excipient or carrier; and (b) an agent or a vector encoding the agent, wherein the agent is configured to reduce the level of a processed mRNA transcript encoding the UBE3A protein in the mammalian cell upon contact with the mammalian cell.

82. The pharmaceutical composition according to claim 79, wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of the sequence shown in any one of SEQ ID NOs: 93 - 120.

83. The pharmaceutical composition according to claim 79, wherein the agent comprises a polynucleotide sequence that is at least 80% complementary to at least 8 contiguous nucleic acids of each mRNA transcript listed in Table 2.

84. The pharmaceutical composition according to claim 79, wherein the agent comprises an antisense oligomer.

85. The pharmaceutical composition according to claim 82, wherein the antisense oligomer has at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

86. The pharmaceutical composition according to claim 79, which comprises the vector, and wherein the vector comprises a viral vector encoding the agent.

87. The pharmaceutical composition according to claim 84, wherein the viral vector comprises an adenovirus vector, an adeno-associated virus (AAV) vector, a lentivirus vector, a herpes simplex virus (HSV) vector, or a retrovirus vector.

88. The pharmaceutical composition according to claim 82, wherein the antisense oligomer comprises a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

89. The pharmaceutical composition according to claim 82, wherein the antisense oligomer comprises a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

90. The pharmaceutical composition according to claim 82, wherein the antisense oligomer comprises a sequence having 100% identity with the sequence shown in any one of SEQ ID NOs: 1 - 92.

91. The pharmaceutical composition according to claim 82, wherein the antisense oligomer consists of a sequence having at least 80% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

92. The pharmaceutical composition according to claim 82, wherein the antisense oligomer consists of a sequence having at least 90% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

93. The pharmaceutical composition according to claim 82, wherein the antisense oligomer consists of a sequence having 100% identity with the sequence shown in any one of SEQ ID NOs: 1-92.

94. The pharmaceutical composition according to claim 82, wherein the antisense oligomer is a modified oligonucleotide comprising the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

95. The pharmaceutical composition according to claim 82, wherein the antisense oligomer is a modified oligonucleotide consisting of the sequence shown in any one of SEQ ID NOs: 154-189 or 192-247.

96. The pharmaceutical composition according to claim 79, wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population upon contact with a mammalian cell population.

97. The pharmaceutical composition according to claim 93, wherein the antisense oligomer is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95% or about 95% to about 99% compared to a mammalian cell population that is otherwise identical and has not been contacted with the agent or the carrier.

98. The pharmaceutical composition according to claim 93, wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

99. The pharmaceutical composition according to claim 93, wherein the agent is configured to reduce the level of the processed mRNA encoding the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30%, or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

100. The pharmaceutical composition according to claim 93, wherein the agent is configured to reduce the level of the UBE3A protein in the population.

101. The pharmaceutical composition according to claim 97, wherein the agent is configured to reduce the level of the UBE3A protein in the population by about 10% to about 99%, about 10% to about 95%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 90%, about 20% to about 80%, about 20% to about 70%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, about 30% to about 50%, about 40% to about 70%, about 40% to about 60%, about 40% to about 50%, about 50% to about 99%, about 50% to about 95%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 50% to about 60%, about 60% to about 99%, about 60% to about 95%, about 60% to about 90%, about 60% to about 80%, about 60% to about 70%, about 70% to about 99%, about 70% to about 95%, about 70% to about 90%, about 70% to about 80%, about 80% to about 99%, about 80% to about 95%, about 80% to about 90%, about 90% to about 99%, about 90% to about 95%, or about 95% to about 99% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

102. The pharmaceutical composition according to claim 97, wherein the agent is configured to reduce the level of the UBE3A protein in the population by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 99% compared to the same population of mammalian cells that have not been contacted with the agent or the carrier.

103. The pharmaceutical composition according to claim 97, wherein the agent is configured to reduce the level of the UBE3A protein in the population by at most about 75%, at most about 70%, at most about 60%, at most about 50%, at most about 40%, at most about 30% or at most about 20% compared to the same population of mammalian cells that have not been contacted with the antisense oligomer.

104. The pharmaceutical composition according to claim 79, wherein the mammalian cells are ex vivo.

105. The pharmaceutical composition according to claim 79, wherein the mammalian cells are in vivo.

106. The pharmaceutical composition according to claim 79, wherein the genome of the mammalian cells has a duplication of the genomic region encompassing the UBE3A gene encoding the UBE3A protein.

107. The pharmaceutical composition according to claim 79, wherein the mammalian cells are human cells.

108. The pharmaceutical composition according to claim 104, wherein the genome of the mammalian cells has a duplication of chromosome 15q11.2-q13.

1.

109. The pharmaceutical composition according to claim 79, wherein the mammalian cells are obtained from a human subject suffering from Dup15q syndrome or are descendants of sample cells obtained from the human subject.

110. The pharmaceutical composition according to claim 79, wherein the pharmaceutical composition is formulated for intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, cisterna magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal injection, subretinal injection, topical application, implantation or intravenous injection.

111. The pharmaceutical composition according to claim 79, wherein the pharmaceutical composition is formulated for intrathecal injection.

112. The pharmaceutical composition according to claim 79, wherein the pharmaceutically acceptable excipient or carrier comprises artificial cerebrospinal fluid.

113. The pharmaceutical composition according to claim 79, wherein the pharmaceutical composition further comprises a second therapeutic agent.

114. The pharmaceutical composition according to claim 110, wherein the second therapeutic agent comprises a small molecule, an antisense oligomer or a gene editing molecule.

115. A method of treating a disease or disorder in a subject in need thereof or reducing the likelihood of the subject developing the disease or disorder by reducing the expression of UBE3A protein in the cells of the subject, the method comprising contacting the cells of the subject with a pharmaceutical composition according to any one of claims 78 to 111.

116. The method according to claim 112, wherein the disease or disorder is associated with overexpression of the UBE3A gene encoding the UBE3A protein or a gain-of-function mutation.

117. The method according to claim 112, wherein the genome of the cells of the subject has at least one extra copy of the UBE3A gene encoding the UBE3A protein.

118. The method according to claim 112, wherein the genome of the cells of the subject has a duplication of a genomic region encompassing the UBE3A gene encoding the UBE3A protein.

119. The method according to claim 112, wherein the genome of the cells of the subject has a duplication of chromosome 15q11.2-q13.

1.

120. The method according to claim 112, wherein the disease or disorder includes Dup15q syndrome, autism spectrum disorder, epilepsy or intellectual disability.

121. The method according to claim 112, wherein the subject is a human.

122. The method according to claim 112, wherein the subject is a fetus, embryo or child.

123. The method according to claim 112, wherein the cells are ex vivo.

124. The method according to claim 112, which comprises administering the pharmaceutical composition to the subject by: intracerebroventricular injection, intraperitoneal injection, intramuscular injection, intrathecal injection, cisterna magna injection, subcutaneous injection, oral administration, synovial injection, intravitreal injection, subretinal injection, topical application, implantation or intravenous injection.

125. The method according to claim 112, which comprises administering the pharmaceutical composition to the subject by intrathecal injection.

126. The method according to claim 112, wherein the method treats the disease or disorder.

Images