Application of 1,3-butanediol in the treatment of idiopathic pulmonary fibrosis

Abstract

The present invention relates to the field of biomedicine, and more specifically to the use of 1,3-butanediol in the treatment of idiopathic pulmonary fibrosis. 1,3-Butanediol inhibits pulmonary fibrosis and promotes lung function recovery by regulating AT2 cell proliferation, inhibiting fibroblast differentiation into myofibroblasts, inhibiting macrophage polarization into M2 macrophages, and regulating lipid metabolism.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and particularly to the use of 1,3-butanediol in treating idiopathic pulmonary fibrosis. Background Art

[0002] Pulmonary fibrosis (ILD) is a common outcome of chronic diseases caused by various endogenous and exogenous pathogens. Its pathological process is characterized by an imbalance between lung tissue damage and repair, leading to extensive extracellular matrix remodeling and excessive deposition. Ultimately, this leads to structural changes and functional loss of lung tissue, impairing alveolar ventilation, and causing dyspnea. Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, fibrotic interstitial lung disease of unknown etiology. While its pathogenesis remains incompletely elucidated, it is generally believed to be closely related to the interaction of multiple factors, including genetic susceptibility, environmental exposures (such as smoking, metal dust, and organic dust), and aging. Its characteristic pathological changes are characterized by usual interstitial pneumonia (UIP), characterized by predominant interstitial fibrosis and fibroblastic foci in the subpleural region, as well as heterogeneity in pathological stages across different lung regions. The clinical course of IPF is chronic and slowly progressive, primarily manifested by progressively worsening dyspnea, often accompanied by a dry cough and fine crackles at the lung bases. The course of the disease usually lasts for months to years from the onset of symptoms to significant lung function decline. Some patients will experience acute exacerbations after a stable period, significantly increasing the risk of death. It should be noted that pulmonary fibrosis is completely different from acute infectious pneumonia in terms of etiology, pathogenesis, histological manifestations and treatment strategies. Infectious pneumonia is mainly an acute inflammatory response caused by the invasion of a clear pathogen, with rapid onset and short-term progression, and is usually treated with antibiotics. IPF is a non-infectious disease, and its pathogenesis involves abnormal repair processes after micro-injury to alveolar epithelial cells, manifesting as chronic, irreversible interstitial fibrosis, and is unresponsive to antibiotics.

[0003] Currently, there is no cure for IPF. Internationally, only pirfenidone and nintedanib are approved for delaying its progression, but their efficacy is limited. Therefore, given the clinical characteristics of IPF as a chronic, progressive, and fatal lung disease and the severe lack of treatment options, the development of novel and effective intervention strategies has important clinical value and practical significance. Summary of the Invention

[0004] This application systematically integrates evidence at the tissue, cellular, molecular and metabolic levels to clearly reveal the multiple mechanisms of action of 1,3-butanediol in anti-fibrosis, improving lung inflammation, promoting alveolar repair and regulating lipid metabolism.

[0005] Specifically, this application comprehensively evaluates the potential therapeutic effect of 1,3-butanediol in the treatment of pulmonary fibrosis through Examples 1-6. Pulmonary fibrosis model mice exhibit typical pathological changes, including decreased lung compliance, increased airway and tissue resistance, reduced lung volume, as well as destruction of alveolar structure and excessive collagen deposition. At the same time, targeted lipidomics analysis showed that there was a significant abnormal accumulation of pro-inflammatory lipids and cholesterol esters in fibrotic lung tissue, suggesting that lipid metabolism disorders may be an important mechanism for the progression of fibrosis.

[0006] Intervention with 1,3-butanediol significantly improved these phenotypes, demonstrating protective effects at multiple levels, including lung function, tissue structure, and molecular expression. It not only significantly increased lung tissue compliance, reduced respiratory resistance and tissue elasticity, and improved lung ventilation capacity, but also, at a pathological level, alleviated fibrotic lesions and collagen deposition, maintaining the integrity of lung structure. Furthermore, 1,3-butanediol effectively inhibited the abnormal accumulation of proinflammatory lipids and cholesterol esters in fibrotic lung tissue, revealing its potential mechanism for alleviating pulmonary fibrosis by regulating lipid metabolism.

[0007] Combined with the results of single-cell transcriptome sequencing, the key mechanism of 1,3-butanediol in the intervention of pulmonary fibrosis was further revealed at the cellular level. In macrophages, 1,3-butanediol significantly activated genes related to fatty acid oxidation and cholesterol synthesis (such as Prkaa1 、 Cpt1a 、 Acox1 、 Srebf2 、 Hmgcr ), and inhibit pro-inflammatory and immune response pathways, while effectively reducing the excessive polarization of M1 to the pro-fibrotic M2 phenotype, reducing extracellular matrix deposition, thereby inhibiting macrophage-mediated inflammation amplification and pro-fibrotic tissue remodeling at the source. In epithelial cells, 1,3-butanediol significantly promotes AT2 cell proliferation and restores its number, activating multiple key pathways including cholesterol metabolism, lipid homeostasis and cell regeneration (such as Zbtb20 、 Soat1 、 Acsl4 ), while downregulating pro-fibrotic genes S100a8 and S100a9 , enhancing epithelial repair ability. In fibroblasts, 1,3-butanediol not only effectively prevents their abnormal differentiation into myofibroblasts, but also downregulates Tgfbi 、 Tgfbr3 、 Spp1 and other profibrotic genes, and up-regulated Bmp4 and Rcn3 Anti-fibrotic and epithelial support factors, while activating Srebf2 、 Hmgcr 、 Cpt1a Cholesterol synthesis and fatty acid oxidation pathways, promoting the restoration of interstitial homeostasis from the dual dimensions of metabolism and differentiation.

[0008] These comprehensive research results consistently confirmed from multiple dimensions, including cell lineages, signaling pathways, metabolic characteristics, and lung function phenotypes, that 1,3-butanediol regulates lipid metabolism, especially cholesterol metabolism, across cell types, precisely intervening in the functional state and fate determination of macrophages, epithelial stem cells AT2, and fibroblasts, synergistically inhibiting the progression of pulmonary fibrosis and promoting the recovery of alveolar structure and function.

[0009] The first aspect of the present invention provides use of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof in the preparation of a medicament for preventing and / or treating pulmonary fibrosis.

[0010] The second aspect of the present invention provides the use of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof as the sole active ingredient in the preparation of a medicament for preventing and / or treating pulmonary fibrosis.

[0011] The 1,3-butanediol or its pharmaceutically acceptable salt or solvate can prevent and / or treat pulmonary fibrosis through any one or a combination of two or more of the following pathways:

[0012] A) Inhibiting the polarization of macrophages into M2 macrophages; preferably, inhibiting the polarization of M1 macrophages into M2 macrophages.

[0013] B) Enhance the proliferation of AT2 cells and promote alveolar repair.

[0014] C) Restoration of AT1 cell population.

[0015] D) regulate lipid metabolism.

[0016] E) Inhibits the differentiation of fibroblasts into myofibroblasts.

[0017] F) Reduce the level of FN1 protein.

[0018] Preferably, said D) includes:

[0019] a) reducing the level of one or more of ceramide, sphingomyelin and / or lysophospholipids; and / or,

[0020] b) Lowering the levels of cholesterol and / or cholesterol esters.

[0021] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof prevents and / or treats pulmonary fibrosis by enhancing the lipid metabolism activity of AT2 cells.

[0022] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof prevents and / or treats pulmonary fibrosis by downregulating one or more of pro-fibrotic genes, upregulating anti-fibrotic genes, upregulating epithelial support factors, upregulating cholesterol synthesis-related genes or upregulating fatty acid β-oxidation-related genes.

[0023] Further preferably, the pro-fibrotic genes include Tgfbi 、 Tgfbr3 and Spp1 .

[0024] Further preferably, the anti-fibrosis gene includes Bmp4 .

[0025] Further preferably, the cholesterol synthesis-related genes include Srebf2 and Hmgcr .

[0026] Further preferably, the fatty acid β-oxidation related genes include Cpt1a .

[0027] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can improve the static compliance, deep inspiration capacity, and forced vital capacity of lung tissue.

[0028] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can reduce airway resistance, respiratory system elasticity, tissue damping and tissue elasticity.

[0029] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can reduce lung density, narrow the scope of consolidation, and alleviate pathological thickening and inflammatory exudation of the lung parenchyma.

[0030] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can reduce collagen deposition, alleviate alveolar structure destruction and inflammatory cell aggregation.

[0031] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can inhibit the expression level of fibronectin 1 (Fn1).

[0032] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can upregulate pathways such as lipid metabolism regulation, fatty acid metabolism, cholesterol metabolism regulation, and epithelial cell function maintenance.

[0033] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can downregulate pathways such as extracellular matrix organization, collagen fiber formation, and inflammatory response regulation.

[0034] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can inhibit the accumulation of pro-inflammatory lipids.

[0035] Further preferably, the pro-inflammatory lipids include ceramide, sphingomyelin and lysophospholipids.

[0036] Preferably, the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof can promote fatty acid oxidation, enhance the cholesterol biosynthesis pathway, and inhibit the accumulation of free cholesterol and cholesterol esters.

[0037] Preferably, the pharmaceutically acceptable salt includes one or more of sodium salt, potassium salt, magnesium salt or calcium salt.

[0038] Preferably, the pulmonary fibrosis includes primary pulmonary fibrosis, secondary pulmonary fibrosis or idiopathic pulmonary fibrosis.

[0039] Preferably, the drug comprises 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, and a pharmaceutically acceptable excipient.

[0040] The drug can be in any suitable dosage form, including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, effervescent tablets, pills, gels, and the like.

[0041] Various dosage forms of the drug can be prepared according to conventional production methods in the pharmaceutical field.

[0042] The drug may contain 0.01-99.5% (specifically, 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%) of the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof.

[0043] Further preferably, the pharmaceutically acceptable excipients include one or more of solvents, excipients, diluents, adhesives, lubricants, humectants, emulsifiers, preservatives, antioxidants, buffers, antibacterial agents, disintegrants, surfactants, suspending agents, suspending aids, solubilizers, thickeners, stabilizers, sweeteners and flavors.

[0044] In a third aspect, the present invention provides a drug for preventing and / or treating pulmonary fibrosis, comprising 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, and a pharmaceutically acceptable excipient.

[0045] The fourth aspect of the present invention provides a method for preventing and / or treating pulmonary fibrosis, which comprises administering an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect to a subject in need.

[0046] The administration may be parenteral or enteral.

[0047] The fifth aspect of the present invention provides a method for inhibiting the polarization of M1 macrophages to M2 macrophages, comprising administering to a subject in need thereof an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect.

[0048] The sixth aspect of the present invention provides a method for enhancing AT2 cell proliferation and / or restoring AT1 cell number, comprising administering to a subject in need thereof an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug according to the third aspect.

[0049] The seventh aspect of the present invention provides a method for inhibiting the differentiation of fibroblasts into myofibroblasts, which comprises administering an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect to a subject in need.

[0050] The eighth aspect of the present invention provides a method for improving lung function, which comprises administering an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect to a subject in need.

[0051] Preferably, the pulmonary function includes PV loop (Pressure-Volume Loop), inspiratory capacity (IC), respiratory resistance (Rrs), airway resistance (Rn), tissue damping (G), tissue elasticity (H), respiratory elasticity (Ers), static compliance (Crs) and forced vital capacity (FVC).

[0052] The ninth aspect of the present invention provides a method for regulating cholesterol homeostasis and reducing the accumulation of pro-inflammatory lipids, which comprises administering an effective amount of 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof, or the drug described in the third aspect to a subject in need.

[0053] The "method" described in the present invention can be for therapeutic purposes or non-therapeutic purposes.

[0054] The term “comprising” described in the present invention is an open description, which includes the specified components or steps described, as well as other specified components or steps that will not be substantially affected.

[0055] The term "and / or" as used herein includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately in this application. For example, "A and / or B" includes "A," "A and B," and "B."

[0056] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-associated signs, symptoms, conditions, or disorders.

[0057] The “prevention” mentioned in the present invention refers to all actions of suppressing symptoms or delaying the progression of specific symptoms by administering the product mentioned in the present invention (such as the 1,3-butanediol or its pharmaceutically acceptable salt or solvate or drug).

[0058] The "effective amount" of the present invention refers to the amount or dosage of the product of the present invention (e.g., the 1,3-butanediol or a pharmaceutically acceptable salt or solvate thereof or a drug) that provides the desired treatment or prevention after being administered to a patient in a single or multiple doses.

[0059] The "subject" described in the present invention can be a human or a non-human animal (e.g., a non-human mammal). The non-human mammal can be a wild animal, zoo animal, commercial animal, pet, laboratory animal, etc. Preferably, the non-human mammal includes, but is not limited to, pigs, cattle, sheep, horses, donkeys, foxes, minks, jackals, camels, dogs, cats, rabbits, mice (e.g., rats, mice, hamsters, gerbils, chinchillas, squirrels), monkeys, etc.

[0060] The term "pharmaceutically acceptable" as used herein means that the pharmaceutical composition neither significantly stimulates the organism nor inhibits the biological activity and properties of the active substance of the administered product.

[0061] The "pharmaceutically acceptable salt" of the present invention refers to a salt prepared from a pharmaceutically acceptable, non-toxic acid or base, wherein the acid or base includes an inorganic acid or base or an organic acid or base. The inorganic acid is selected from hydrochloric acid, hydrobromic acid, phosphoric acid, hydroiodic acid, or sulfuric acid. The inorganic base is selected from calcium, magnesium, lithium, sodium, zinc, aluminum, or potassium. The organic acid is selected from formic acid, glycolic acid, propionic acid, acetic acid, succinic acid, methanesulfonic acid, ethanesulfonic acid, maleic acid, glutamic acid, benzoic acid, stearic acid, alginic acid, benzenesulfonic acid, glucuronic acid, pamoic acid, or galacturonic acid. The organic base is selected from diethanolamine, choline, procaine, lysine, or 1,2-ethylenediamine.

[0062] As used herein, a "solvate" refers to a physical association between a compound of the present invention (i.e., 1,3-butanediol) and one or more solvent molecules. This physical association includes varying degrees of ionic and covalent bonding, such as hydrogen bonding. In some cases, a solvate can be isolated, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid. Solvates include both solution-phase and isolatable solvates. Representative solvates include ethanolates, methanolates, hydrates, and the like.

[0063] Beneficial effects of this application:

[0064] 1. This application discovered that 1,3-butanediol (1,3-BD) exhibits significant anti-fibrotic effects on multiple levels. Compared with the control group, mice in the model group exhibited significant weight loss and decreased survival, suggesting a severe course of bleomycin-induced pulmonary fibrosis. Intervention with 1,3-BD not only significantly alleviated these clinically relevant phenotypes but also demonstrated a positive overall improvement trend, demonstrating its potential clinical application in the treatment of pulmonary fibrosis.

[0065] 2. This application uses drinking water to administer 1,3-butanediol, which is easy to use and has strong compliance. Functional testing results show that 1,3-butanediol significantly improves lung dysfunction, including recovery of the pressure-volume (PV) loop, increased inspiratory capacity (IC), improved static compliance (Crs), reduced respiratory system resistance (Rrs) and tissue elasticity (Ers), and recovery of forced vital capacity (FVC), indicating that it can effectively alleviate alveolar structural damage and improve lung compliance and ventilation function.

[0066] 3. At the molecular level, 1,3-butanediol inhibits the abnormal expression of key fibrosis genes (such as fibronectin FN1), reducing collagen deposition and extracellular matrix remodeling in lung tissue, thereby slowing the progression of pulmonary fibrosis. Furthermore, 1,3-butanediol can upregulate pathways related to lipid metabolism, cholesterol transport, and alveolar epithelial cell repair, promoting AT2 cell proliferation and restoring AT1 cell numbers, significantly improving alveolar structure and tissue homeostasis.

[0067] 4. 1,3-Butanediol also shows good effects in regulating inflammation. It can effectively inhibit the accumulation of inflammatory mediators such as pro-inflammatory lipids (such as cholesterol, ceramide Cer, sphingomyelin SM and lysophospholipid LPC), reduce the activation of inflammatory response and immune cell recruitment pathways, alleviate oxidative stress damage, and inhibit pathological extracellular matrix deposition and chronic inflammatory processes from the level of metabolism-immunity-repair triple network, thereby further slowing the development of pulmonary fibrosis.

[0068] 5. As a compound with a simple structure and a clear metabolic profile, 1,3-butanediol possesses excellent pharmacokinetic properties and safety. Long-term administration of 1,3-butanediol in animal studies has demonstrated no significant toxic side effects. Its wide safe dose range and high absorption efficiency demonstrate a promising pharmacological basis and promising application prospects. In summary, 1,3-butanediol is a metabolic intervention candidate with a clear targeting mechanism, good safety profile, and therapeutic potential, and is expected to be used in the clinical treatment and drug development of pulmonary fibrosis and related diseases in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0070] Figure 1 : Statistics of body weight and survival rate, including 16 mice in the normal control group, 12 mice in the model group, and 11 mice in the treatment group. The horizontal axis is the number of days after the start of modeling. Figure a: Statistical results of body weight of mice in each group. The weight of all mice was normalized with their own weight on the first day of modeling as 1; Figure b: Statistical results of the survival rate of mice in each group, displayed as survival percentage.

[0071] Figure 2 : Analysis of lung function indicators of mice in each group (n=7 per group) included pressure-volume loop (PV loop), deep inspiratory capacity, respiratory system resistance, large airway resistance, tissue damping, tissue elasticity, respiratory system elasticity, static compliance and forced vital capacity.

[0072] Figure 3 : CT imaging results of mouse lungs. Figure a shows representative coronal and axial lung scan images of three groups of mice; Figure b shows a three-dimensional reconstruction of tissue density based on whole-lung CT scan data, including ventral and dorsal structures.

[0073] Figure 4Representative pathological staining images of lung tissue from mice in each group. Panel a: Representative Masson trichrome staining images (n = 6, scale bar 2.00 mm); Panel b: Representative hematoxylin and eosin (H&E) staining images (n = 6, scale bar 500 μm); Panel c: Representative Sirius red staining images (n = 6, scale bar 50 μm). Panel d: Quantification of fibrosis severity, using the Ashcroft score of lung tissue sections (n ​​= 6 mice per group; averaged across ≥ 8 fields per mouse).

[0074] Figure 5 : Representative immunofluorescence staining images of SPC, Ki67, and PDPN in lung tissue (n=6, scale bar 20μm). In immunofluorescence staining, Ki67 is used as a marker of cell proliferation, pro-surfactant protein C (pro-SPC) specifically marks alveolar type II epithelial cells (AT2), and podoplanin (PDPN) is a characteristic molecule of alveolar type I epithelial cells (AT1). The first row shows DAPI (blue, marking cell nuclei), Ki67 (green), and pro-SPC (red) signals in sequence. Double-positive cells (Ki67) co-expressing green and red) + / pro-SPC + ) represents proliferating AT2 cells. The second row shows DAPI, PDPN, and pro-SPC signals to clarify the distribution and number changes of AT1 and AT2 cells in the tissue.

[0075] Figure 6 : Changes in the expression of key molecules related to pulmonary fibrosis in the lung tissues of mice in each group. The mRNA expression level of Fn1 (Figure a) in lung homogenate was detected by RT-qPCR (n=5 per group), Figure b is the image of the immunoblotting results, and Figure c is the relative abundance of FN1 (n=4 per group).

[0076] Figure 7 : GO functional enrichment analysis of differentially expressed genes (DEGs) between the normal control group and the model group (Figure a) and between the model group and the treatment group (Figure b).

[0077] Figure 8: Changes in lipid metabolism in the lung tissues of mice in each group, where Figure a: Absolute quantitative analysis of representative lipid molecules (including cholesterol, CE 18:2, CE 18:3, CE 19:0, Cer d17:1 / 26:0, Cer d18:2 / 26:0, SM d18:1 / 17:1, SM d18:1 / 20:2, SM d18:1 / 24:2, LPCe 15:0, LPCe 18:2 and LPC 26:2); Figure b: Heat map display of significantly different lipids (P < 0.05) identified by targeted lipidomics in the lung tissues of mice in the normal control group, model group and treatment group (n = 5 for each group).

[0078] Figure 9 : Single-cell transcriptome sequencing results, among which, Figure a: The integrated UMAP map shows the distribution of various cell types in all samples, colored by cell type; Figure b: The expression distribution of classic marker genes used for cell type annotation in the UMAP map, and the color gradient indicates the standardized expression level; Figure c: The UMAP map is colored by experimental group to distinguish the normal control group, model group and treatment group; Figure d: The UMAP map is colored by individual samples to reflect the differences between samples; Figure e: Shows the proportion distribution of different cell types in each sample, colored by cell type; Figure f: Shows the average proportion of different cell types in each experimental group, colored by cell type (n = 3 per group).

[0079] Figure 10 Analysis results of macrophages and monocytes. Figure a: UMAP plot showing clustering of macrophages and monocytes, including alveolar macrophages (AM), interstitial macrophages (IM), and monocytes; Figure b: Expression distribution of classic marker genes in the UMAP plot to assist in cell annotation, with the color gradient representing normalized expression levels; Figure c: Violin plot showing the expression levels of typical AM-related genes; Figure d: UMAP plot showing the distribution of M1-like and M2-like gene signature scores in macrophage / monocyte populations, with color intensity representing gene set scores; Figure e: Pseudo-temporal trajectory analysis of the M1-to-M2-like polarization process. The first row shows a comparison between the normal control group and the model group, and the second row shows a comparison between the model group and the treatment group. Trajectories are colored by cell subset, pseudo-temporal sequence, and experimental group, respectively; Figure f: Expression dynamics of representative genes during the M1-to-M2-like conversion process. The color gradient represents expression intensity. The first row shows a comparison between the normal control group and the model group, and the second row shows a comparison between the model group and the treatment group.

[0080] Figure 11Epithelial cell analysis results. Figure a: UMAP plot showing the clustering of epithelial cells, which are divided into six subpopulations, including AT1 cells, AT2 cells, intermediate cells, club cells, ciliated cells, and neuroendocrine cells; Figure b: Expression distribution of classic marker genes in the UMAP plot, used for cell type annotation, with the color gradient representing normalized expression levels; Figure c: GO functional enrichment analysis of AT2 cells based on differentially expressed genes (DEGs) between the model and treatment groups (adjusted P value < 0.05, |logFC| > log1.5); Figure d: Violin plot showing the expression of representative AT2-related genes associated with the enriched GO pathways in Figure c.

[0081] Figure 12 : Stromal cell analysis results. Figure a: UMAP plot showing the clustering of stromal cells, which are divided into four subpopulations; Figure b: Expression distribution of classic marker genes used for cell type annotation in the UMAP plot, with the color gradient representing normalized gene expression levels; Figure c: Statistics of the proportion of fibroblasts and myofibroblasts among all stromal cells in each sample (n = 3); Figure d: GO functional enrichment analysis of fibroblasts based on differentially expressed genes (DEGs) between the model and treatment groups (adjusted P value < 0.05, |logFC| > log1.5); Figure e: Pseudo-temporal trajectory analysis of stromal cells, colored by cell subpopulation, pseudo-temporal process, and experimental group, with the first row showing the comparison between the normal control group and the model group, and the second row showing the comparison between the model group and the treatment group; Figure f: Violin plot showing the expression of representative fibroblast genes associated with the enriched GO pathways in Figure d. DETAILED DESCRIPTION

[0082] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0083] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and biological materials described are commercially available unless otherwise specified.

[0084] The 1,3-butanediol used in the examples was purchased from Sigma (309443), and its structure is shown in Formula I. Formula I.

[0085] Experimental materials and methods involved in this application:

[0086] 1. Mice and Housing Conditions

[0087] The animals used in this application were 8-week-old male C57BL / 6J mice weighing 22-26 grams, purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. Mice were housed in a well-ventilated, temperature-controlled rodent housing system with free access to standard chow and water. All animal experimental protocols were approved by the Laboratory Animal Use and Care Committee (Animal Protocol No. 23-CGQ) and complied with relevant national regulations and standards for the use of experimental animals.

[0088] 2. Monitoring of Mouse Weight and Survival Rate

[0089] Starting from the first day of modeling, mice were weighed daily and deaths were recorded for analysis of weight changes and survival rates.

[0090] 3. Mouse Lung Function Testing

[0091] Mice were deeply anesthetized, intubated, and secured to a pulmonary function testing system (FlexiVent, SCIREQ, Canada). Five testing modes (snapshot, prime / quick prime, PV loop, NPFE, and deep inflation) were tested three times each. Measured parameters included PV loop (pressure-volume loop), inspiratory capacity (IC), respiratory resistance (Rrs), airway resistance (Rn), tissue damping (G), tissue elastance (H), elastic resistance (Ers), static compliance (Crs), and forced vital capacity (FVC).

[0092] 4. CT Scan of Mouse Lungs

[0093] Mice were deeply anesthetized and fixed in a scanning chamber. Lung imaging was performed using a high-resolution, fast in vivo micro-CT scanner (SkyScan 1276, Bruker, Germany). Scanning parameters were: current 200 μA, voltage 80 kV, pixel size 7.999873 μm, exposure time 600 ms, and rotation step size 0.400°. CT data were analyzed and displayed using DataViewer software.

[0094] 5. Masson's trichrome staining of mouse lung tissue

[0095] After dewaxing and hydration, paraffin sections, such as those with Bouin's fixation, require post-treatment with Bouin's solution. Sections are stained with Weigert's iron hematoxylin for nuclear staining, differentiated with 1% hydrochloric acid and alcohol, and stained with acid fuchsin for cytoplasm. Following treatment with phosphomolybdic acid, sections are counterstained with aniline blue. Finally, sections are rinsed with 1% glacial acetic acid, dehydrated, transparentized, and mounted. The staining results in collagen fibers appearing blue, cytoplasm and red blood cells appearing red, and nuclei appearing purple-black.

[0096] 6. HE staining of mouse lung tissue

[0097] Fixed lung tissue was dehydrated, cleared, and embedded in paraffin. Sections were then sectioned at 5 μm thickness. After dewaxing and rehydration, sections were stained with hematoxylin and eosin (HE), sequentially staining nuclear staining (hematoxylin), differentiation staining (1% hydrochloric acid alcohol), bluing, and cytoplasmic staining (eosin). Sections were dehydrated with graded ethanol, cleared with xylene, and mounted with neutral gum.

[0098] 7. Sirius Red Staining of Mouse Lung Tissue

[0099] Paraffin sections were stained with Sirius Red staining solution, and the characteristic birefringence signals of collagen fibers were observed under a polarizing microscope (BX51, Olympus, Japan).

[0100] 8. Immunofluorescence Staining

[0101] Tissue sections were deparaffinized, antigen retrieved, and permeabilized with Triton X-100 before serum blocking and incubation with primary and secondary antibodies. Cell nuclei were stained with DAPI. The following primary and fluorescent secondary antibodies were used: SPC (Abcam, AB211326) and secondary antibodies: rabbit 594 (Invitrogen, A21207); Ki67 (eBioscience, 14-5698-82) and secondary antibodies: rat 488 (Invitrogen, A21208); PDPN (Invitrogen, 14-5381-85) and secondary antibodies: hamster 488 (Invitrogen, A21110).

[0102] 9. RNA Extraction

[0103] Lung tissue was lysed in TRIzol (Invitrogen, USA), treated with chloroform to separate proteins and RNA, and RNA was precipitated with isopropanol and washed with 75% ethanol. RNA was then dissolved in RNase-free water. RNA concentration and purity (A260 / A280) were determined using a NanoDrop micro-spectrophotometer (Thermo Scientific, USA).

[0104] 10. Real-time quantitative PCR (qPCR)

[0105] The extracted RNA was reverse transcribed into cDNA, and the reaction system was prepared using qPCR Master Mix. The qPCR program (denaturation, annealing, extension) was set according to the enzyme characteristics. The primer sequences are as follows:

[0106] Fibronectin1-F: ATGTGGACCCCTCCTGATAGT (SEQ ID NO: 1);

[0107] Fibronectin1-R: GCCCAGTGATTTCAGCAAAGG (SEQ ID NO: 2);

[0108] housekeeping gene 18S-F: CCAGAGCGAAAGCATTTGCCAAGA (SEQ ID NO: 3);

[0109] Housekeeping gene 18S-R: TCGGCATCGTTTATGGTCGGAACT (SEQ ID NO: 4).

[0110] 11. Protein Extraction and Western Blot

[0111] Cells or tissues were lysed with pre-cooled RIPA buffer containing inhibitors. Total protein was collected by centrifugation and quantified by the BCA assay (Thermo Scientific, USA). Samples were denatured by heating with loading buffer and then electrophoresed on a 4%-12% gradient gel (NuPAGE, USA). The membranes were transferred to PVDF membranes and blocked. After incubation with primary and secondary antibodies, detection was performed using chemiluminescence. Antibody information is as follows: recombinant anti-fibronectin antibody (abcam, ab199056) and anti-alpha tubulin antibody (abcam, ab7291).

[0112] 12. Bulk RNA Sequencing Analysis

[0113] In bulk RNA sequencing analysis, differentially expressed genes (DEGs) were identified based on an adjusted P value (Padj) < 0.05 and an absolute log2-fold change (|log2FC|) > 1. Functional enrichment of DEGs was assessed using Gene Ontology (GO) analysis using the DAVID database (https: / / david.ncifcrf.gov). Significantly enriched pathways were defined as having a P value < 0.05.

[0114] 13. Lipidomics Analysis

[0115] Lipidome samples were prepared from lung tissues of five model mice in each group, following a standardized protocol. The weight of each lung tissue sample was recorded and thoroughly homogenized using a tissue grinder. Chloroform / methanol extract containing an internal standard was added to the sample, and the samples were shaken, sonicated, and centrifuged to separate the organic and aqueous phases. The supernatant was carefully transferred to a fresh tube, and the residual precipitate was further treated with chloroform and KCl solution, shaken again, and centrifuged to extract lipids. The resulting supernatants were combined and concentrated at low temperature. A blank sample was included for every 10–20 samples tested to monitor background signal. All samples were processed according to a pre-defined standardized protocol to ensure consistency between experimental groups and normal controls and minimize batch effects. Lipid profiles were analyzed using an Agilent G6495C triple quadrupole LC / MS system equipped with iFunnel technology to enhance ion transmission efficiency and SWARM-assisted optimization to achieve high-throughput and accurate lipid quantification.

[0116] 14. Single-cell transcriptomics data analysis

[0117] Single-cell transcriptome (scRNA) analysis was performed as follows: Raw sequencing data were processed using CellRanger (version 4.0.8), with reads aligned to the mouse reference genome mm10 (Mus musculus). Cells within each sample were identified using default parameters. Initial quality control, dataset integration, and cell clustering analysis were performed using Scanpy (version 1.10.2). Cells expressing fewer than 200 genes, cells with a mitochondrial gene ratio exceeding 20%, and genes detected in fewer than three cells were removed. Duplicate cells were identified and removed using Scrublet with default parameters. After preprocessing to remove low-quality and duplicate cells, batch effect correction and sample integration were performed using Harmony. Principal component analysis (PCA) was then performed on the 2,000 genes with the greatest variability. Clustering was performed using the Leiden algorithm (resolution = 0.2) based on a neighbor-joining graph. Cell subsets identified included epithelial, endothelial, immune, stromal, and mesothelial cells. Macrophage / monocyte clusters were functionally divided into M1 (pro-inflammatory) and M2 (pro-fibrotic) types. Module scores were calculated using the scoregenes function. Differentially expressed genes (DEGs) were analyzed using the FindMarkers function in Seurat, with screening criteria of Padj < 0.05, |log2FC| > 1.5, and a gene expression ratio exceeding 25% in any group. Significant DEGs were further analyzed for pathway enrichment in the GO and KEGG databases using the clusterProfiler R package (version 4.10.1). To visualize expression changes between conditions, genes were normalized using the NormalizeData function, followed by calculation of the mean expression level for each sample using the AverageExpression function and log transformation. For pathway enrichment visualization, genes were ranked by log2FC and input into clusterProfiler for GSEA analysis, which was then displayed using the GseaVis package.

[0118] 15. Statistical Analysis

[0119] All data are expressed as mean ± SD. The Student's t test was used for comparison between groups, and a p value less than 0.05 was considered statistically significant. represents P < 0.05, represents P < 0.01, represents P < 0.001, Represents P < 0.0001.

[0120] Example 1: 1,3-Butanediol prolongs the survival of mice with pulmonary fibrosis

[0121] 1. Grouping of mice and establishment of pulmonary fibrosis animal model

[0122] The mice were randomly divided into normal control group, model group and 1,3-butanediol treatment group (i.e. treatment group).

[0123] Mice in the 1,3-butanediol-treated group were administered the drug starting 7 days before modeling and continuing until day 21 after BLM injection. The drug was dissolved in drinking water at a 10% (v / v) ratio and allowed to drink freely. The general condition of the mice was observed and recorded daily.

[0124] Modeling: After anesthetizing mice, the trachea was exposed. Bleomycin (BLM) (2 U / kg) was injected into the trachea via the tracheal cartilage rings using a 25-gauge needle. Mice in the control group and the 1,3-butanediol-treated group were injected with an equal volume of PBS solution. After surgery, the tracheotomy site was sutured, and the mice were allowed to recover. Twenty-one days after BLM injection, the mice were sacrificed, and lung tissue was collected for subsequent experiments.

[0125] 2. Results The results of monitoring the weight and survival rate of mice in each group showed that compared with the normal control group, the weight of the model group decreased significantly after the model was established, while the 1,3-butanediol treatment group effectively alleviated the weight loss. In addition, some mice in the model group died from the 7th day, and the survival rate was significantly reduced. However, the treatment group effectively prolonged the survival time of the mice and alleviated the decrease in survival rate (see Figure 1 ).

[0126] Example 2: 1,3-Butanediol inhibits pulmonary fibrosis phenotype

[0127] Following the same grouping, modeling, and dosing regimen as in Example 1, this example further performed lung function testing, imaging, and histopathological observations on day 21 of modeling to confirm the therapeutic effect of 1,3-butanediol on pulmonary fibrosis. Specific results are as follows:

[0128] Figure 2The results of pulmonary function tests comprehensively characterized the lung physiological status of mice in the different treatment groups. PV loop pressure-volume control step curves revealed that compared with the normal control group, the model group had a significant decrease in lung capacity at the same airway pressure, indicating impaired lung compliance. The curves in the treatment group shifted upward overall, demonstrating a significant improvement in lung compliance. Further analysis of multiple pulmonary function parameters revealed that the model group exhibited significant abnormalities, including increased airway resistance (including large airway resistance and respiratory system resistance), increased tissue damping, increased tissue elastance, increased respiratory system elastance, decreased compliance (e.g., static compliance), decreased deep inspiratory volume, and decreased forced vital capacity, reflecting typical impaired lung function. In contrast, the treatment group showed significant improvements in key indicators such as static compliance, deep inspiratory volume, and forced vital capacity, while airway resistance, respiratory system elastance, tissue damping, and tissue elastance all decreased significantly. This suggests that 1,3-butanediol intervention significantly alleviated mechanical obstruction in the airways and lung parenchyma, improving lung ventilation and compliance. In summary, the role of 1,3-butanediol in improving lung tissue structure and inhibiting pulmonary fibrosis was further confirmed from a functional level.

[0129] Figure 3 The lung imaging changes of mice in different treatment groups were shown. Figure 3 As shown in Figure a, the normal control group exhibited good lung tissue transparency and clear structure, with open airways and no abnormal shadows. In contrast, the model group exhibited significant increased lung parenchymal density, large patches of ground-glass opacities, and disturbed lung markings, suggesting extensive pulmonary fibrosis, alveolar collapse, and interstitial hyperplasia. In contrast, the treatment group (i.e., the 1,3-butanediol-treated group) showed a significant decrease in lung density, clearer lung markings, and a reduction in the extent of consolidation, suggesting that the drug effectively alleviated pathological thickening and inflammatory exudates in the lung parenchyma. Figure 3 The three-dimensional reconstruction in (b) further validates these findings at a structural level. The model group showed collapsed, irregular lung tissue contours, increased solid areas, and a significant decrease in lung volume. In contrast, the treatment group (i.e., the 1,3-butanediol-treated group) showed relatively intact, well-expanded lung lobe structures on both the ventral and dorsal sides, with reduced solid tissue, suggesting recovery of lung volume and gas exchange function. In summary, 1,3-butanediol significantly reduced lung inflammation and fibrosis at the imaging level, improved lung structural integrity and functional status, and further supports its potential therapeutic effect in the intervention of pulmonary fibrosis.

[0130] Figure 4Representative pathological staining images of the lung tissues of mice in the normal control group, model group, and treatment group are shown, including Masson trichrome staining, hematoxylin-eosin (H&E) staining, and Sirius red staining, which were used to evaluate the degree of lung fibrosis, tissue structural changes, and collagen deposition. Masson staining results showed that a large amount of blue collagen deposition was present in the lung tissue of the model group, indicating significant fibrotic changes. After treatment with 1,3-butanediol, the blue area was significantly reduced, and the lung tissue structure was more intact, indicating that the degree of fibrosis was significantly alleviated ( Figure 4 (a) H&E staining results showed that the alveolar wall in the model group was significantly thickened, structurally disordered, and accompanied by a large number of inflammatory cell infiltration, showing severe inflammatory damage. However, 1,3-butanediol intervention significantly reduced alveolar structural damage and inflammatory cell aggregation, and the lung tissue returned to normal morphology ( Figure 4 Sirius red staining results showed that a large amount of red and yellow interwoven collagen deposition in the lung tissue of the model group indicated abnormal accumulation of type I and type III collagen, while the deposition area and degree in the treatment group were significantly reduced, further verifying the inhibitory effect of 1,3-butanediol on pulmonary fibrosis ( Figure 4 Middle c). Figure 4 The quantitative analysis results in the middle d showed that the Ashcroft fibrosis score of the control group was close to 0, while the score of the model group was significantly increased, indicating that there were obvious fibrotic changes in the lung tissue. In contrast, the Ashcroft score of the 1,3-butanediol-treated group was reduced by about 50% compared with the model group ( : P<0.0001), indicating that the degree of fibrosis was significantly alleviated, suggesting that 1,3-butanediol has a significant effect in reducing the pathological degree of pulmonary fibrosis. Figure 5 Representative immunofluorescence staining images of SPC, Ki67, and PDPN in lung tissue from mice in the normal control, model, and 1,3-butanediol-treated groups (n = 6; scale bar, 20 μm) are shown to assess the regenerative and repair status of alveolar epithelial cells. Immunofluorescence analysis revealed that 1,3-butanediol treatment significantly alleviated AT2 cell depletion and promoted alveolar repair. Specifically, the proportion of Ki67- and pro-SPC-positive cells relative to total pro-SPC-positive cells in the 1,3-butanediol group was significantly higher than in the model group, suggesting that 1,3-butanediol significantly enhanced the proliferation of AT2 cells. Furthermore, the number of PDPN-positive AT1 cells and pro-SPC-positive AT2 cells in the model group was significantly reduced, while 1,3-butanediol treatment partially restored these reductions, further supporting its role in promoting AT2 cell proliferation and maintaining a stable AT1 cell population, contributing to alveolar structural repair and improved lung function. These results confirm the positive role of 1,3-butanediol in promoting alveolar epithelial cell regeneration in ameliorating pulmonary fibrosis at the cellular level.

[0131] Example 3: Molecular Verification of 1,3-Butanediol's Inhibition of Pulmonary Fibrosis

[0132] This example examined the expression changes of key molecules related to pulmonary fibrosis at the molecular level on day 21 of modeling. The specific results are as follows:

[0133] Molecular level analysis Figure 6 As shown, quantitative reverse transcription PCR (RT–qPCR) results indicated that fibronectin 1 (Fn1) mRNA expression levels in the model group were significantly elevated compared to the housekeeping gene 18S, and 1,3-butanediol treatment significantly inhibited the overexpression of these genes. Further immunoblotting (Western blot) results showed that FN1 protein expression levels were significantly elevated in the lung tissues of model mice on day 21. 1,3-butanediol treatment significantly reduced the fibrosis-induced upregulation of FN1 protein, suggesting that it exerts an anti-fibrotic effect at the molecular level.

[0134] Example 4: Study on the Genetic Pathway of 1,3-Butanediol Inhibiting Pulmonary Fibrosis

[0135] This example detects changes in gene pathways at the 21st day of modeling from the gene pathway level.

[0136] Figure 7 The results of GO enrichment analysis are shown, comparing the biological processes involved in the differentially expressed genes (DEGs) between the normal control group and the pulmonary fibrosis model group (a) and between the pulmonary fibrosis model group and the 1,3-butanediol treatment group (b), respectively. The screening criteria were adjusted P value < 0.05 and |logFC| > log2. Figure 7 Figure a in the middle shows that during the development of fibrosis, the upregulated GO pathways mainly involve cell-matrix adhesion, tissue remodeling, collagen metabolism, inflammatory response regulation, and extracellular cyst structure organization, suggesting abnormal activation of genes related to extracellular matrix remodeling, signal transduction, and cell motility during fibrosis; while the downregulated GO pathways are enriched in respiratory system development, lung epithelial development, and epithelial cell proliferation, reflecting the significant impairment of lung tissue regeneration and repair capacity under fibrotic conditions. Figure 7 Figure b shows that significantly upregulated GO pathways after 1,3-butanediol treatment include lipid metabolism and transport regulation, fatty acid metabolism, and epithelial cell proliferation, suggesting that it can promote metabolic reprogramming and support lung epithelial repair. Downregulated pathways involve extracellular matrix organization, collagen fibrillogenesis, and inflammatory response regulation, consistent with anti-fibrotic and anti-inflammatory mechanisms. In summary, this GO analysis reveals the potential mechanism by which 1,3-butanediol exerts its anti-fibrotic effects at the transcriptional level by regulating lipid metabolism, inhibiting matrix deposition, and restoring alveolar epithelial function.

[0137] Example 5: Metabolic Study of 1,3-Butanediol Inhibiting Pulmonary Fibrosis

[0138] This example detects the changes in lipid metabolism in lung tissue on the 21st day of modeling from a metabolic perspective.

[0139] Figure 8 The changes in lipid metabolism in the lung tissues of mice in the normal control group, model group and 1,3-butanediol treatment group were demonstrated, further revealing its potential anti-fibrosis mechanism. Figure 8 Figure a shows the absolute quantitative analysis results of representative lipids, including cholesterol, cholesterol esters (CE 18:2, CE 18:3, CE 19:0), ceramides (Cer d17:1 / 26:0, Cer d18:2 / 26:0), sphingomyelins (SM d18:1 / 17:1, SM d18:1 / 20:2, SM d18:1 / 24:2), and lysophospholipids (LPCe 15:0, LPCe 18:2, LPC 26:2), which are closely related to inflammation and fibrosis. Figure 8 Figure b shows a heatmap of differentially expressed lipids identified by targeted lipidomics (n = 5). This heatmap shows that in a pulmonary fibrosis model, levels of multiple proinflammatory lipids (including ceramides, sphingomyelins, and lysophospholipids) are significantly elevated, suggesting that these lipids may accelerate lung tissue damage and fibrosis progression by promoting alveolar epithelial cell apoptosis, enhancing vascular permeability, and activating fibroblast migration. Treatment with 1,3-butanediol significantly inhibited the accumulation of these lipids, reducing the burden of proinflammatory mediators and demonstrating a clear antifibrotic effect. Further analysis revealed that cholesterol esters, a storage form of cholesterol, were significantly elevated in the fibrosis group. 1,3-butanediol reduced total cholesterol and its esterification products (such as CE 18:2, CE 18:3, and CE 19:0) by approximately 30%, suggesting that it promotes fatty acid oxidation, enhances downstream pathways of cholesterol biosynthesis, and inhibits the abnormal accumulation of free cholesterol and cholesterol esters. In summary, 1,3-butanediol regulates cholesterol homeostasis, reduces the accumulation of pro-inflammatory lipids, inhibits the activation of fibrosis-related pathways at the metabolic level, and plays a role in alleviating the progression of pulmonary fibrosis.

[0140] Example 6: Study on the mechanism of 1,3-butanediol inhibiting pulmonary fibrosis

[0141] To elucidate the inhibitory effect of 1,3-butanediol on pulmonary fibrosis (PF) and its potential mechanism, single-cell transcriptome sequencing (scRNA-seq) was performed on whole lung tissue samples of mice in the normal control group, model group (21 days after modeling), and treatment group (21 days after modeling).

[0142] After quality control and double cell removal, scRNA-seq data from 104,802 cells were obtained (a). Based on classic cell lineage markers, seven major cell populations were identified: 18,419 NK / T cells ( Cd3d 、 Cd3e and Nkg7 ), 12,164 stromal cells ( Col1a1 ), 3,181 epithelial cells ( Epcam ), 6,551 endothelial cells ( Pecam1 ), 28,335 macrophages / monocytes ( Ear1 、 Cx3cr1 、 C1q and Flt3 ), 19,038 B cells ( Cd79a ) and 17,114 neutrophils ( Csf3r )( Figure 9 Each group contained three biological replicates ( Figure 9 In c, d, the relative abundance of the above cell populations in different groups and disease stages is presented ( Figure 9 (e, f).

[0143] In idiopathic pulmonary fibrosis (IPF), alveolar epithelial cells are repeatedly damaged, resulting in impaired regenerative capacity of alveolar type II epithelial cells (AT2), thereby destroying the structural integrity and barrier function of the alveolar epithelium. Fibroblasts are abnormally activated during the fibrosis process and differentiate into myofibroblasts, which leads to excessive extracellular matrix (ECM) deposition and fibrotic remodeling of lung tissue. Macrophages shape the inflammatory and fibrotic microenvironment by polarizing to classical (M1) and alternative (M2) types. Therefore, AT2 cells, fibroblasts and macrophages, as three types of cells that play a key role in the occurrence and progression of IPF, have become the core focus of research and therapeutic intervention on the disease. This example further analyzed epithelial cells (AT2), stromal cells (fibroblasts) and macrophages, and the results are as follows: Figure 10-12 As shown, specifically:

[0144] Figure 10 The results revealed the potential mechanism of 1,3-butanediol in regulating the composition and functional status of macrophage subsets in the process of pulmonary fibrosis. UMAP clustering results showed that among the 28,335 macrophages and monocytes, they could be clearly divided into functional subsets such as alveolar macrophages (AM), interstitial macrophages (IM) and monocytes ( Figure 10 Further functional subtype analysis showed that 1,3-butanediol significantly upregulated lipid and cholesterol metabolism-related pathways in AM, including key genes for fatty acid oxidation (e.g. Prkaa1 、 Cpt1a 、 Acox1 、 Acox3 ) and cholesterol synthesis pathway genes (e.g. Srebf2 、 Hmgcr 、 Fdps )( Figure 10 (c) and simultaneously inhibited pathways related to inflammation and immune response, suggesting that it alleviated the pro-inflammatory phenotype of AM by improving metabolic homeostasis.

[0145] In addition to being divided into AM and IM according to anatomical location, lung macrophages can also be polarized according to their functional status during the process of pulmonary fibrosis, differentiating into classically activated (M1 type) or alternatively activated (M2 type) macrophages. M1 type macrophages enhance the immune response by secreting proinflammatory cytokines and chemokines, while M2 type macrophages exhibit a typical profibrotic phenotype by activating fibroblasts and promoting extracellular matrix (ECM) deposition. These two functional subtypes play a key role in maintaining lung homeostasis and regulating tissue remodeling. Therefore, the study further constructed an M1 / M2 scoring system based on a representative gene set ( Figure 10 d), and carried out a pseudo-time series trajectory analysis ( Figure 10 The results showed that there was a clear trend of M1-to-M2-like polarization in the fibrosis group, accompanied by the expression of pro-fibrotic genes (such as Spp1 、 Fn1 、 Ctsd ) and lipid metabolism regulators (e.g. Lpl ) expression was elevated ( Figure 10 (f) However, in the 1,3-butanediol-treated group, this conversion process was significantly attenuated, suggesting that it may slow the progression of pulmonary fibrosis by inhibiting excessive M2-like polarization and reducing excessive ECM deposition. Taken together, these results suggest that 1,3-butanediol effectively intervenes in the macrophage-driven profibrotic process by regulating the metabolic state and functional polarization of AMs, exerting a significant anti-fibrotic effect at the cellular level.

[0146] Figure 11 The results showed that 1,3-butanediol plays a key role in improving the recovery and functional regulation of epithelial cells, especially AT2 cells, in pulmonary fibrosis. In the UMAP cluster analysis, a total of six epithelial cell subpopulations were identified, including AT1 cells, AT2 cells, intermediate cells expressing AT1 and AT2 markers, as well as club cells, ciliated cells and neuroendocrine cells ( Figure 11 Further analysis revealed that the proportion of AT2 cells decreased significantly in the model group, but recovered significantly in the 1,3-butanediol intervention group, suggesting a potential role for AT2 cells in promoting alveolar repair.

[0147] GO functional enrichment analysis showed that the differentially expressed genes in AT2 cells of the treatment group were significantly enriched in pathways such as cholesterol metabolism, lipid synthesis and lipid homeostasis, while pathways related to epithelial cell apoptosis and inhibition of proliferation were downregulated ( Figure 11 Representative genes related to these pathways were significantly upregulated in the treatment group, including cholesterol biosynthesis genes. Zbtb20 , cholesterol esterification gene Soat1 , and fatty acid oxidation-related genes Acsl4 and Acox1 , suggesting that 1,3-butanediol can enhance the lipid metabolism activity of AT2 cells. In addition, the pro-fibrotic genes significantly upregulated in the state of pulmonary fibrosis S100a8 and S100a9 , which was significantly inhibited in the treatment group, further supporting its anti-fibrotic effect at the cellular level ( Figure 11 (d)

[0148] The above results were combined with immunofluorescence analysis ( Figure 7 ), indicating that 1,3-butanediol plays an important protective role in the intervention of pulmonary fibrosis by enhancing the proliferation ability and lipid metabolism activity of AT2 cells and partially restoring the number of AT1 cells, promoting the regeneration of alveolar structure and functional recovery at the cellular level.

[0149] Figure 12 The results revealed the important role of 1,3-butanediol in regulating the fate transition of fibroblasts, inhibiting the progression of fibrosis and promoting lung repair. In the UMAP cluster analysis of 12,164 stromal cells, four major subpopulations were identified, including fibroblasts ( Col13a1 、 Col14a1 ), myofibroblasts ( Acta2 、 Tagln ), mesothelial cells ( Msln ) and smooth muscle cells ( Smpx )( Figure 12 In the pulmonary fibrosis model, the proportion of fibroblasts decreased significantly by approximately 47%, while the proportion of myofibroblasts increased significantly, suggesting that the fibrosis process is accompanied by the phenotypic transition of fibroblasts to myofibroblasts ( Figure 12 After intervention with 1,3-butanediol, the proportion of fibroblasts increased by approximately 70% compared with the fibrosis group and returned to a level close to the baseline, suggesting that it has the effect of inhibiting the expansion of myofibroblasts and promoting interstitial remodeling ( Figure 12 Middle c).

[0150] GO functional enrichment analysis showed that the differentially expressed genes in the treated group fibroblasts were significantly enriched in pathways such as epithelial repair, lipid metabolism, and cholesterol biosynthesis, suggesting that 1,3-butanediol can activate the tissue repair function of fibroblasts through metabolic reprogramming ( Figure 12 (middle d). Pseudo-temporal trajectory analysis showed that fibrosis significantly promoted the transformation of fibroblasts into myofibroblasts, while 1,3-butanediol intervention effectively preserved the fibroblast state and inhibited its differentiation into myofibroblasts, suggesting that it can slow down the progression of fibrosis by intervening in the cell fate trajectory ( Figure 12 Middle e).

[0151] Expression analysis of representative genes further supports the above mechanism ( Figure 12 Middle f): Profibrotic genes Tgfbi 、 Tgfbr3 and Spp1 In the treatment group, these genes were significantly downregulated, which promoted the proliferation, activation and ECM deposition of fibroblasts in fibrosis; while the anti-fibrotic genes Bmp4 (inhibit fibroblast differentiation) and support AT2 cell survival Rcn3 It was suppressed in the fibrosis group but restored after 1,3-butanediol treatment. In addition, the treatment group also significantly upregulated cholesterol synthesis-related genes. Srebf2 、 Hmgcr and fatty acid β-oxidation-related genes Cpt1a , suggesting that 1,3-butanediol plays multiple roles in promoting metabolic homeostasis and inhibiting the progression of fibrosis.

[0152] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0153] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. Use of 1,3-butanediol as the sole active ingredient in the preparation of a medicament for preventing and / or treating pulmonary fibrosis, wherein the pulmonary fibrosis is idiopathic pulmonary fibrosis.

2. The use according to claim 1, characterized in that The 1,3-butanediol prevents and / or treats pulmonary fibrosis through any one or a combination of two or more of the following pathways: A) Inhibit macrophage polarization toward M2 macrophages; B) Enhance the proliferation of AT2 cells and promote alveolar repair; C) Restoration of AT1 cell population; D) regulate lipid metabolism; E) inhibiting the differentiation of fibroblasts into myofibroblasts; F) Reduce the level of FN1 protein.

3. The use according to claim 2, characterized in that A) includes inhibiting the polarization of M1 macrophages to M2 macrophages.

4. The use according to claim 2, characterized in that D) Regulation of lipid metabolism includes: a) reducing the level of one or more of ceramide, sphingomyelin and / or lysophospholipids; and / or, b) Lowering the levels of cholesterol and / or cholesterol esters.

5. The use according to claim 1, characterized in that The 1,3-butanediol prevents and / or treats pulmonary fibrosis by enhancing the lipid metabolism activity of AT2 cells.

6. The use according to claim 1, characterized in that The medicine comprises 1,3-butanediol and pharmaceutically acceptable excipients.

7. The use according to claim 6, characterized in that The pharmaceutically acceptable excipients include one or more of solvents, diluents, adhesives, lubricants, humectants, emulsifiers, preservatives, antioxidants, buffers, antibacterial agents, disintegrants, surfactants, suspending agents, suspending aids, solubilizers, thickeners, stabilizers, sweeteners or flavorings.

Images