Establishment method of salmonella pullorum challenge model
By pretreating the chicken embryos with chitosan and injecting Salmonella leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leucosmic leu
Patent Information
- Application Number
- CN202510466992.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-04-15
AI Technical Summary
The existing method for establishing Salmonella dysentery model of chickens has the problem of high mortality, low infection rate and inconsistent onset time of chicks, making it difficult to simulate clinical infection patterns and control experimental variables.
Chitosan solution was used to pretreat chicken embryos and inject Salmonella leucoderma leucoderma through the air chamber to control the infection speed and intensity, simulate the clinical infection pattern, and improve the consistency of the survival rate and onset time of chicks.
It reduces the mortality rate of chicks, improves the consistency of infection rate and onset time, and ensures the comparability and consistency of drug experimental results.
Smart Images

Figure CN120267709A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological medicine technology, and particularly relates to a method for establishing a Salmonella pullorum challenge model. Background Art
[0002] In the process of drug research, animal disease models are important carriers for drug research and disease research. Among them, the establishment of a Salmonella pullorum disease model is of great significance for the research and development of drugs for effectively preventing and treating Salmonella pullorum disease.
[0003] At present, there are various methods for establishing a Salmonella pullorum model, mainly including artificial infection by oral gavage, intraperitoneal injection, and subcutaneous injection, and mostly using chicks at 4 - 7 days old and above as experimental subjects. For these methods of establishing challenge models, the inventor believes that the following technical problems exist: (1) The injection challenge method does not conform to the infection mode of clinical Salmonella pullorum, and intraperitoneal injection can cause acute bacteremia, easily resulting in a large number of acute deaths of challenged chicks and accidental deaths caused by operations; while the incidence of subcutaneous injection is relatively low, and usually only some chicks start to get sick 2 - 3 days after challenge, with uneven symptoms and inconsistent onset times, and the modeling effect is not obvious; (2) Using the method of oral gavage for artificial infection conforms to the infection mode of clinical Salmonella pullorum to a certain extent. Only a few chicks show symptoms of Salmonella pullorum 12 hours later, and more than 80% of the chicks start to get sick 72 hours after chick infection. The onset times are not uniform, and the effective administration time cannot be determined.
[0004] Therefore, how to solve the above technical problems and design a challenge model method for Salmonella pullorum with low chick mortality, high infection rate, and uniform onset time is a technical problem currently faced by those of ordinary skill in the art.
[0005] The information disclosed in this background art section is only intended to enhance the overall understanding of the present invention and should not be regarded as an admission or any form of implication that this information constitutes prior art already known to those of ordinary skill in the art. Summary of the Invention
[0006] In view of the above technical problems, an embodiment of the present invention provides a method for establishing a Salmonella pullorum challenge model to solve the problems raised in the above background art.
[0007] I. The design idea of the present invention is as follows: (1)Research has found that chitosan can inhibit the rapid reproduction and endotoxin production of Salmonella pullorum; this effect of chitosan can prevent Salmonella pullorum from multiplying too quickly when attacking chicken embryos and reduce the production of endotoxins; by slowing down the reproduction of Salmonella and the production of endotoxins, chitosan helps to mitigate the negative impact on the development of chicken embryos, thus contributing to improving the controllability and success rate of the experiment; (2)The research also found that chitosan can change the permeability of cell membranes and slowly guide Salmonella into chicken embryos; in this way, chitosan allows Salmonella pullorum to enter the embryo through the shell membrane of the chicken embryo at a slower rate, so that the infection process of Salmonella is more controllable, can simulate the mode of clinical infection, and avoid too fast or unnatural infection caused by other infection methods (such as injection), and thus is more in line with the actual clinical pathological process; (3)Moreover, chitosan can enhance the immune function of the body, which is crucial for the hatching of chicken embryos and the survival of chicks; the immunomodulatory effect of chitosan can improve the hatching rate of chicken embryos, and thus increase the survival rate of chicks; this not only helps to improve the stability of the model, but also can reduce the mortality rate of chicks in the experiment, thereby ensuring the successful establishment of the challenge model; (4)Due to the above effects of chitosan, after the challenged chicken embryos hatch into chicks, they can show disease symptoms within a relatively unified time; compared with other methods, chitosan regulates the speed and intensity of the Salmonella infection process, making the hatched chicks show consistent clinical symptoms (such as the onset time, incidence rate, etc.) within a certain time window; this unified onset time is crucial for drug experiments because it can better control the experimental variables and ensure the comparability and consistency of the test results of drugs on different chicks.
[0008] II. A method for establishing a Salmonella pullorum challenge model for chickens, comprising the following steps: Take 12-day-old chicken embryos and inject a chitosan oligosaccharide solution into the air chamber of the chicken embryos; Place the chicken embryos injected with the chitosan oligosaccharide solution in an incubator and incubate them until they reach 14 days old; Inject Salmonella pullorum into the air chamber of the 14-day-old chicken embryos for challenge; After the chicken embryos are challenged, place them in an incubator and continue to incubate them until they reach 21 days old; After the chicken embryos are incubated to 21 days old and hatch into chicks, establish a challenge model.
[0009] Preferably, in the step of injecting the chitosan oligosaccharide solution into the air chamber of the chicken embryos, the volume of the chitosan oligosaccharide solution injected into the air chamber of the chicken embryos is 0.2 mL, and the mass concentration of the chitosan oligosaccharide solution is 0.8% - 1.2%.
[0010] Preferably, the mass concentration of the chitosan oligosaccharide solution is 1%.
[0011] Preferably, in the step of injecting the chitosan oligosaccharide solution into the air chamber of the chicken embryo, before injecting the chitosan oligosaccharide solution into the air chamber of the chicken embryo, it is sterilized at 121 °C for 30 min in advance.
[0012] Preferably, in the step of injecting Salmonella pullorum into the air chamber of a 14-day-old chicken embryo for challenge, the volume of the Salmonella pullorum solution injected into the air chamber of the chicken embryo is 0.1 mL, and the concentration of the Salmonella pullorum solution is 10 4 cfu / mL - 10 6 cfu / mL.
[0013] Preferably, the concentration of the Salmonella pullorum solution is 10 5 cfu / mL.
[0014] Preferably, in the step of injecting Salmonella pullorum into the air chamber of a 14-day-old chicken embryo for challenge, the strain of Salmonella pullorum used is Salmonella pullorum CVCC533.
[0015] Preferably, in the step of establishing a challenge model after the chicken embryo hatches into a chick at 21 days of age, the chick will be infected with Salmonella pullorum within 24 h after hatching to establish a challenge model.
[0016] Preferably, after the challenge model is established, positive detection of the chick infected with Salmonella pullorum is required. During the positive detection, an anal swab is used for sampling and PCR is used for detection.
[0017] Preferably, the PCR detection primers for Salmonella include: the forward primer sequence shown in SEQ ID NO.1 and the reverse primer sequence shown in SEQ ID NO.2; specifically, the sequence of SEQ ID NO.1 is: GTGAAATTATCGCCACGTTCGGGCAA; the sequence of SEQ ID NO.2 is: TCATCGCACCGTCAAAGGAACC.
[0018] The PCR detection primers for Salmonella pullorum CVCC533 include: the forward primer sequence shown in SEQ ID NO.3 and the reverse primer sequence shown in SEQ ID NO.4; specifically, the sequence of SEQ ID NO.3 is: TTATGTTACGGGACGAGTG; the sequence of SEQ ID NO.4 is: CAAGACTCCCTGCCCTAT.
[0019] A method for establishing a Salmonella pullorum challenge model provided by an embodiment of the present invention has the following beneficial effects: The method of the challenge model is creatively optimized in the present invention, and the optimal injection concentration of the chitosan solution and the challenge concentration of Salmonella pullorum are screened; By establishing a Salmonella pullorum challenge model with the method of the present invention, the highest morbidity rate and chick survival rate of chicks can be controlled after 24 hours, and the onset time can be guaranteed to be unified. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 It is the result of liver pathological tissue section.
[0021] Figure 2 It is the result of spleen pathological tissue section.
[0022] Figure 3 It is the result of kidney pathological tissue section. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0023] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts belong to the protection scope of the present invention.
[0024] In view of the above technical problems, an embodiment of the present invention provides a method for establishing a Salmonella pullorum challenge model to solve the problems raised in the above background technology.
[0025] Example 1: Chitosan Concentration Optimization Experiment Experimental grouping: Different groups are set in the experiment, with 20 chicken embryos in each group. The specific grouping method is as shown in Table 1 below; Experimental method: Using 12-day-old chicken embryos, first inject 0.2 mL of chitosan oligosaccharide solution (sterilized at 121 °C for 30 min) into the air chamber, place it in the incubator, and wait until the 14th day of age before challenging. Inject 0.1 mL of Salmonella pullorum CVCC533 (10 5 cfu / mL) into the air chamber. After challenging, place the chicken embryos in the incubator. After hatching at the 21st day of age, count the number of dead embryos, record the state of the chicks after hatching, observe the mental state, anus, feces, etc. of the chicken flock after normal feeding, and collect anal swab samples to detect the positive rate of Salmonella pullorum CVCC533.
[0026] Table 1 Experimental grouping
[0027] Example 2: Challenge Concentration Optimization Experiment Experimental grouping: Different groups are set in the experiment, with 20 chicken embryos in each group. The specific grouping method is as shown in Table 2 below; Experimental method: 12-day-old chicken embryos were used. First, 0.2 mL of 1.0% chitosan oligosaccharide solution (sterilized at 121 °C for 30 min) was injected into the air chamber, and then placed in an incubator. At 14 days old, challenge was carried out. 0.1 mL of Salmonella pullorum CVCC533 was injected into the air chamber. After challenge, the chicken embryos were placed back into the incubator. After hatching at 21 days old, the number of dead embryos was counted, and the status of the hatched chicks was recorded. After normal feeding, the mental state, anus, feces, etc. of the chicken flock were observed, and anal swab samples were taken to detect the positive rate of Salmonella pullorum CVCC533.
[0028] Table 2 Experimental grouping
[0029] Example 3: Detection method for Salmonella pullorum CVCC533 Detection was carried out by PCR method. An anal swab was dipped into SC medium, used to wipe the anus, and then placed in SC medium for enrichment culture for 16 - 24 h. Then PCR was used for detection. The primer sequences are shown in Table 3 below, including two pairs of primers for Salmonella and Salmonella pullorum CVCC533. The PCR reaction conditions for Salmonella pullorum CVCC533 are shown in Table 4 below, and the PCR reaction conditions for Salmonella are shown in Table 5 below.
[0030] Table 3 Primer sequences
[0031] Table 4 PCR reaction conditions for Salmonella pullorum CVCC533
[0032] Table 5 PCR reaction conditions for Salmonella
[0033] The PCR products were detected by 1% agarose gel electrophoresis; the result judgment criterion: when both target bands appear, it is judged as positive.
[0034] Example 4: Statistical analysis of experimental results The statistical analysis of experimental results is shown in Table 6 and Table 7 below.
[0035] Table 6: Optimization of chitosan concentration
[0036] Table 7: Optimization of challenge concentration
[0037] Based on the above data on hatchability, morbidity, mortality, and infection duration, the best results were obtained when the chitosan concentration was 1% and the challenge concentration of Salmonella pullorum CVCC533 was 0.1 mL (10 5 cfu / mL); at this concentration, the morbidity of chicks was the highest 24 hours after inoculation, the onset time was uniform, and the survival rate of chicks was relatively high.
[0038] Example 5: Pathological tissue sections After dissecting the chicks in Group 4, pathological tissue sections were made, and the results are as Figures 1 - 3 shown.
[0039] Figure 1 The left figure shows that at low magnification, the hepatic lobule structure is unclear, there are multiple focal necroses, and there is infiltration of inflammatory cells around the necrotic foci (100× HE); Figure 1 The right figure shows that at high magnification, the hepatic cord structure is unclear, there are a large number of heterophilic granulocytes infiltrating in the necrotic foci, there are a large number of lymphocytes infiltrating around, and the hepatocytes are significantly swollen (200× HE).
[0040] Figure 2 The left figure shows that at low magnification, the boundary between the red pulp and white pulp of the spleen is unclear (100× HE); Figure 2 The right figure shows that at high magnification, the number of parenchymal cells in the white pulp is relatively small (200× HE).
[0041] Figure 3 The left figure shows that at low magnification, the glomeruli are swollen and fill the entire capsule cavity, and some renal tubules are occluded (200× HE); Figure 3 The right figure shows that at high magnification, the renal tubular epithelial cells are swollen and the lumen of the renal tubules is narrowed (200× HE).
[0042] Through the observation of pathological tissue sections of the liver, spleen, and kidney, pathological features after infection were found in all three organs, indicating that the method for establishing the Salmonella pullorum CVCC533 model is effective.
[0043] In summary, chick dissection and flock status: In the dissected challenged group of dead chicks, liver hemorrhage or congestion, gallbladder enlargement, cecum enlargement, poor yolk absorption, and the content being yellow-green and cheesy were all visible in the suspected dead chicks of Salmonella pullorum.
[0044] After hatching, in the blank control group, no symptoms of Salmonella pullorum disease occurred in chicks. In the other model groups, except for the chicks that died acutely without observing clinical symptoms, all showed clinical symptoms of Salmonella pullorum such as discharging grayish-white loose feces, listlessness, ruffled feathers, fear of cold and huddling together, and grayish-white feces sticking to the anus 24 hours after inoculation.
[0045] The chick embryo infection model established by this method can obtain results consistent with clinical symptoms. Moreover, through the protective effect of chitosan oligosaccharide, the dead embryo rate can be reduced, the hatching rate can be increased. Although the hatched chicks are bacterium-carrying, their survival rate is relatively high, and the symptom onset time is consistent. Clinical symptoms of pullorum disease such as pulling grayish-white loose stools appear after 24 h, and the disease duration is long, lasting up to 196 h, with a high incidence rate of 88.89%. A stable and effective chick embryo infection model of Salmonella pullorum CVCC533 can be established.
[0046] The embodiments described above are only used to describe the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A method for establishing a Salmonella pullorum challenge model, characterized in that, It includes the following steps: Take 12-day-old chicken embryos and inject a chitosan oligosaccharide solution into the air chambers of the chicken embryos; Place the chicken embryos injected with the chitosan oligosaccharide solution in an incubator and incubate them until they reach 14 days old; Inject Salmonella pullorum into the air chambers of the 14-day-old chicken embryos for challenge; After the chicken embryos are challenged, place them in the incubator and continue to incubate them until they reach 21 days old; After the chicken embryos incubate to 21 days old and hatch into chicks, establish a challenge model.
2. The method for establishing a Salmonella pullorum challenge model according to claim 1, characterized in that, In the step of injecting the chitosan oligosaccharide solution into the air chamber of the chicken embryo, the volume of the chitosan oligosaccharide solution injected into the air chamber of the chicken embryo is 0.2 mL, and the mass concentration of the chitosan oligosaccharide solution is 0.8%-1.2%.
3. The method for establishing a Salmonella pullorum challenge model according to claim 2, wherein, The mass concentration of the chitosan oligosaccharide solution is 1%.
4. The method for establishing a Salmonella pullorum challenge model according to claim 1, characterized in that, In the step of injecting the chitosan oligosaccharide solution into the air chamber of the chicken embryo, before injecting the chitosan oligosaccharide solution into the air chamber of the chicken embryo, it is pre-sterilized at 121°C for 30 min.
5. The method for establishing a Salmonella pullorum challenge model according to claim 1, characterized in that, In the step of injecting Salmonella pullorum into the air chamber of 14-day-old chicken embryos for challenge, the volume of the Salmonella pullorum solution injected into the air chamber of the chicken embryos is 0.1 mL, and the concentration of the Salmonella pullorum solution is 10 4 cfu / mL - 10 6 cfu / mL.
6. The method for establishing a Salmonella pullorum challenge model according to claim 5, characterized in that, The concentration of Salmonella pullorum solution is 10 5 cfu / mL.
7. The method for establishing a Salmonella pullorum challenge model according to claim 1, characterized in that, In the step of injecting Salmonella pullorum into the air chamber of the 14-day-old chicken embryo for challenge, the strain of Salmonella pullorum used is Salmonella pullorum CVCC533.
8. The method for establishing a Salmonella pullorum challenge model according to claim 1, wherein In the step of establishing a challenge model after the chicken embryos incubate to 21 days old and hatch into chicks, the chicks will be infected with Salmonella pullorum within 24 h after hatching to establish a challenge model.
9. The method for establishing a Salmonella pullorum challenge model according to claim 1, characterized in that, After the challenge model is established, positive detection of the chicks infected with Salmonella pullorum needs to be carried out. During the positive detection process, anal swabs are used for sampling and PCR is used for detection.
10. The method for establishing a Salmonella pullorum challenge model according to claim 9, characterized in that, The PCR detection primers for Salmonella include: the forward primer sequence shown in SEQ ID NO.1 and the reverse primer sequence shown in SEQ ID NO.2; The PCR detection primers for Salmonella pullorum CVCC533 include: the forward primer sequence shown in SEQ ID NO.3 and the reverse primer sequence shown in SEQ ID NO.4.
Citation Information
Patent Citations
Bioactive coatings and films for sanitary control and preservation of eggs.
BR102019014216A2
Method for establishing salmonella pullorum disease model
CN109486900A
Method for establishing salmonella pullorum chick embryo infection models
CN112568181A
Feed additive and application thereof
CN115812854A
Disease marker for ulcerative colitis and utilization thereof
JP2004135545A