A method for establishing a chicken salmonella pullorum challenge model

Abstract

The application discloses a method for establishing a chicken white diarrhea Salmonella typhimurium challenge model and relates to the technical field of biological medicine. The method comprises the following steps: taking 12-day-old chicken embryos and injecting a chitosan oligosaccharide solution into the air chamber of the chicken embryos; placing the chicken embryos injected with the chitosan oligosaccharide solution in an incubator to incubate until the chicken embryos are 14-day-old; injecting chicken white diarrhea Salmonella typhimurium into the air chamber of the 14-day-old chicken embryos to perform challenge; placing the chicken embryos after challenge in the incubator to continue incubation until the chicken embryos are 21-day-old; and establishing a challenge model after the chicken embryos hatch into chicks at the age of 21 days. The application creatively optimizes the method for establishing a challenge model, screens the optimal injection concentration of a chitosan solution and the challenge concentration of chicken white diarrhea Salmonella typhimurium; and the chicken white diarrhea Salmonella typhimurium challenge model established by the method can control the highest morbidity and chick survival rate of chicks after 24 hours and ensure uniform disease onset time.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to a method for establishing a chicken pullorum Salmonella challenge model. BACKGROUND

[0002] In the process of drug research, an animal disease model is an important carrier for drug research and disease research. The establishment of a chicken pullorum Salmonella disease model is of great significance for the development of drugs for effectively preventing and treating chicken pullorum Salmonella disease.

[0003] At present, there are various methods for establishing a chicken pullorum Salmonella model, mainly including oral gavage, intraperitoneal injection, and subcutaneous injection for artificial infection, and most of the test objects are 4-7-day-old and older chicks. For these methods for establishing a challenge model, the inventors believe that the following technical problems exist:

[0004] (1) The injection challenge method does not conform to the infection mode of clinical chicken pullorum, and intraperitoneal injection can cause acute bacteremia, easily causing a large number of acute deaths of challenge chicks and accidental deaths caused by operation; and the morbidity of subcutaneous injection is relatively low, and usually only part of the chicks have symptoms 2-3 days after challenge, the symptoms are not uniform, the onset time is not uniform, and the modeling effect is not obvious;

[0005] (2) The method of oral gavage for artificial infection is in line with the infection mode of clinical chicken pullorum to some extent, only a small number of chicks have chicken pullorum symptoms after 12 hours, and more than 80% of the chicks have symptoms after 72 hours of infection, the onset time is not uniform, and the effective drug administration time cannot be determined.

[0006] Therefore, how to solve the above technical problems, design a challenge model method of chicken pullorum Salmonella with low mortality of chicks, high infection rate and uniform onset time, is a technical problem faced by the general technical personnel in the field at present.

[0007] The information disclosed in this BACKGROUND section is only intended to increase an understanding of the general context in which the present application can be practiced. It is not admitted that any of the information provided in this section is prior art or relevant to the patentability of the present application. SUMMARY

[0008] In view of the above technical problems, the present application provides a method for establishing a chicken pullorum Salmonella challenge model to solve the problems in the above background.

[0009] Firstly, the design idea of the present application is as follows:

[0010] (1) The study found that chitosan can inhibit the rapid proliferation and endotoxin production of Salmonella pullorum; this effect of chitosan can prevent Salmonella pullorum from rapidly proliferating when attacking chicken embryos and reduce the production of endotoxins; by slowing down the proliferation of Salmonella and the production of endotoxins, chitosan helps to reduce the negative impact on the development of chicken embryos, thereby helping to improve the controllability and success rate of the experiment;

[0011] (2) The study also found that chitosan can change the permeability of the cell membrane and slowly guide Salmonella into the chicken embryo; in this way, chitosan allows Salmonella pullorum to enter the embryo through the shell membrane of the chicken embryo at a slower speed, so that the infection process of Salmonella is more controllable and can simulate the mode of clinical infection, avoiding the rapid or unnatural infection caused by other infection methods (such as injection), thereby being more consistent with the actual clinical pathological process;

[0012] (3) And chitosan can enhance the immune function of the body, which is crucial for the hatching of chicken embryos and the survival of chicks; the immune regulation of chitosan can improve the hatching rate of chicken embryos, thereby increasing the survival rate of chicks; this not only helps to improve the stability of the model, but also reduces the mortality rate of chicks in the experiment, thereby ensuring the successful establishment of the infection model;

[0013] (4) Due to the above effects of chitosan, the chicken embryos after infection can show symptoms of the disease within a relatively uniform time after hatching into chicks; compared with other methods, chitosan regulates the speed and intensity of Salmonella infection, so that the chicks after hatching show consistent clinical symptoms (such as the time of onset, the incidence rate, etc.) within a certain time window; this uniform onset time is crucial for drug experiments, as it can better control experimental variables and ensure that the test results of drugs on different chicks are comparable and consistent.

[0014] II. A method for establishing a Salmonella pullorum infection model, comprising the following steps:

[0015] Take 12-day-old chicken embryos and inject chitosan oligosaccharide solution into the air sac of the chicken embryo;

[0016] Place the chicken embryos injected with chitosan oligosaccharide solution in an incubator for incubation until they are 14 days old;

[0017] Inject Salmonella pullorum into the air sac of the 14-day-old chicken embryo to perform infection;

[0018] Place the chicken embryos after infection in the incubator for further incubation until they are 21 days old;

[0019] Establish the infection model after the chicken embryos are hatched into chicks at 21 days old.

[0020] Preferably, in the step of injecting the chitosan oligosaccharide solution into the air sac of the chicken embryo, the volume of the chitosan oligosaccharide solution injected into the air sac of the chicken embryo is 0.2 mL, and the mass concentration of the chitosan oligosaccharide solution is 0.8%-1.2%.

[0021] Preferably, the mass concentration of the chitosan oligosaccharide solution is 1%.

[0022] Preferably, in the step of injecting the chitosan oligosaccharide solution into the air sac of the chicken embryo, the chitosan oligosaccharide solution is sterilized at 121℃ for 30 min before being injected into the air sac of the chicken embryo.

[0023] Preferably, in the step of injecting the Salmonella pullorum into the air sac of the 14-day-old chicken embryo to perform the challenge, the volume of the Salmonella pullorum solution injected into the air sac of the chicken embryo is 0.1 mL, and the concentration of the Salmonella pullorum solution is 10 4 cfu / mL-10 6 cfu / mL.

[0024] Preferably, the concentration of the Salmonella pullorum solution is 10 5 cfu / mL.

[0025] Preferably, in the step of injecting the Salmonella pullorum into the air sac of the 14-day-old chicken embryo to perform the challenge, the strain of the Salmonella pullorum used is Salmonella pullorum CVCC533.

[0026] Preferably, in the step of establishing the challenge model after the chicken embryo is incubated to become a chick after hatching at 21 days old, the chick is infected with the Salmonella pullorum to establish the challenge model within 24 h after hatching.

[0027] Preferably, after the challenge model is established, positive detection of the infection of the chick with the Salmonella pullorum is required, and the sampling is performed by using the anal swab and the detection is performed by using PCR.

[0028] Preferably, the primers for the PCR detection of the Salmonella pullorum include a forward primer sequence as shown in SEQ ID NO. 1 and a reverse primer sequence as shown in SEQ ID NO. 2; specifically, the sequence of SEQ ID NO. 1 is GTGAAATTATCGCCACGTTCGGGCAA, and the sequence of SEQ ID NO. 2 is TCATCGCACCGTCAAAGGAACC.

[0029] The primer for PCR detection of chicken pullorum Salmonella CVCC533 includes a forward primer sequence shown as SEQ ID NO. 3 and a reverse primer sequence shown as SEQ ID NO. 4; specifically, the sequence of SEQ ID NO. 3 is TTATGTTACGGGACGAGTG, and the sequence of SEQ ID NO. 4 is CAAGACTCCCTGCCCTAT.

[0030] The method for establishing a chicken pullorum Salmonella challenge model provided by the embodiment of the present application has the following beneficial effects: the method for establishing a challenge model is creatively optimized, and the optimal injection concentration of chitosan solution and the challenge concentration of chicken pullorum Salmonella are screened; the chicken pullorum Salmonella challenge model is built by the method, the highest morbidity and survival rate of chicks can be controlled after 24 hours, and the onset time can be ensured to be uniform. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 The result of the pathological tissue section of the liver is shown.

[0032] Figure 2 The result of the pathological tissue section of the spleen is shown.

[0033] Figure 3 The result of the pathological tissue section of the kidney is shown. DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the present application.

[0035] To solve the problems in the background art, the embodiment of the present application provides a method for establishing a chicken pullorum Salmonella challenge model.

[0036] Embodiment 1: chitosan concentration optimization experiment

[0037] Experimental grouping: different groups are set in the experiment, and each group has 20 chicken embryos. The specific grouping method is shown in Table 1.

[0038] Experimental method: 12-day-old chicken embryos are used. First, 0.2 mL of chitosan oligosaccharide solution (121℃, 30min sterilization) is injected into the air chamber, and then the air chamber is placed in the incubator. When the chicken embryos are 14 days old, the challenge is performed, and 0.1 mL of chicken pullorum Salmonella CVCC533 (10 5The chicken embryos were placed in the incubator after the challenge, and the number of dead embryos was counted after hatching at 21 days of age. The state of the chicks after hatching was recorded, and the mental state, anus, feces, etc. of the chicken group were observed after normal feeding. Anus swab sampling was performed, and the positive rate of chicken pullorum Salmonella CVCC533 was detected.

[0039] Table 1 experimental grouping

[0040]

[0041] Example 2: Challenge concentration optimization experiment

[0042] Experimental grouping: different groups were set in the experiment, 20 chicken embryos in each group, and the specific grouping method was as follows Table 2;

[0043] Experimental method: 12-day-old chicken embryos were used. First, 0.2 mL of 1.0% chitosan oligosaccharide solution (121℃, 30min sterilization) was injected into the air chamber, and then placed in the incubator. At 14 days of age, the challenge was performed, and 0.1 mL of chicken pullorum Salmonella CVCC533 was injected into the air chamber. After the challenge, the chicken embryos were placed in the incubator, and the number of dead embryos was counted after hatching at 21 days of age. The state of the chicks after hatching was recorded, and the mental state, anus, feces, etc. of the chicken group were observed after normal feeding. Anus swab sampling was performed, and the positive rate of chicken pullorum Salmonella CVCC533 was detected.

[0044] Table 2 experimental grouping

[0045]

[0046] Example 3: Detection method of chicken pullorum Salmonella CVCC533

[0047] The PCR method was used for detection. The anus swab was dipped in SC medium and wiped the anus, and then placed in SC medium for enrichment culture for 16-24h. Then PCR was used for detection. The primer sequence is as follows Table 3, containing two pairs of primers of Salmonella and chicken pullorum Salmonella CVCC533. The PCR reaction conditions of chicken pullorum Salmonella CVCC533 are as follows Table 4, and the PCR reaction conditions of Salmonella are as follows Table 5.

[0048] Table 3 primer sequence

[0049]

[0050] Table 4 PCR reaction conditions of chicken pullorum Salmonella CVCC533

[0051]

[0052] Table 5 PCR reaction conditions of Salmonella

[0053]

[0054] PCR products were detected by 1% agarose gel electrophoresis; the determination standard: when two target bands appeared, it was determined to be positive.

[0055] Example 4: Statistics of experimental results

[0056] The statistics of experimental results are shown in Tables 6 and 7 below.

[0057] Table 6: Chitosan concentration optimization

[0058]

[0059] Table 7: Challenge concentration optimization

[0060]

[0061] Based on the above data, the shell rate, the incidence rate, the mortality rate and the infection duration, the effect is the best when the chitosan concentration is 1% and the challenge concentration of chicken salmonella pullorum CVCC533 is 0.1 mL (10 5 cfu / mL); under this concentration, the incidence rate of chicks is the highest after 24 h and the incidence time is uniform, and the survival rate of chicks is high.

[0062] Example 5: Pathological tissue section

[0063] After the 4th group of chicks was dissected, pathological tissue sections were made, and the results are shown in Figures 1-3

[0064] Figure 1 The left side shows that under low magnification, the structure of liver lobule is not clear, there are multiple focal necrosis, and there are inflammatory cell infiltrations around the necrosis foci (100x HE); Figure 1 The right side shows that under high magnification, the liver cord structure is not clear, there are a large number of heterophilic granulocyte infiltrations in the necrosis foci, there are a large number of lymphocyte infiltrations around, and the liver cells are obviously swollen (200x HE).

[0065] Figure 2 The left side shows that under low magnification, the boundary between red pulp and white pulp of the spleen is not clear (100x HE); Figure 2 The right side shows that under high magnification, the number of parenchymal cells in the white pulp is small (200x HE).

[0066] Figure 3 The left side shows that under low magnification, the glomerulus is swollen and fills the entire capsule, and part of the renal tubule is occluded (200x HE); Figure 3 The right side shows that under high magnification, the renal tubular epithelial cells are swollen, and the renal tubular lumen is reduced (200x HE).

[0067] ​Through the observation of pathological tissue sections of liver, spleen and kidney, the three organs all appeared the pathological characteristics after infection, which showed that the method for establishing the chicken pullorum Salmonella CVCC533 model was effective.

[0068] In summary, the anatomy of the chicks and the state of the chicken population: the dead chicks in the autopsy challenge group all showed suspected chicken pullorum death in chicks with liver bleeding or congestion, gallbladder enlargement, cecal enlargement, poor yolk absorption, and yellow-green cheese-like contents.

[0069] From hatching, the blank control group of chicks did not develop chicken pullorum symptoms, and the remaining model groups all developed chicken pullorum clinical symptoms such as grayish white loose stools, depression, ruffled feathers, cold huddling, and grayish white feces sticking to the anus, except for the acute death of chicks.

[0070] The chicken embryo infection model established by this method can obtain consistent results with clinical symptoms, and the protection of chitosan can reduce the embryo mortality rate and improve the hatching rate. Although the chicks after hatching are infected, the survival rate is high, the symptom onset time is consistent, and the chicken pullorum clinical symptoms such as grayish white loose stools appear after 24 hours. The duration of the disease can last for 196 hours, the incidence rate is high (88.89%), and a stable and effective chicken pullorum Salmonella CVCC533 embryo infection model can be established.

[0071] The above-described embodiments are only preferred embodiments of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art should fall within the protection scope of the present application as defined by the claims.

Claims

1. A method for establishing a Salmonella pullorum challenge model in chickens, characterized in that, Includes the following steps: Take a 12-day-old chicken embryo and inject a chitosan oligosaccharide solution into the air cell of the chicken embryo. The chitosan oligosaccharide solution has a mass concentration of 0.8%-1.2% and an injection volume of 0.2 mL. Chicken embryos injected with chitosan oligosaccharide solution were placed in an incubator and incubated until 14 days of age; Salmonella pullorum was injected into the air chamber of 14-day-old chicken embryos to challenge them; After being challenged with the virus, the chicken embryos were placed in an incubator and incubated until 21 days of age. A challenge model was established after chicken embryos hatched at 21 days of age. The chicks were infected with Salmonella pullorum within 24 hours of hatching, and the duration of disease in the chicks in the model could reach 216 hours.

2. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 1, characterized in that: The chitosan oligosaccharide solution has a mass concentration of 1%.

3. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 1, characterized in that: In the step of injecting chitosan oligosaccharide solution into the chicken embryo air chamber, the chitosan oligosaccharide solution is sterilized at 121°C for 30 minutes before being injected into the chicken embryo air chamber.

4. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 1, characterized in that: In the step of challenging 14-day-old chicken embryos by injecting Salmonella pullorum into the air chamber, the volume of Salmonella pullorum solution injected into the air chamber is 0.1 mL, and the concentration of the Salmonella pullorum solution is 10. 4 cfu / mL-10 6 cfu / mL.

5. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 4, characterized in that: The concentration of the Salmonella pullorum solution was 10. 5 cfu / mL.

6. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 1, characterized in that: In the step of challenging 14-day-old chicken embryos by injecting Salmonella pullorum into the air chamber, the strain of Salmonella pullorum used is Salmonella pullorum CVCC533.

7. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 1, characterized in that: After the challenge model is established, positive detection of Salmonella pullorum in chicks is required. During the positive detection process, anal swabs are used for sampling and PCR testing is performed.

8. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 7, characterized in that: The PCR detection primers include: a front primer sequence as shown in SEQ ID NO.1, and a back primer sequence as shown in SEQ ID NO.

2.

9. The method for establishing a Salmonella pullorum challenge model in chickens according to claim 6, characterized in that: After the challenge model is established, PCR detection of Salmonella pullorum CVCC533 in chicks needs to be performed. The PCR detection primers for Salmonella pullorum CVCC533 include: the front primer sequence shown in SEQ ID NO.3 and the back primer sequence shown in SEQ ID NO.4.

Images