Biological covalent binding method of CpG adjuvant and antigen

Abstract

The invention relates to the field of vaccines, in particular to a fixed-point covalent binding method of a CpG adjuvant and an antigen. According to the method, a step-by-step coupling strategy is adopted, a HUH protein and matched specific recognition ssDNA sequence coupling system, an isopeptide bond molecular adhesive system, a fusion expression system and the like are used for achieving fixed-point coupling of the CpG adjuvant and the antigen according to the molar ratio of 1: 1, and the obtained conjugate has the effect of improving immune stimulation of vaccines.

Description

Technical Field

[0001] The present invention relates to the field of vaccines, and in particular to a method for biocovalently binding a CpG adjuvant to an antigen and a CpG adjuvant-antigen conjugate prepared by the method. Background Art

[0002] Unmethylated cytosine-guanine dinucleotides (CpG-ODNs) are 20-30 nucleotide DNA sequences with immunostimulatory activity. They were first discovered by Tokunaga et al. while studying the BCG vaccine for Mycobacterium bovis. As a new and highly effective vaccine adjuvant, CpG adjuvants stimulate cellular immunity and hold broad application prospects in future vaccine development.

[0003] Currently, most vaccine studies use CpG adjuvants through physical mixing, resulting in high adjuvant dosages. Therefore, in recent years, some researchers have attempted to reduce the amount of CpG adjuvant used using chemical coupling methods. In 2000, Helen Tighe et al. modified the CpG adjuvant with 5′-thiolation, treated the antigen with N-ethylmaleimide, and activated it with sulfosuccinimide-4-(N-maleimidomethyl)cyclohexane-1-carboxylate. The two were then mixed to obtain a chemical coupling product of the antigen and CpG adjuvant. Both this chemical coupling product and the physical mixing group (50 μg CpG adjuvant) were able to stimulate Th1 cell immune responses. In 2005, Antji Heit et al. demonstrated that CpG adjuvants, covalently linked to the antigen ovalbumin (OVA) through cross-linking sulfo-maleimido-N-hydroxysuccinimide ester (SMCC), could promote antigen-specific CD8 + The activation and proliferation of T cells, and the challenge experiment verified that a single dose of vaccine can provide the body with immune protection. Subsequent studies have shown that the degree of coupling between the antigen and the CpG adjuvant affects the immune effect that the vaccine can stimulate. When the antigen and the CpG adjuvant are coupled at a 1:1 molar ratio, the physical stability of the coupled product is optimal, and the stimulated antigen cross-presentation reaction is the strongest. In the above-mentioned studies on the coupling of CpG adjuvants and antigens, researchers mostly used the bifunctional cross-linker SMCC for the binding reaction, so that the CpG adjuvant forms a coupling product with the cysteine ​​in the protein antigen sequence. For antigens containing more than two cysteines, this coupling method will produce an uneven coupling ratio of CpG adjuvant to antigen during construction, which is not conducive to the quality control of vaccine products.

[0004] In order to obtain a product with uniform and controllable coupling sites, researchers have used the click coupling effect of azide groups and alkyne groups to couple CpG adjuvants to antigens in a 1:1 ratio. However, this strategy prepares protein antigens by the insertion of non-natural amino acids, which is not conducive to industrial production. A Chinese invention patent (CN114732898B) successfully used an isopeptide bond molecular bonding method (SpyCatcher / SpyTag system) to couple CpG adjuvants to antigens such as Shigella polysaccharide protein antigens, and the conjugate had a better immune effect while significantly reducing the amount of CpG adjuvant used. Although this coupling method can achieve a 1:1 coupling of CpG adjuvants to antigens, it involves steps such as maleimide amine-sulfhydryl cross-linking reactions, and therefore also has problems that are not conducive to industrial production.

[0005] Therefore, developing a coupling method with mild reaction conditions and simple process to prepare a vaccine product with uniform and controllable coupling sites and a 1:1 coupling of CpG adjuvant and antigen is an urgent problem to be solved in this field.

[0006] Through experiments, the inventors discovered that by utilizing the SpyCatcher / SpyTag system and the connection system of the nuclease family HUH protein and ssDNA, a new biological covalent binding technology for antigens and CpG adjuvants can be established, achieving a 1:1 covalent coupling of antigens and CpG adjuvants with uniform coupling sites at room temperature or low temperatures, avoiding the shortcomings of conventional chemical coupling technology with harsh conditions and cumbersome processes, and the conjugates obtained by this biological covalent technology have the effect of enhancing the immune stimulation of the vaccine. Summary of the Invention

[0007] To obtain a conjugate of CpG adjuvant and antigen in a 1:1 molar ratio and site-specific coupling for enhancing the immunostimulatory effect of vaccines, the present inventors have developed a biocovalent binding technology to covalently bind the CpG adjuvant and antigen. This technology simultaneously utilizes a HUH protein coupled to a matching specific recognition ssDNA sequence coupling system, an isopeptide bond molecular adhesive system, and a fusion expression system to achieve the present invention's objectives. Specifically, under mild conditions at room temperature or low temperature, the CpG adjuvant and antigen are site-specifically coupled in a 1:1 molar ratio, wherein the CpG is covalently linked to the ssDNA, the ssDNA is covalently coupled to the HUH protein via phosphotyrosine, the HUH protein is fused with a first molecule of an isopeptide bond molecular adhesive by expression, the first and second molecules of the molecular adhesive are covalently coupled via an isopeptide bond formed between a lysine residue and asparagine or aspartic acid, and the second molecule of the isopeptide bond molecular adhesive is fused with the antigen by expression. The conjugate obtained according to the above method is referred to as a "CpG adjuvant-antigen conjugate."

[0008] Specifically, the technical solution of the present invention relates to a method for site-specific covalent binding of a CpG adjuvant to an antigen, comprising the following steps:

[0009] a. The first molecule of the isopeptide bond molecule adhesive is fused to the N-terminus or C-terminus of the HUH protein to produce the first molecule adhesive-HUM fusion protein;

[0010] b. A specific recognition ssDNA sequence containing a core sequence matching the HUH protein used in step a is connected to the 5' or 3' end of the CpG adjuvant to produce a CpG-ssDNA linker;

[0011] c. incubating the first adhesive molecule-HUM fusion protein produced in step a with the CpG-ssDNA linker produced in step b, and the HUH protein specifically recognizes the ssDNA sequence and binds to produce a CpG-ssDNA-HUH conjugate;

[0012] d. The isopeptide bond molecule used in step a first molecule of the isopeptide bond molecule binder is matched with the second molecule of the antigen N-terminus or C-terminus fusion expression to produce a second molecule of the binder - antigen fusion protein;

[0013] e. Incubate the CpG-ssDNA-HUH conjugate produced in step c with the second binder molecule-antigen fusion protein produced in step d at room temperature or low temperature to produce a CpG adjuvant-antigen conjugate, wherein the CpG adjuvant and the antigen are site-specifically covalently bound at a molar ratio of 1:1.

[0014] In this technical solution, there is no order between steps a and b, as long as they are completed before step c. In addition, there is no order between step d and steps a, b or c, as long as it is completed before step e.

[0015] As described above, due to the universality of the oligonucleotide using the CpG adjuvant in this technical solution being able to chemically link with the specific recognition ssDNA sequence, the universality of the covalent coupling of phosphotyrosine between the HUH protein and its matching specific recognition ssDNA sequence, the universality of the covalent coupling of the first molecule and the second molecule of the molecular adhesive through the isopeptide bond formed between the lysine residue and asparagine or aspartic acid, and the universality of the fusion expression of the two proteins, the technical solution has the characteristics of universality. Therefore, any CpG adjuvant, any HUH protein and its matching specific recognition ssDNA sequence, any isopeptide bond molecular adhesive system, and any protein antigen are suitable for the above-mentioned method of the present invention.

[0016] Therefore, the technical solution of the present invention also relates to a method for site-specific covalent binding of the above-mentioned CpG adjuvant to an antigen, wherein CpG is but not limited to CpG 1018, CpG 2216, CpG 2336, CpG 2007, CpG BW006 / 684, CpG D-SL01, CpG2395, CpG M362, CpG D-SL03 or CpG 2006 / 7909.

[0017] As described above, any modification of the CpG adjuvant based on the coupling system of HUH protein and matching specific recognition ssDNA sequence is applicable to the method of the present invention. Therefore, the technical solution of the present invention also relates to the covalent binding method of the above-mentioned CpG adjuvant and antigen, wherein the HUH protein and the matching specific recognition ssDNA sequence containing the core sequence are protein PCV2 and a sequence containing the core sequence TATTAC, protein DCV and a sequence containing the core sequence TATTAC, protein FBNYV and a sequence containing the core sequence TATTAC, protein BBTV and a sequence containing the core sequence TATTAC, protein WDV and a sequence containing the core sequence TATTAC. The protein TYLCV and a sequence containing the core sequence TATTAC, the protein CpCDV and a sequence containing the core sequence TATTAC, the protein MSMV and a sequence containing the core sequence TATTAC, the protein CLCV and a sequence containing the core sequence TATTAC, the protein TGMV and a sequence containing the core sequence TATTAC, the protein RepB and a sequence containing the core sequence TACTAC, the protein RepBm and a sequence containing the core sequence TACTAC, the protein TraI and a sequence containing the core sequence GGTGC, the protein mMobA and a sequence containing the core sequence CCCTCCC, or the protein NES and a sequence containing the core sequence CCCTTA. Furthermore, the technical solution of the present invention also relates to a method for covalently binding the above-mentioned CpG adjuvant to an antigen, wherein the HUH protein and the matching specific recognition ssDNA sequence are, but are not limited to, protein PCV2 and sequence TAAGTATTAC, protein DCV and sequence TTATATTATTAC, protein DCV and sequence AAGTATTACCAG, protein FBNYV and sequence CTTAGTATTAC, protein BBTV and sequence CTTATTATTAC, protein WDV and sequence TTATAATATTAC, protein TYLCV and sequence TATAAATATTAC, protein CpCDV and sequence AAATTAATATTAC, protein MSMV and sequence ATAAT AATATTAC, protein CLCV and the sequence CAATAATATTAC, protein TGMV and the sequence TTTAATATTAC, protein RepB and the sequence TGCTTCCGTACTACGACCCCCCA, protein RepBm and the sequence TGCTTCCGTACTACGACCCCCCA, protein TraI and the sequence TTTGCGTGGGGTGTGGTGCTTT, protein mMobA and the sequence CCAGTTTCTCGAAGAGAAACCGGTAAGTGCACCCTCCC, or protein NES and the sequence ACGCGAACGGAACGTTCGCATAAGTGCGCCCTTACGGGATTTAAC.

[0018] As mentioned above, any isopeptide bond molecular adhesive system is applicable to the method of the present invention. Therefore, the technical solution of the present invention also relates to the covalent binding method of the above-mentioned CpG adjuvant and antigen, wherein the first isopeptide bond molecular adhesive molecule and the matching second isopeptide bond molecular adhesive molecule are respectively but not limited to SpyCatcher and SpyTag, SpyTag and SpyCatcher, SpyCatcherΔN1ΔC1 and SpyTag, SpyTag and SpyCatcherΔN1ΔC1, SpyLigase and SpyTag / KTag, SpyTag / KTag and SpyLigase, SnoopCatcher and SnoopTag, SnoopTag and SnoopCatcher, SpyCatcher002 and SpyTag002, SpyTag002 and SpyCatcher002, SnoopLigase2 and SnoopTagJr / DogTag, SnoopTagJr / DogTag and SnoopLigase 2. SpyDock and SpyTag002, or SpyTag002 and SpyDock.

[0019] As mentioned above, any protein antigen is suitable for the method of the present invention. Therefore, the technical solution of the present invention also relates to a method for covalently binding the above-mentioned CpG adjuvant to an antigen, wherein the antigen is but not limited to a protein antigen and a saccharide antigen. The saccharide antigen is in the form of a glycoprotein, and the protein serves as a carrier. Further, the antigens involved in the present invention are but not limited to protein antigens or saccharide antigens derived from bacteria, viruses, fungi, spirochetes, mycoplasmas, rickettsiae, chlamydiae, parasites or tumors. Further, the protein antigens involved in the present invention are Brucella protein antigen Omp19 and novel coronavirus RBD, and the saccharide antigen is Shigella surface polysaccharide OPS.

[0020] On the other hand, the present invention also relates to a CpG adjuvant-antigen conjugate prepared according to the above method, wherein the CpG adjuvant and the antigen are site-specifically covalently bound at a molar ratio of 1:1, wherein the 5' end or 3' end of the CpG adjuvant is covalently linked to the specific recognition ssDNA sequence matching the HUH protein through a phosphodiester bond, the HUH protein is covalently coupled to the specific recognition ssDNA sequence matching the HUH protein through phosphotyrosine, the N-terminus or C-terminus of the HUH protein is covalently linked to the first molecule of the isopeptide bond molecular adhesive through a peptide bond, the first molecule of the isopeptide bond molecular adhesive is covalently coupled to the matching second molecule of the isopeptide bond molecular adhesive through an isopeptide bond formed between a lysine residue and asparagine or aspartic acid, and the second molecule of the isopeptide bond molecular adhesive is covalently linked to the N-terminus or C-terminus of the antigen through a peptide bond. The "covalent linkage via a phosphodiester bond" between the 5' or 3' end of the CpG adjuvant and the specific recognition ssDNA sequence containing the core sequence that matches the HUH protein includes direct covalent linkage via a phosphodiester bond between the 5' or 3' end of the CpG adjuvant and the specific recognition ssDNA sequence that matches the HUH protein, and covalent linkage via a phosphodiester bond between the 5' or 3' end of the CpG adjuvant and the specific recognition ssDNA sequence that matches the HUH protein via a nucleic acid linker. The "covalent linkage via a peptide bond" between the N-terminus or C-terminus of the HUH protein and the first molecule of the isopeptide bond molecular adhesive includes direct peptide bond linkage between the N-terminus or C-terminus of the HUH protein and the first molecule of the isopeptide bond molecular adhesive, and peptide bond linkage between the N-terminus or C-terminus of the HUH protein and the first molecule of the isopeptide bond molecular adhesive via a protein linker. The above-mentioned isopeptide bond molecular adhesive second molecule is "covalently linked to the N-terminus or C-terminus of the antigen through a peptide bond", including the isopeptide bond molecular adhesive second molecule being directly linked to the N-terminus or C-terminus of the antigen through a peptide bond, and the isopeptide bond molecular adhesive second molecule being linked to the N-terminus or C-terminus of the antigen through a protein linker with a peptide bond respectively.

[0021] As described above, due to the versatility of the method of the present invention, the technical solution of the present invention also relates to a CpG adjuvant-antigen conjugate prepared according to the above method, wherein the CpG adjuvant is but not limited to CpG 1018, CpG 2216, CpG2336, CpG 2007, CpG BW006 / 684, CpG D-SL01, CpG 2395, CpG M362, CpG D-SL03 or CpG 2006 / 7909.

[0022] The technical solution of the present invention also relates to a CpG adjuvant antigen conjugate prepared according to the above method, wherein the first isopeptide bond molecule adhesive and the second isopeptide bond molecule adhesive matching molecule are respectively but not limited to SpyCatcher and SpyTag, SpyTag and SpyCatcher, SpyCatcherΔN1ΔC1 and SpyTag, SpyTag and SpyCatcherΔN1ΔC1, SpyLigase and SpyTag / KTag, SpyTag / KTag and SpyLigase, SnoopCatcher and SnoopTag, SnoopTag and SnoopCatcher, SpyCatcher002 and SpyTag002, SpyTag002 and SpyCatcher002, SnoopLigase 2 and SnoopTagJr / DogTag, SnoopTagJr / DogTag and SnoopLigase2, SpyDock and SpyTag002, or SpyTag002 and SpyDock.

[0023] The technical solution of the present invention also relates to a CpG adjuvant antigen conjugate prepared according to the above method, wherein the HUH protein and the matching specific recognition ssDNA sequence containing the core sequence are respectively protein PCV2 and a sequence containing the core sequence TATTAC, protein DCV and a sequence containing the core sequence TATTAC, protein FBNYV and a sequence containing the core sequence TATTAC, protein BBTV and a sequence containing the core sequence TATTAC, protein WDV and a sequence containing the core sequence TATTAC, protein TYLCV and a sequence containing the core sequence TATTAC, protein White protein CpCDV and a sequence containing the core sequence TATTAC, protein MSMV and a sequence containing the core sequence TATTAC, protein CLCV and a sequence containing the core sequence TATTAC, protein TGMV and a sequence containing the core sequence TATTAC, protein RepB and a sequence containing the core sequence TACTAC, protein RepBm and a sequence containing the core sequence TACTAC, protein TraI and a sequence containing the core sequence GGTGC, protein mMobA and a sequence containing the core sequence CCCTCCC, or protein NES and a sequence containing the core sequence CCCTTA.

[0024] Furthermore, the technical solution of the present invention also relates to a CpG adjuvant antigen conjugate prepared according to the above method, wherein the HUH protein and the matching specific recognition ssDNA sequence are, but are not limited to, protein PCV2 and sequence TAAGTATTAC, protein DCV and sequence TTATATTATTAC, protein DCV and sequence AAGTATTACCAG, protein FBNYV and sequence CTTAGTATTAC, protein BBTV and sequence CTTATTATTAC, protein WDV and sequence TTATAATATTAC, protein TYLCV and sequence TATAATATTAC, protein CpCDV and sequence AAATTAATATTAC, protein MSMV and sequence ATA ATAATATTAC, protein CLCV and the sequence CAATAATATTAC, protein TGMV and the sequence TTTTAATATTAC, protein RepB and the sequence TGCTTCCGTACTACGACCCCCCA, protein RepBm and the sequence TGCTTCCGTACTACGACCCCCCA, protein TraI and the sequence TTTGCGTGGGGTGTGGTGCTTT, protein mMobA and the sequence CCAGTTTCTCGAAGAGAAACCGGTAAGTGCACCCTCCC, or protein NES and the sequence ACGCGAACGGAACGTTCGCATAAGTGCGCCCTTACGGGATTTAAC.

[0025] The technical solution of the present invention also relates to a CpG adjuvant antigen conjugate prepared according to the above method, wherein the antigen is a protein antigen or a sugar antigen. Further, the present invention also relates to a CpG adjuvant antigen conjugate prepared according to the above method, wherein the protein antigen or sugar antigen is a protein antigen or sugar antigen derived from bacteria, viruses, fungi, spirochetes, mycoplasmas, rickettsiae, chlamydiae, parasites or tumors. Furthermore, the protein antigen involved in the present invention is the Brucella protein antigen Omp19 and the new coronavirus RBD, and the sugar antigen is the Shigella surface polysaccharide OPS.

[0026] In another aspect, the present invention also relates to the use of the above-mentioned CpG adjuvant-antigen conjugate in the preparation of vaccines.

[0027] In another aspect, the present invention also relates to a vaccine, characterized in that it comprises the above-mentioned CpG adjuvant-antigen conjugate. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 1 is a flow chart of the technical solution of the present invention, wherein a is an overall flow chart, b is an enlarged schematic diagram of plasmid pET28a-ST-HUH, and c is an enlarged schematic diagram of plasmid pET28a-SC-Omp19.

[0029] Figure 2 This is the result of pET28a-ST-HUH gene sequencing.

[0030] Figure 3 This is the result of Coomassie Brilliant Blue staining and Western-Blot experiment on protein expression level of BL21 / ST-HUH strain.

[0031] Figure 4 This is the result of Coomassie Brilliant Blue staining after ST-HUH protein molecular sieve purification.

[0032] Figure 5 This is a diagram showing the detection results of the ST-HUH and HUH-CpG 1018 connection system.

[0033] Figure 6 This is the peak diagram of SC-Omp19 protein purified by molecular sieve.

[0034] Figure 7 This is the result of Coomassie Brilliant Blue staining of molecular sieve purified SC-Omp19 protein.

[0035] Figure 8 The following is a Coomassie blue staining validation image of the Omp19-Tag-HUH-CpG 1018 conjugate. A shows the SC-Omp19 and Tag-HUH-CpG 1018 conjugate, CpG-Omp19; B shows a small amount of incompletely conjugated SC-Omp19 protein; and C shows a small amount of incompletely conjugated Tag-HUH-CpG 1018.

[0036] Figure 9 This is the result of Coomassie Brilliant Blue staining of molecular sieve purified CpG-Omp19.

[0037] Figure 10 This is the peak diagram of molecular sieve purification of CpG-Omp19 conjugate.

[0038] Figure 11 It is a test for the level of specific IgG antibodies in the immune serum of CpG-Omp19 conjugate.

[0039] Figure 12 This is the result of Coomassie Brilliant Blue staining test on the collected samples of molecular sieve purified SC-OPS glycoprotein.

[0040] Figure 13 This is the peak diagram of SC-OPS glycoprotein purified by molecular sieve.

[0041] Figure 14 This is the result of the ligation reaction experiment between FHUH-CpG 1018 and SC-OPS.

[0042] Figure 15This is the result of the ligation reaction experiment verification of ST-HUH and HUH-CpG 2006.

[0043] Figure 16 This is a verification image of Coomassie brilliant blue staining after purification of SC-R protein by nickel column affinity chromatography.

[0044] Figure 17 This is the SC-R protein detection result diagram.

[0045] Figure 18 This is a diagram showing the results of the Coomassie Brilliant Blue staining experiment verifying the ligation reaction between SC-R and Tag-HUH-CpG 2006.

[0046] Figure 19 This is the peak diagram of molecular sieve purification of CpG-R conjugate.

[0047] Figure 20 This is the result of Coomassie Brilliant Blue staining of molecular sieve purified CpG-R.

[0048] Figure 21 It is a test of the level of specific IgG antibodies in CpG-R conjugate immune serum.

[0049] Figure 22 This is the result of pET28a-SC-HUH gene sequencing.

[0050] Figure 23 This is the result of protein expression level test in whole-cell BL21 / SC-HUH.

[0051] Figure 24 This is a Coomassie Brilliant Blue staining experiment verification diagram after the purification of SC-HUH protein by nickel column affinity chromatography.

[0052] Figure 25 This is a Coomassie Brilliant Blue staining experiment verification diagram after molecular sieve purification of SC-HUH protein.

[0053] Figure 26 This is the experimental result of Coomassie Brilliant Blue staining experiment to verify the HUH-CpG 2006 and SC-HUH coupling system.

[0054] Figure 27 This is a map of the Omp19-HUH protein expression plasmid and enzyme digestion test results.

[0055] Figure 28 This is the result of Coomassie brilliant blue staining of Omp19-HUH protein after purification by nickel column affinity chromatography.

[0056] Figure 29 This is the result of Coomassie brilliant blue staining of Omp19-HUH protein after purification by molecular sieve.

[0057] Figure 30 This is the HA-HUH protein expression plasmid map and enzyme digestion test results.

[0058] Figure 31 This is the result of Coomassie brilliant blue staining of HA-HUH protein after purification by nickel column affinity chromatography.

[0059] Figure 32 This is the RBD-HUH protein expression plasmid map and enzyme digestion test results.

[0060] Figure 33 This is an SDS-PAGE analysis of RBD-HUH protein expression.

[0061] Figure 34 This is an analysis diagram of the connection between Omp19-HUH protein and HUH-CpG 2006.

[0062] Figure 35 This is an analysis diagram of the connection between HA-HUH protein and HUH-CpG 2006. Specific implementation method:

[0063] In order to obtain a conjugate of CpG adjuvant and antigen in a 1:1 molar ratio and site-specific coupling for improving the immune stimulation effect of the vaccine, the present inventors have developed a biocovalent binding technology to covalently bind CpG adjuvant to antigen. The technology adopts a step-by-step coupling strategy, using HUH protein and a matching specific recognition ssDNA sequence coupling system, an isopeptide bond molecular adhesive system, and a fusion expression system to achieve the purpose of the present invention, that is, under mild conditions at room temperature or low temperature (such as -4°C-10°C), CpG adjuvant and antigen are coupled in a 1:1 molar ratio and site-specifically. The entire experimental process is designed as follows: Figure 1As shown. The experimental process takes Brucella outer membrane protein Omp19 antigen as an example. The SpyTag short peptide was fused with HUH protein and purified to obtain ST-HUH fusion protein, and the SpyCatcher protein was fused with Omp19 protein and purified to obtain SC-Omp19 fusion protein; the HUH-CpG 1018 oligodeoxyribonucleotide sequence was designed and synthesized, which contained the HUH protein specific recognition sequence AAGTATTACCAG and the CpG 1018 sequence TGACTGTGAACGTTCGAGATGA; then the ST-HUH fusion protein was fused with HUH-CpG 1018 is ligated to obtain STH-CpG; then, the STH-CpG is combined with the SC-Omp19 protein under mild conditions, such as room temperature or low temperature, to obtain the CpG adjuvant-antigen conjugate CpG-Omp19. This is because the side chain carboxyl group of aspartic acid in the SpyTag sequence and the side chain amino group of lysine in the SpyCatcher sequence can spontaneously combine to form an isopeptide bond, allowing for gentle and rapid covalent coupling of STH-CpG and SC-Omp19 at room temperature or low temperature. Finally, CpG-Omp19 is purified using gel filtration chromatography. The purified conjugated product enhances the immune stimulatory effect of the vaccine.

[0064] In the art, conventional coupling techniques for directly fusing antigens with HUH proteins, and leveraging the functionality of the HUH protein system to couple the antigens to the CpG adjuvant, typically fail to produce the desired coupling product. Example 18 of the present patent application also employed three antigens for further experimental testing, finding that none of the three antigens could achieve CpG coupling via direct fusion with the HUH protein. This is likely due to the antigen's natural structure and steric hindrance, which severely interfere with the HUH protein's functionality. The step-by-step coupling strategy of the present invention successfully addresses this technical issue.

[0065] In the present invention, CpG adjuvant refers to a non-methylated cytosine-guanine dinucleotide DNA repeat sequence with a length of 20-30 nucleotides and immunostimulatory activity. CpG adjuvant has the function of directly activating B cells and antigen-presenting cells, and indirectly activating NK cells and T cells. Its mechanism of action is to activate Th1 type immune response by binding to the innate immune pattern recognition receptor Toll-like receptor 9 (TLR9) in the cell. CpG adjuvants have different structural characteristics and are generally divided into three types: A, B, and C. Their corresponding immune effects are also different: although type A can activate pDC cells, it has a weaker activation effect on B cells; type B is the earliest discovered and most clearly studied CpG adjuvant, and has been used in vaccine clinical research; type C has the advantages of both the first two, but there are no reports of its use in clinical research. In the present invention's covalent binding technology for antigens and CpG adjuvants, a 12-base sequence, such as TTATATTATTAC, is added to the 5' end of the CpG adjuvant, followed by coupling to a fusion protein consisting of the isopeptide bond molecular adhesive Tag C-terminus and the HUH protein. Specifically, the phosphate group on the eighth adenine deoxyribonucleotide at the 5' end of the CpG adjuvant is coupled to a tyrosine residue of the HUH protein in the fusion protein. It is well known in the art that the addition of a HUH protein-specific recognition ssDNA nucleotide sequence to the 3' end of the CpG adjuvant can also achieve the objectives of the present invention and is therefore within the scope of protection of the present invention.

[0066] From the above-mentioned CpG coupling characteristics, it can be seen that any CpG adjuvant in the art can be applicable to the technology of the present invention. These CpG adjuvants may include but are not limited to CpG1018, CpG 2216, CpG 2336, CpG 2007, CpG BW006 / 684, CpG D-SL01, CpG 2395, CpG M362, CpG D-SL03 or CpG 2006 / 7909, etc. (see Table 1).

[0067] Table 1. CpG sequences

[0068] name Sequence (5′→3′) SEQ ID NO. CpG 1018 TGACTGTGAACGTTCGAGATGA 1 CpG 2216 GGGGGACGATCGTCGGGGGG 2 CpG 2336 GGGGACGACGTCGTGGGGGGG 3 CpG 2006 / 7909 TCGTCGTTTTGTCGTTTTGTCGTT 4 CpG 2007 TCGTCGTTGTCGTTTTGTCGTT 5 CpG BW006 / 684 TCGACGTTCGTCGTTCGTCGTTC 6 CpG D-SL01 TCGCGACGTTCGCCCGACGTTCGGTA 7 CpG 2395 TCGTCGTTTTCGGCGCGCGCCG 8 CpG M362 TCGTCGTCGTTCGAACGACGTTGAT 9 CpG D-SL03 TCGCGAACGTTCGCCGCGTTCGAACGCGG 10

[0069] The amino acid sequence of HUH endonuclease superfamily proteins (abbreviated as HUH proteins) all have two conserved protein motifs, namely HUH motif and Y motif. The HUH motif structure is composed of two histidines separated by a hydrophobic group, and the Y motif structure contains a tyrosine residue or two tyrosine residues separated by multiple amino acids. HUH protein recognizes specific single-stranded deoxyribonucleic acid (ssDNA) and cuts and inserts DNA fragments at the cleavage site. Divalent metal ions and HUH motifs can assist in the connection between the Y motif and ssDNA. The tyrosine residue of the Y motif forms a phosphotyrosine intermediate with the phosphate group of ssDNA. In vitro studies have shown that Mg 2+ 、Mn 2+ Or other divalent metal ions can assist the connection between HUH protein and ssDNA. In addition, HUH protein recognizes the hairpin structure of ssDNA, and ssDNA contains a core deoxyribonucleotide (hereinafter referred to as the core sequence), which can form a circular ring head of the hairpin structure. HUH protein needs to recognize this circular ring head, then cut the ssDNA and connect with the ssDNA. For ssDNA sequences, the sequences on both sides of the circular ring head can vary, as long as they can form a hairpin structure, they can be recognized and connected by the corresponding HUH protein.

[0070] In the present invention, by adding a 12-base sequence such as AAGTATTACCAG to the 5' end of the CpG adjuvant, the fusion protein is coupled to the C-terminus of the isopeptide bond molecular adhesive Tag and the HUH protein. Specifically, the phosphate group on the eighth adenine deoxyribonucleotide at the 5' end of the CpG adjuvant is coupled to the tyrosine residue in the HUH protein in the fusion protein of the isopeptide bond molecular adhesive Tag and the HUH protein, thereby achieving the coupling purpose of the present invention. As described above, the HUH protein achieves the coupling purpose of the present invention primarily by recognizing the circular head formed by the core sequence in ssDNA, namely, by recognizing the TATTAC core sequence in the 12-base sequence AAGTATTACCAG. Based on the above coupling characteristics, any HUH protein and ssDNA coupling system in the art is suitable for the above method of the present invention, so the HUH protein and the matching specific recognition ssDNA sequence coupling system containing the core sequence includes but is not limited to PCV2 / sequence containing the core sequence TATTAC, DCV / sequence containing the core sequence TATTAC, FBNYV / sequence containing the core sequence TATTAC, BBTV / sequence containing the core sequence TATTAC, WDV / sequence containing the core sequence TATTAC, TYLCV / sequence containing the core sequence TATTAC, CpCDV / sequence containing the core sequence TATTAC, MSMV / sequence containing the core sequence TATTAC, CLCV / sequence containing the core sequence TATTAC, TGMV / sequence containing the core sequence TATTAC, RepB / sequence containing the core sequence TACTAC, Rep Bm / sequence containing the core sequence TACTAC, TraI / sequence containing the core sequence GGTGC, mMobA / sequence containing the core sequence CCCTCCC, NES / sequence containing the core sequence CCCTTA.Further, the HUH protein and the matching specific recognition ssDNA sequence coupling system include but are not limited to PCV2 / TAAGTATTAC, DCV / TTATATTATTAC, DCV / AAGTATTACCAG, FBNYV / CTTAGTATTAC, BBTV / CTTATTATTAC, WDV / TTATAATATTAC, TYLCV / TATAATATTAC, CpCDV / AAATTAATATTAC, MSMV / ATAATAATATTAC, CLCV / CAATAATATTAC, TGMV / TTTAATATTAC, RepB / TGCTTCCGTACTACGACCCCCCA, RepBm / TGCTTCCGTACTACGACCCCCCA, TraI / TTTGCGTGGGGTGTGGTGCTTT, mMobA / CCAGTTTCTCGAAGAGAAACCGGTAAGTGCACCCTCCC, NES / ACGCGAACGGAACGTTCGCATAAGTGCGCCCTTACGGGATTTAAC. The HUH protein and its specific recognition ssDNA sequence are shown in Table 2 below.

[0071] Table 2. HUH protein names and specific recognition ssDNA sequences

[0072]

[0073]

[0074] In the present invention's method for site-specific covalent binding of a CpG adjuvant to an antigen and the CpG adjuvant-antigen conjugate prepared according to the method, the core sequence, ssDNA core sequence, specific recognition ssDNA core sequence, or matching specific recognition ssDNA core sequence refers to a sequence within an ssDNA sequence recognized by the HUH protein that can form a hairpin head; the ssDNA sequence, specific recognition ssDNA sequence, matching specific recognition ssDNA sequence, specific recognition ssDNA sequence containing a core sequence, or matching specific recognition ssDNA sequence containing a core sequence refers to an ssDNA sequence recognized by the HUH protein that can form a hairpin structure and contains a core sequence that can form a hairpin head. Taking the DCV / TTATATTATTAC system as an example, the TTATATTATTAC sequence is the specific recognition ssDNA sequence that matches the HUH protein DCV and forms a hairpin structure; the TATTAC sequence is the core sequence that forms a hairpin head. Modifying some of the bases at either end of the core TATTAC sequence allows for binding to the DCV protein. For example, the present invention utilizes the linkage of AAGTATTACCAG to the DCV protein. Those skilled in the art can easily experiment with sequences other than the core sequence. Because sequences other than the core sequence cannot be exhaustively enumerated, in the present patent application, for ease of description and determination of the scope of protection, descriptions of a specific HUH protein in the HUH protein system and its matching specific recognition ssDNA sequence include all nucleic acid sequences containing its core sequence that can achieve the function of that specific HUH protein system. For example, when referring to the specific recognition ssDNA sequence that matches the DCV protein, it can include TTATATTATTAC, AAGTATTACCAG, and any other nucleic acid sequences containing the core sequence TATTAC that can form a hairpin structure and be recognized by DCV. All of the aforementioned nucleotide sequences that can achieve the function of a specific HUH protein are also within the scope of protection of the present application.

[0075] In the present invention, an isopeptide bond molecular adhesive refers to two polypeptide sequences bonded together by an isopeptide bond formed by the side chain carboxyl group of aspartic acid and the side chain amino group of lysine, wherein one molecule of the isopeptide bond molecular adhesive is typically shorter and contains an active aspartic acid, typically referred to as a tag, and the other molecule is typically longer and contains the corresponding active lysine, typically referred to as a catcher. In the present invention, of the two molecules of the isopeptide bond molecular adhesive system, the molecule expressed in fusion with the HUH protein is referred to as the first isopeptide bond molecular adhesive molecule, and the molecule expressed in fusion with the antigen is referred to as the second isopeptide bond molecular adhesive molecule; and the first isopeptide bond molecular adhesive molecule can be any molecule in the isopeptide bond molecular adhesive system, and the second isopeptide bond molecular adhesive molecule refers to another molecule in the isopeptide bond molecular adhesive system that matches the above-mentioned first molecule. Taking SpyCatcher / SpyTag as an example, if SpyCatcher is used as the first molecule of the isopeptide bond molecular binder, then the matching SpyTag is the second molecule of the isopeptide bond molecular binder. Alternatively, SpyTag can be used as the first molecule of the isopeptide bond molecular binder, and the matching SpyCatcher is the second molecule of the isopeptide bond molecular binder. Example 15 below illustrates this flexibility of the isopeptide bond molecular binder system.

[0076] Since the technology of the present invention uses the general principle of spontaneous formation of isopeptide bonds of adhesives, any isopeptide bond molecular adhesive system in the art is applicable to the above-mentioned method of the present invention, and the isopeptide bond molecular adhesive system includes but is not limited to SpyCatcher and SpyTag, SpyCatcherΔN1ΔC1 and SpyTag, SpyLigase and SpyTag / KTag, SnoopCatcher and SnoopTag, SpyCatcher002 and SpyTag002, SnoopLigase2 and SnoopTagJr / DogTag, SpyDock and SpyTag002, wherein the isopeptide bond molecular adhesives and the corresponding Tag sequences are shown in Table 3 below.

[0077] Table 3. Isopeptide bond molecular adhesive names and corresponding tag sequences

[0078]

[0079] Specifically, in the patent application of the present invention, the first molecule of the isopeptide bond molecular adhesive and the matching second molecule of the isopeptide bond molecular adhesive can be SpyCatcher and SpyTag, SpyTag and SpyCatcher, SpyCatcherΔN1ΔC1 and SpyTag, SpyTag and SpyCatcherΔN1ΔC1, SpyLigase and SpyTag / KTag, SpyTag / KTag and SpyLigase, SnoopCatcher and SnoopTag, SnoopTag and SnoopCatcher, SpyCatcher002 and SpyTag002, SpyTag002 and SpyCatcher002, SnoopLigase 2 and SnoopTagJr / DogTag, SnoopTagJr / DogTag and SnoopLigase 2, SpyDock and SpyTag002, or SpyTag002 and SpyDock.

[0080] In the method for site-specific covalent binding of a CpG adjuvant to an antigen and the CpG adjuvant-antigen conjugate prepared according to the method of the present invention, the site-specific covalent binding of the CpG adjuvant to the antigen or the site-specific covalent binding of the CpG adjuvant to the antigen at a molar ratio of 1:1 means that the CpG adjuvant to the ssDNA, the HUH protein to the specific recognition ssDNA sequence matching the HUH protein, the HUH protein to the first molecule of the isopeptide bond molecular adhesive, the first molecule of the isopeptide bond molecular adhesive and the matching second molecule of the isopeptide bond molecular adhesive, and the second molecule of the isopeptide bond molecular adhesive to the antigen are all covalently connected at fixed sites and in a fixed manner, and the molar ratio of the CpG adjuvant to the antigen is 1:1. Specifically, in the prepared CpG adjuvant-antigen conjugate, the 5' or 3' end of the CpG adjuvant is covalently linked to the specific recognition ssDNA sequence via a nucleic acid linker via a phosphodiester bond, the HUH protein is covalently coupled to the specific recognition ssDNA sequence that matches the HUH protein via phosphotyrosine, the HUH protein is covalently linked to the N-terminus or C-terminus of the first molecule of the isopeptide bond molecular adhesive via a protein linker via a peptide bond (achieved by fusion expression), the first molecule of the isopeptide bond molecular adhesive is covalently coupled to the matching second molecule of the isopeptide bond molecular adhesive via an isopeptide bond formed between an asparagine or aspartic acid residue and a lysine residue, and the N-terminus or C-terminus of the second molecule of the isopeptide bond molecular adhesive is covalently linked to the antigen via a peptide bond via a polypeptide linker (achieved by fusion expression). The nucleic acid linkers and protein linkers are well known in the art, and those skilled in the art can easily determine the length of the nucleic acid linkers and protein linkers as well as the specific nucleotide sequence or polypeptide sequence.

[0081] Taking the CpG-Omp19 conjugate obtained in Examples 1-5 as an example, the 5' end of the CpG 1018 adjuvant sequence TGACTGTGAACGTTCGAGATGA matches the specific recognition ssDNA sequence AAG of HUH TATTAC The 3' of CAG (core sequence is underlined) is connected through a phosphodiester bond, the HUH protein and the specific recognition ssDNA sequence are covalently coupled to each other through the phosphate group on the eighth adenine deoxyribonucleotide in AAGTATTACCAG and the tyrosine residue in the HUH protein to form a phosphotyrosine covalent coupling, the N-terminus of the HUH protein and the C-terminus of the first molecule of the isopeptide bond molecular adhesive are covalently linked to the C-terminus of the Tag of the linker sequence EAAAKEAAAK by a peptide bond, the first molecule of the isopeptide bond molecular adhesive and the matching second molecule of the isopeptide bond molecular adhesive are covalently coupled through the isopeptide bond formed between the asparagine or aspartic acid residue in the Tag and the lysine residue in the Cather, the C-terminus of the second molecule of the isopeptide bond molecular adhesive and the N-terminus of the antigen Omp19 are covalently linked to the N-terminus of the antigen Omp19 through the linker sequence GGSG by a peptide bond, and the molar ratio of CpG adjuvant to antigen in the final produced CpG adjuvant and antigen conjugate is 1:1.

[0082] In the method for site-specific covalent binding of a CpG adjuvant to an antigen of the present invention, the HUH CpG-Tag conjugate and the fusion antigen obtained by fusing the antigen with the Catcher can be subjected to mild and rapid covalent coupling at room temperature or low temperature, ultimately obtaining a CpG adjuvant-antigen conjugate in which the CpG adjuvant and the antigen are site-specifically covalently bound at a 1:1 molar ratio.

[0083] In the method for site-specific covalent binding of a CpG adjuvant to an antigen of the present invention, a fusion protein in which the N-terminus of the first molecule of the isopeptide bond molecular adhesive is fused to the HUH protein via a protein linker can be obtained by adding a protein linker to the N-terminus of the first molecule of the isopeptide bond molecular adhesive and expressing and purifying the fusion protein, or by biosynthesis. A fusion protein in which the C-terminus of the first molecule of the isopeptide bond molecular adhesive is fused to the HUH protein via a protein linker can be obtained by adding a protein linker to the C-terminus of the first molecule of the isopeptide bond molecular adhesive and expressing and purifying the fusion protein, or by biosynthesis. The above-mentioned fusion expression of the first molecule of the isopeptide bond molecular adhesive and the HUH protein refers to the concatenation of the DNA coding sequence of the first molecule of the isopeptide bond molecular adhesive and the DNA coding sequence of the HUH protein by conventional molecular biological means, and expression and purification using conventional expression systems such as eukaryotic and prokaryotic systems; that is, the fusion of the HUH protein and the first molecule of the isopeptide bond molecular adhesive can be a fusion of the N-terminus of the HUH protein with the C-terminus of the first molecule of the adhesive, or a fusion of the C-terminus of the HUH protein with the N-terminus of the first molecule of the adhesive. Fusion expression technology is well known in the art. The specific implementation steps include amplifying the coding region of the first molecule of the isopeptide bond molecular adhesive and the coding region of the HUH protein by PCR technology, then inserting them into the expression vector through restriction endonuclease, and transforming them into expression bacteria for expression.

[0084] In the method for site-specific covalent binding of CpG adjuvant to antigen of the present invention, the fusion protein in which the N-terminus of the second molecule of isopeptide bond molecular adhesive is fused with the antigen through protein linker can be obtained by adding protein linker to the N-terminus of the second molecule of isopeptide bond molecular adhesive and expressing and purifying the fusion protein, and can be obtained by biosynthesis. The fusion protein in which the C-terminus of the second molecule of isopeptide bond molecular adhesive is fused with the antigen through protein linker can be obtained by adding protein linker to the C-terminus of the second molecule of isopeptide bond molecular adhesive and expressing and purifying the fusion protein, and can be obtained by biosynthesis. The above-mentioned fusion expression of the second molecule of isopeptide bond molecular adhesive and the antigen refers to the conventional means of molecular biology, which connects the DNA coding sequence of the second molecule of isopeptide bond molecular adhesive with the DNA coding sequence of the antigen in series, and expresses and purifies them using conventional expression systems such as eukaryotic and prokaryotic systems; that is, the fusion of the antigen and the second molecule of isopeptide bond molecular adhesive can be the fusion of the N-terminus of the antigen and the C-terminus of the second molecule of the adhesive, or the fusion of the C-terminus of the antigen and the N-terminus of the second molecule of the adhesive. Fusion expression techniques are well known in the art. Specific implementation steps include amplifying the coding regions of the second molecule of the isopeptide bond adhesive and the antigen using PCR, then inserting them into an expression vector using restriction endonucleases, and transforming them into expression bacteria for expression. Furthermore, to obtain bacteria capable of expressing carbohydrate antigens (including carrier proteins), genetically engineered bacteria that have been introduced with exogenous protein glycosylation systems can be used, and these techniques are also well known in the art.

[0085] In the present invention, antigen refers to a protein or carbohydrate antigen that has the effect of preventing a disease or treating a disease by activating the immune system, such as, but not limited to, a tumor. Antigens suitable for the site-specific covalent binding method of the present invention for the CpG adjuvant and antigen include protein antigens and carbohydrate antigens, wherein the protein antigen can be derived from, but not limited to, bacteria, viruses, fungi, spirochetes, mycoplasmas, rickettsiae, chlamydiae, parasites, and tumor markers; carbohydrate antigens can be derived from, but not limited to, bacteria, viruses, fungi, spirochetes, mycoplasmas, rickettsiae, chlamydiae, parasites, and tumor markers, such as O-antigens on the surface of bacteria, which are linked to a protein carrier to activate the immune system to produce immune memory. In the present invention, fusion antigen or fusion expression refers to the concatenation of the DNA coding sequence of the second molecule of the isopeptide bond molecular adhesive with the DNA coding sequence of the antigen by conventional molecular biological means, and expression and purification using conventional expression systems such as eukaryotic and prokaryotic expression systems. That is, the fusion of the antigen and the second molecule of the isopeptide bond molecular adhesive can be the fusion of the N-terminus of the antigen with the C-terminus of the second molecule of the adhesive, or the fusion of the C-terminus of the antigen with the N-terminus of the second molecule of the adhesive. Fusion expression technology is well known in the art. The specific implementation steps include amplifying the coding region of the second molecule and the coding region of the antigen to be expressed using PCR technology, then inserting them into an expression vector using restriction endonucleases, and transforming them into expression bacteria for expression. In addition, to obtain a saccharide antigen (including a carrier protein), genetically engineered bacteria that have been introduced with an exogenous protein glycosylation system can be used. The expressed antigen can be purified and identified using conventional techniques, including SDS-PAGE, Western Blot, multidimensional liquid chromatography, nickel column affinity chromatography, molecular sieve chromatography, and the like.

[0086] Therefore, in the CpG adjuvant of the present invention and the antigen fixed covalent binding method and the CpG adjuvant antigen conjugate prepared according to the method, the antigen can be a protein antigen and a saccharide antigen, wherein for saccharide antigens, the antigen is a glycoprotein form, and the protein is used as a carrier. Further, the antigen includes but is not limited to protein antigens or saccharide antigens derived from bacteria, viruses, fungi, spirochetes, mycoplasmas, rickettsiae, chlamydiae, parasites or tumors. Further, the protein antigen is a Brucella protein antigen Omp19 and a novel coronavirus antigen RBD, and the saccharide antigen is a Shigella surface polysaccharide OPS (O-antigen polysaccharide). The present invention, by being combined with different antigens, proves that the method is applicable to a variety of antigens and has wide applicability.

[0087] In the present invention's method for site-specific covalent binding of a CpG adjuvant to an antigen and the CpG adjuvant-antigen conjugate prepared according to the method, a CpG adjuvant with an ssDNA sequence matching the HUH system added to its 5' or 3' end can be obtained by chemical synthesis. To further enhance the CpG adjuvant's efficacy and prevent the degradation of single-stranded nucleic acids, the CpG deoxyribonucleotides can also be thiolated, including by chemical synthesis. These techniques are conventional in the art.

[0088] In the method for site-specific covalent binding of CpG adjuvant to antigen of the present invention, the in vitro connection of the second molecule of isopeptide bond molecular adhesive fusion antigen and the above-mentioned first molecule conjugate of CpG-isopeptide bond molecular adhesive can be achieved by mixing the two and placing them at room temperature or low temperature for a period of time, such as overnight, through spontaneous formation of isopeptide bonds. This process does not require the addition of catalysts or other additional auxiliary materials. This in vitro connection technology is well known in the art.

[0089] The CpG adjuvant-antigen conjugate obtained by the site-specific covalent binding method of the CpG adjuvant and antigen of the present invention can be directly used in vaccines. Compared with the antigen and adjuvant mixed system prepared by the traditional method, the vaccine obtained by this method has better immune effect, uses less adjuvant, and saves costs.

[0090] Because the present invention uses the reported Brucella protein antigen Omp19, the novel coronavirus antigen RBD, and the Shigella polysaccharide antigen, a long-standing concern of the inventors, as models to verify the versatility of the present invention's CpG adjuvant site-specific covalent binding technology, the method of the present invention is applicable to the development and preparation of various vaccines. There are many different antigens, CpG adjuvants, HUH proteins, corresponding ssDNA sequences, and isopeptide bond molecular adhesives. Substituting other antigens, other CpG adjuvants, other HUH proteins, corresponding ssDNAs, and other adhesives can achieve the same effect. Therefore, based on the remarkable versatility of this method, the use of different antigens, CpG adjuvants, HUH proteins, corresponding ssDNAs, and isopeptide bond molecular adhesives should also fall within the scope of protection of this patent.

[0091] The present invention is further illustrated below with reference to specific examples and accompanying figures. These examples are illustrative and do not constitute limitations on the claimed technical solutions of the present invention. Furthermore, the pET28a(+) plasmid, P34 vector, E. coli, HEK293T cells, and the like in the following examples were constructed and maintained according to conventional techniques in the art and can also be obtained commercially.

[0092] Example 1: Construction of ST-HUH fusion protein expression plasmid

[0093] The reagents used in this example are as follows: LB medium (0.5% yeast powder, 1% sodium chloride, and 1% peptone); Escherichia coli BL21 (DE3) competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; restriction endonucleases NcoI and XhoI were purchased from New England Biolabs Inc.; plasmid extraction kit, DNA gel product recovery kit, and PCR product recovery kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0094] The SpyTag-HUH fusion protein (hereafter referred to as ST-HUH) expression vector was constructed using enzyme ligation. Two EAAAK rigid protein linkers were used to connect the HUH protein amino acid sequence to the SpyTag amino acid sequence at the C-terminus. After codon optimization, the ST-HUH protein amino acid sequence was fully synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Sangon Biotech).

[0095] Primers ST-HUH-F: GCCATGGGCGCGCACATCG (SEQ ID NO.34) and ST-HUH-R: GCTCGAGAACCGCGCTGGTC (SEQ ID NO.35) were designed based on the ST-HUH sequence. ST-HUH fragment was amplified using ST-HUH as a template. PCR was used to verify and recover the target fragment of 443 bp. The ST-HUH fragment and pET28a(+) plasmid were double-digested with restriction endonucleases NcoI and XhoI. The two fragments were added to the same system at the same time, connected with T4 ligase at 16°C overnight, and then transformed into BL21 (DE3) competent cells. 800 μL LB medium was added and cultured in a shaker at 37°C at 220 r / min for 2 hours. The bacterial liquid was taken out and spread all on LB solid medium containing kanamycin resistance. After culture in a constant temperature incubator at 37°C for 12 hours, a monoclonal strain was picked and inoculated into LB liquid medium (Kanamycin). + ), placed in a shaking incubator at 37°C and 220r / min for 12h, the pET28a plasmid containing the ST-HUH gene was named pET28a-ST-HUH, and the BL21 (DE3) strain containing the pET28a-ST-HUH plasmid was named BL21 / ST-HUH. The accuracy of the final expression vector was confirmed by enzyme digestion and sequencing. The specific operation method is to collect the cultured bacterial solution and centrifuge it to remove the supernatant. The plasmid was extracted using the Tiangen Plasmid Extraction Kit, and then the gene sequence of the pET28a-ST-HUH plasmid was determined. The results are as follows Figure 2As shown in the figure, the newly constructed pET28a-ST-HUH plasmid has a 100% match with the theoretical design sequence. In summary, the pET28a-ST-HUH plasmid was successfully constructed. Finally, the BL21 / ST-HUH strain was stored at -80°C.

[0096] Example 2: Purification and preparation of ST-HUH protein

[0097] To verify the protein expression level of the BL21 / ST-HUH strain, the BL21 / ST-HUH strain was inoculated into 5 mL of LB liquid medium at a ratio of 1:100 and cultured at 37°C at 220 r / min for 12 h. After three generations of inoculation using this method, the BL21 / ST-HUH strain was induced to express the ST-HUH target protein after re-inoculation. The specific operation method was to take 50 μL of the bacterial solution and transfer it to LB liquid medium and culture it at 37°C at 220 r / min until the bacterial solution OD 600nm When the value is about 0.6, add 5μL 0.6mmol / L IPTG solution and culture at 30℃ and 220r / min for 12h. First, prepare the whole bacterial sample. The specific operation method is to take 1mL of bacterial solution and centrifuge it. After discarding the supernatant, take 100μL deionized water to resuspend the bacteria, add an equal volume of 2×SDS buffer (110mol / L SDS, 40mmol / L DTT, 0.6mmol / L bromophenol blue, 100mmol / L Tris-HCl, 16% glycerol) and mix well. Boil in a boiling water bath for 10min, centrifuge at 12000r / min for 10min, slowly aspirate the supernatant and load it into the polyacrylamide gel loading well. After the sample is separated by electrophoresis in the polyacrylamide gel, the gel is stained with Coomassie Brilliant Blue. The Coomassie Brilliant Blue staining experiment was performed using the eStain L1 protein stainer. For specific operation methods, please refer to the operating instructions of the eStain L1 protein stainer. The experimental results are as follows Figure 3As shown in A, the BL21 / ST-HUH whole bacterial sample has an obvious protein expression band at the 15kDa position, and the position of the target band is consistent with the theoretical protein molecular weight of the ST-HUH protein. Western-Blot experiments were used to further verify the protein expression level of the BL21 / ST-HUH strain. The whole bacterial protein sample preparation and gel separation operation methods are the same as the Coomassie Brilliant Blue staining experiment. The difference is that a rapid wet transfer instrument is used to transfer the protein sample in the gel to a PVDF membrane. Subsequently, the PVDF membrane was blocked with 5% skim milk at 37°C for 1 hour, and the excess blocking solution was washed away with TBST. The PVDF membrane was placed in an HRP-labeled Anti-his antibody (purchased from Abmart Pharmaceutical Technology (Shanghai) Co., Ltd., abmart, model Code M20020L) diluted at a ratio of 1:3000 with TBST, incubated at 37°C for 1 hour, and the residual antibody solution was washed away with TBST solution. Finally, the PVDF membrane was developed and analyzed using a chemiluminescence imaging system. The experimental results are shown in Figure 2. Figure 3 As shown in Figure B, similarly, a specific protein band was observed at 15 kDa in the BL21 / ST-HUH whole-cell protein sample, which is consistent with the theoretical molecular weight of the ST-HUH protein. Therefore, in summary, the BL21 / ST-HUH strain constructed in this study is capable of correctly expressing the ST-HUH protein.

[0098] ST-HUH protein was purified and prepared as follows: BL21 / ST-HUH bacterial solution was inoculated into 20 mL LB medium at a ratio of 1:100, and cultured at 37°C and 220 rpm for 7 h. The bacterial solution was further transferred to 2 L LB liquid medium and cultured at 37°C and 220 rpm for 3 h until the bacterial solution OD reached 0. 600nmWhen the pH value was approximately 0.6, the cells were induced with IPTG and cultured at 30°C for 12 hours, and the cells were harvested. The cells were resuspended in 200 mL of L1 lysis buffer (50 mmol / L Tris-HCl, 350 mmol / L NaCl, 10 mmol / L imidazole, pH 8.0), disrupted by high-pressure homogenizer, and centrifuged to obtain the supernatant. The His-tagged ST-HUH protein was purified using nickel affinity chromatography. The specific procedure was as follows: a nickel affinity chromatography column (Roche, model number: Lot 64698700) was equilibrated with approximately 3 column volumes of W1 equilibration buffer (50 mmol / L Tris-HCl, 350 mmol / L NaCl, 10 mmol / L imidazole, pH 8.0). The supernatant was loaded into tube A at a flow rate of 2 mL / min. The nickel column was equilibrated with W1 equilibrium solution, and finally, the target protein was eluted with eluent E2 (50mmol / LTris-HCl, 1mmol / L NaCl, 500mmol / L imidazole, pH 8.0) and collected. The collected samples were separated by 12% polyacrylamide gel electrophoresis and verified by Coomassie brilliant blue staining. The target protein samples were combined and concentrated using an ultrafiltration tube with a molecular weight cutoff of 10kDa (Millipore, model number Lot R1JB38750) and a Superdex G75 chromatography column (General Electric Company or GE, model number Lot 10305626) (1.6×90cm 2 ) to further purify the ST-HUH protein and replace the buffer system. The specific operation method is to balance the Superdex G75 chromatography column (GE) (1.6×90cm) with molecular sieve buffer (50mmol / L Tris-HCl, 350mmol / L NaCl, pH 8.0). 2 ), the concentrated sample was loaded at a flow rate of 1.5 mL / min, and the protein sample was collected. The protein sample was also verified by Coomassie Brilliant Blue staining. The experimental results are shown in Figure 2. Figure 4 The results showed that high-purity ST-HUH protein was successfully purified through nickel affinity chromatography and molecular sieve purification. The ST-HUH protein was concentrated, quantified using the BCA protein quantification method, and stored at -80°C.

[0099] Example 3: Ligation of ST-HUH and HUH-CpG 1018

[0100] The HUH-CpG 1018 sequence is as follows: 5'-AAGTATTACCAGT*G*A*C*T*G*T*G*A*A*C*G*T*T*C*G*A*G*A*T*G*A-3', where AAGTATTACCAG is the specific recognition ssDNA sequence matching HUH, TGACTGTGAACGTTCGAGATGA is the CpG 1018 sequence, and * indicates thiolation modification. The HUH-CpG 1018 sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd. To obtain a conjugate of ST-HUH and HUH-CpG 1018 (hereinafter referred to as Tag-HUH-CpG 1018), ST-HUH and HUH-CpG 1018 were mixed at a molar mass ratio of 1.8:1, and an equal volume of 2×HEPES buffer (100 mmol / L Hepes, 2 mol / L NaCl, 2 mmol / L MgCl2, 2 mmol / L MnCl2, pH 8.0) was added. The mixture was incubated in a 37°C metal bath for 20 min. The conjugation results were verified using Coomassie Brilliant Blue staining and Western Blot experiments. The specific operation method was the same as in Example 2, except that a 4%-20% gradient polyacrylamide gel was used for electrophoresis separation of the samples. The experimental results are shown in FIG. Figure 5 As shown, Figure 5 A is the result of Coomassie brilliant blue staining experiment. Figure 5Figure B shows the Western Blot results. Both experimental results show a target band at 26 kDa in the lane containing the ST-HUH and HUH-CpG 1018 conjugate system, which is shifted upward compared to the ST-HUH sample lane. Theoretically, the molecular weight of the ST-HUH protein conjugated to HUH-CpG 1018 should be increased, meaning the position of the conjugate in the gel should shift upward. This is consistent with the experimental results, indicating that the ST-HUH protein and HUH-CpG 1018 were successfully conjugated. Furthermore, SDS and DTT denaturants failed to dissociate the bond between ST-HUH and HUH-CpG 1018 in the conjugate Tag-HUH-CpG 1018, indicating that the HUH protein-ssDNA conjugation system is irreversible. Using this HUH protein-ssDNA conjugation system in this study allowed the construction of a structurally stable intermediate for the SpyTag and CpG adjuvant conjugate. To further verify the coupling results of ST-HUH and HUH-CpG 1018, the 3' end of HUH-CpG 1018 was labeled with FAM fluorescence (hereinafter referred to as FHUH-CpG 1018). The sequence of FAM fluorescence-labeled HUH-CpG 1018 is as follows: 5'-AAGTATTACCAGT*G*A*C*T*G*T*G*A*A*C*G*T*T*C*G*A*G*A*T*G*A-FAM-3', where * indicates thiolation modification. ST-HUH and FHUH-CpG 1018 were connected in the same way. The difference was that the connection results of ST-HUH and FHUH-CpG 1018 were verified by fluorescence luminescence method. The specific operation method was as follows: after the connection product was separated by polyacrylamide gel electrophoresis, it was developed and imaged using a chemiluminescence imaging analysis system (Bio-Rad). The results are shown in Figure 3. Figure 5 As shown in Figure C, compared with FHUH-CpG 1018, the ST-HUH and FHUH-CpG1018 connection system in the gel has a fluorescent band at a higher position, and this fluorescent band is consistent with the theoretical molecular weight of the conjugate Tag-HUH-CpG 1018 of 26 kDa, indicating that FHUH-CpG 1018 is successfully connected to the ST-HUH protein.

[0101] Example 4: Expression and purification of SC-Omp19

[0102] Outer membrane lipoprotein 19 (Omp19) is a protein present on the surface of Brucella bacteria. This protein is anchored to the bacterial outer membrane and plays a key role in bacterial attachment and invasion of host cells. Studies have shown that Omp19 can induce a Th1 immune response, making it an important target for combating Brucella infection. It is considered a promising candidate component of a subunit vaccine against brucellosis, making the study of Omp19 of great significance.

[0103] To verify the method of the present invention, this example uses a fusion protein of an isopeptide bond molecular adhesive Catcher and the Brucella outer membrane protein Omp19 as an antigen, hereinafter referred to as SC-Omp19. The Brucella outer membrane protein Omp19 is fused to the C-terminus of the isopeptide bond molecular adhesive Catcher sequence, codon optimized, and an expression plasmid pET28a-Omp19 of SC-Omp19 is constructed using Goldengate and enzyme ligation. The plasmid is transformed into BL21 (DE3) competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) using chemical transfection, and the strain is named BL21 / Omp19. The BL21 / Omp19 strain is preserved in this laboratory.

[0104] The SC-Omp19 protein was prepared by the same method as in Example 2, except that the collected cells after culture were resuspended with 200 mL of equilibrium solution A (10 mmol / L imidazole, 20 mmol / L Tris-HCl, 150 mmol / L NaCl, 0.1% Tween-20, pH 7.0), and the affinity chromatography nickel column was equilibrated with 3 column volumes of equilibrium solution A. The protein was eluted with eluent B (500 mmol / L imidazole, 20 mmol / L Tris-HCl, 150 mmol / L NaCl, 0.1% Tween-20, pH 7.0) and collected. The verification method for the collected samples was the same as in Example 2. Similarly, the target protein was combined according to the verification results and further subjected to molecular sieve purification. The difference was that a Superdex G200 chromatography column (General Electric Company or GE, model number Lot 10341109) (1.6×90 cm 2 ) was purified by molecular sieve purification, and the chromatography column was equilibrated with 1× PBS (pH 7.0) buffer. Figure 6 The peak of SC-Omp19 protein purified by molecular sieve is shown in Figure 1. There is only one peak at 80mL–120mL. The Coomassie brilliant blue staining method is also used to verify the sample after molecular sieve purification. The specific operation method is the same as in Example 2. The experimental results are shown in Figure 1. Figure 7 The results showed that a protein band at the 31 kDa position was visible in lanes 1-14. The protein concentration first increased and then decreased over time. This verification result was consistent with the molecular sieve peak of the SC-Omp19 protein, and the position of the protein band was consistent with the theoretical molecular weight of SC-Omp19. Subsequently, the target protein samples in lanes 10-15 were combined, and the SC-Omp19 protein concentration was measured using a BCA protein quantification kit (Thermo). SC-Omp19 was then frozen at -80°C. After purification by nickel column affinity chromatography and molecular sieve chromatography, the SC-Omp19 protein achieved the target purity and yield.

[0105] Example 5: Preparation of CpG-Omp19

[0106] In order to prepare the CpG-Omp19 conjugate, the SC-Omp19 prepared in Example 4 was connected to the Tag-HUH-CpG 1018 prepared in Example 3. The specific operation method is as follows: First, SC-Omp19 and Tag-HUH-CpG1018 were mixed at a molar ratio of 1.8:1. After thorough mixing, the mixture was placed in a 4°C refrigerator and allowed to stand for 12 hours. Subsequently, the connection result was verified by Coomassie Brilliant Blue staining. The experimental results are shown in FIG. Figure 8 As shown in the figure, the first lane sample is ST-HUH, the second lane sample is Tag-HUH-CpG 1018, the third lane sample is SC-Omp19, and the fourth lane sample is a mixture of SC-Omp19 and STH-CpG1018. The result shows that the first lane has a band at the 15kDa position, which is consistent with the theoretical molecular weight of ST-HUH protein. The second lane has a band at the 25kDa position, which is consistent with the theoretical molecular weight of Tag-HUH-CpG1018. The third lane has a band at the 31kDa position, which is consistent with the theoretical molecular weight of SC-Omp19 protein. There are three bands in the fourth lane, band A is located at the 55kDa position, which is consistent with the theoretical value of SC-Omp19 and Tag-HUH-CpG 1018 conjugate (hereinafter referred to as CpG-Omp19), indicating that SC-Omp19 and Tag-HUH-CpG1018 are successfully connected. Band B is located at the 31 kDa position, which is the same as the SC-Omp19 protein in the third lane, indicating that a small amount of incompletely connected SC-Omp19 protein exists in the ligation system of SC-Omp19 and Tag-HUH-CpG 1018. Band C is located at the 25 kDa position, which is consistent with Tag-HUH-CpG 1018 in the second lane, indicating that a small amount of incompletely connected Tag-HUH-CpG1018 exists in the ligation system of SC-Omp19 and Tag-HUH-CpG 1018.

[0107] Example 6: Purification of CpG-Omp19 Conjugate

[0108] After Omp19 is linked to Tag-HUH-CpG 1018, a small amount of unbound SC-Omp19, Tag-HUH-CpG 1018, and HUH-CpG 1018 adjuvant remains in the connection system. It is necessary to remove the unbound substances in the connection system to obtain a high-purity CpG-Omp19 conjugate. Gel filtration chromatography was used for separation and purification. The specific operation method was the same as in Example 2, except that the same chromatography column and chromatography column equilibration buffer as in Example 4 were used, and samples were collected according to the peak time. The collected samples were also verified by Coomassie Brilliant Blue staining experiment, and the results are shown in FIG. Figure 9The results showed that there was a single band at the 55kDa position in lanes 2-5 of the gel, which was consistent with the theoretical molecular weight of the CpG-Omp19 conjugate, and there was a single band at the 25kDa position in lane 7, which was consistent with the theoretical molecular weight of STH-CpG. Figure 10 This is the peak plot of the molecular sieve purification of the CpG-Omp19 conjugate. Analysis of the peaks, corresponding to the results of the Coomassie Brilliant Blue staining experiment, indicates that Peak 1 represents the CpG-Omp19 conjugate peak, Peak 2 represents the Tag-HUH-CpG 1018 peak, and Peak 3 represents the HUH-CpG 1018 peak. Due to the low amount of SC-Omp19 protein remaining in the conjugation system, no distinct SC-Omp19 peak is observed in the molecular sieve peak plot, nor is a distinct protein band observed on the Coomassie Brilliant Blue-stained gel. In summary, molecular sieve purification effectively removes unreacted products from the SC-Omp19 and Tag-HUH-CpG 1018 conjugate system, yielding a highly pure CpG-Omp19 conjugate. Subsequently, target samples from lanes 2-5 were pooled and concentrated, and after protein quantification, stored at -80°C.

[0109] Example 7: Immunoassay of CpG-Omp19

[0110] Humoral immune response is an important indicator of the immune effect of the vaccine. ELISA experiments can detect the specific antibody titer in the serum of immunized mice. In this example, BALB / c mice were randomly divided into 7 groups, namely PBS group, Omp19 group (labeled as Omp19), Omp19+Al(OH)3 group (labeled as Omp19+Al), CpG-Omp19+Al(OH)3 group (labeled as CpG-Omp19+Al), CpG 1018(H)+Omp19+Al(OH)3 group (labeled as HUH-CpG1018(H)+Omp19+Al), CpG-Omp19 group (labeled as CpG-Omp19), CpG 1018(L)+Omp19+Al(OH)3 group (labeled as HUH-CpG 1018(L)+Omp19+Al). Each experimental group received a single vaccination containing 20 μg of Omp19 protein and 100 μg of Al(OH)3 as an adjuvant. In addition, the CpG 1018(H)+Omp19+Al(OH)3 group also added 50 μg of CpG1018 as an adjuvant, while the CpG 1018(L)+Omp19+Al(OH)3 group added 6.9 μg of CpG1018. Each mouse in the PBS group was inoculated with 100 μL of 1x concentration of phosphate buffered saline (PBS). The mice were subcutaneously immunized on days 0 and 14, and blood was collected from the tail vein on days 7 and 21. The ELISA experiment was used to detect the IgG antibody titer of the serum on day 21, and the test results are as follows. Figure 11The results showed that the IgG antibody levels elicited in mice in the CpG-Omp19+Al(OH)3 group were significantly higher than those in the CpG 1018(H)+Omp19+Al(OH)3 group (****, P<0.0001, error means standard error), 28-fold higher than those in the CpG 1018(H)+Omp19+Al(OH)3 group, and the CpG-Omp19+Al(OH)3 group had the lowest intra-group scatter. This suggests that when the antigen and aluminum adjuvant doses are the same, co-delivery of the antigen and CpG adjuvant has a superior immune response when the CpG adjuvant dose is consistent. Similarly, the IgG antibody levels elicited in mice in the CpG-Omp19 group were significantly higher than those in the Omp19 group (****, P<0.0001, error means standard error). In summary, the design method for coupling antigens to CpG adjuvants can effectively enhance the immune protective effect of antigens while reducing the CpG adjuvant dose.

[0111] Example 8: Expression and purification of SC-OPS

[0112] To verify that the method of the present invention is also applicable to sugar antigens, this example constructs a Shigella polysaccharide protein antigen coupled with SpyCatcher, hereinafter referred to as SC-OPS. The glycosylation sequence 4573 recognized by the glycosyltransferase PglL is fused to the C-terminus of the SpyCatcher sequence to obtain a SpyCatcher protein (named as SC-OPS glycoprotein) loaded with the OPS polysaccharide antigen. The preparation process of Shigella 301DWP strain with a deletion of the O-antigen ligase gene has been published in CN105695497A, i.e., the avirulent Shigella flexneri 2a 301ΔpCPΔwaaI with a defect in the O-antigen ligase gene waaI, and can be obtained from the Institute of Bioengineering, Academy of Military Medical Sciences.

[0113] The SC-OPS glycoprotein was purified using the same method as in Example 2, except that 8 L of bacterial solution was required to induce expression in order to obtain sufficient glycoprotein. 4573C The 301DWP strain carrying the plasmid was cultured in LB medium for 7 h, inoculated again into 8 L LB liquid medium, and cultured in a shaking incubator at 37 °C at 220 r / min until the OD 600nmWhen the pH value was 0.6, a 0.6 mol / L IPTG solution was added to the culture at a volume ratio of 1:1000 and incubated at 30°C for 12 hours. The SC-OPS glycoprotein was also purified using nickel column affinity chromatography and gel filtration chromatography. After purification, the collected sample was tested for purity using Coomassie Brilliant Blue staining. Since SC-OPS is a glycoprotein, its structure demonstrates that sugar chains of varying lengths can be attached to the SpyCatcher protein. Therefore, when the SC-OPS glycoprotein is separated by polyacrylamide gel electrophoresis, Coomassie Brilliant Blue staining reveals ladder-like bands. Figure 12 This is the result of the Coomassie Brilliant Blue staining experiment. The results show that lanes 1-7 all have ladder-shaped bands unique to glycoproteins. In this experiment, the ladder-shaped bands are SC-OPS glycoproteins. Figure 13 The peak of the molecular sieve-purified SC-OPS glycoprotein is analyzed in correspondence with the results of the Coomassie Brilliant Blue staining experiment. The protein peak between 80mL and 100mL is considered to be the target glycoprotein SC-OPS. Finally, the target samples were combined and concentrated, and protein and sugar quantification were performed separately before being frozen at -80°C.

[0114] Example 9: Preparation of CpG-OPS

[0115] SC-OPS was linked to Tag-HUH-CpG 1018 using the same method as in Example 5 to prepare a conjugate of OPS and CpG adjuvant (hereinafter referred to as CpG-OPS). When SC-OPS was linked to Tag-HUH-CpG 1018, SC-OPS with sugar chains of varying lengths could be linked to Tag-HUH-CpG 1018. Therefore, the conjugate CpG-OPS and unlinked SC-OPS overlapped in the gel, and Coomassie Brilliant Blue staining and Western Blot experiments were insufficient to demonstrate successful conjugation of SC-OPS to ST-CpG 1018. In order to fully detect the results of the ligation reaction, FHUH-CpG 1018 and ST-HUH linker Tag-HUH-CpG1018 (hereinafter referred to as FTag-HUH-CpG 1018) were used to connect with SC-OPS, and the blue light excitation FAM fluorescence luminescence method was used to verify the connection results of SC-OPS and FTag-HUH-CpG 1018. The specific operation method is to connect SC-OPS and FTag-HUH-CpG 1018 at a molar ratio of 1.3:1, and the connection products are separated by polyacrylamide gel electrophoresis, and then fluorescence luminescence experiment, Coomassie brilliant blue staining experiment and Western-Blot experiment are performed respectively. The fluorescence luminescence experiment results are shown in Figure 2. Figure 14A, The samples loaded in wells 1-5 of the polyacrylamide gel are, in order: ST-HUH protein, FTag-HUH-CpG 1018, FTag-HUH-CpG 1018 coupled with SC-OPS, SC-OPS glycoprotein, and FHUH-CpG 1018. Theoretically, when FTag-HUH-CpG 1018 is successfully coupled to the SC-OPS glycoprotein, a fluorescent ladder-like band should be observed in the fluorescence experiment. The fluorescence experiment results showed a fluorescent ladder-like band in lane 3, which is consistent with the theoretical results and indicates that FTag-HUH-CpG 1018 is successfully coupled to SC-OPS. Subsequently, the polyacrylamide gel was subjected to Coomassie Brilliant Blue staining and Western Blot experiments. Theoretically, when FTag-HUH-CpG1018 is successfully linked to SC-OPS, the position of the coupling product in the polyacrylamide gel will shift upward. If there is unlinked SC-OPS in the ligation reaction system, the coupling product may overlap with the position of the unreacted SC-OPS, resulting in the observation of darker trapezoidal bands in both the Coomassie Brilliant Blue staining and Western Blot experiments. Figure 14 B is the result of Coomassie brilliant blue staining experiment. Figure 14 C shows the results of a Western blot analysis of the conjugated product using an anti-His tag antibody. Both experiments show a darker glycoprotein ladder in lane 3, consistent with theoretical analysis. Overall, these three experiments demonstrate successful conjugation of SC-OPS and FTag-HUH-CpG 1018.

[0116] Example 10: Ligation of ST-HUH and HUH-CpG 2006

[0117] In order to verify that the method of the present invention is also applicable to various CpG adjuvants, CpG2006 was modified in this example, and HUH-CpG 2006 was designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequence is as follows: 5'-AAGTATTACCAGT*C*G*T*C*G*T*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T-3', where AAGTATTACCAG is the specific recognition ssDNA sequence matching HUH, TCGTCGTTTTGTCGTTTTGTCGTT is the CpG 2006 (or CpG 2006 / 7909) sequence, and * indicates a thiolation modification. The conjugate of ST-HUH and HUH-CpG 2006 (hereinafter referred to as Tag-HUH-CpG 2006) was obtained using the same experimental method as in Example 3, except that ST-HUH and HUH-CpG 2006 were linked at a molar ratio of 1:1. The linked system was also verified by Coomassie Brilliant Blue staining. Figure 15As shown in Figure A, theoretically, the molecular weight of ST-HUH conjugated to HUH-CpG 2006 increases, and the protein band shifts upward. Coomassie Brilliant Blue staining reveals a band at 27 kDa in the HUH-CpG 2006 / ST-HUH conjugated system. This band is located higher than that of ST-HUH, consistent with theoretical results and indicating successful conjugation of ST-HUH and HUH-CpG 2006. In addition, the 3' end of HUH-CpG 2006 was labeled with FAM fluorescence using the same method as in Example 3. Hereinafter, it is referred to as FHUH-CpG 2006. The sequence of FHUH-CpG 2006 is as follows: 5'-AAGTATTACCAGT*C*G*T*C*G*T*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T-FAM-3', where AAGTATTACCAG is the specific recognition ssDNA sequence matching HUH, TCGTCGTTTTGTCGTTTTGTCGTT is CpG 2006, FAM is the FAM fluorescence label, and * indicates thiolation modification. ST-HUH was linked to FHUH-CpG 2006, and after polyacrylamide gel electrophoresis, the fluorescence luminescence experiment results were as follows: Figure 15 As shown in Figure B, compared to FHUH-CpG 2006, the ST-HUH-FHUH-CpG 2006 conjugate system exhibits a band at 28 kDa. This band position is consistent with the theoretical molecular weight of the Tag-HUH-CpG 2006 conjugate, further demonstrating successful conjugation of ST-HUH and HUH-CpG 2006. In summary, the antigen-CpG adjuvant conjugation method designed in this invention is equally applicable to different CpG adjuvants. This demonstrates the universal applicability of the design method to CpG adjuvants.

[0118] Example 11: Expression and purification of SC-R antigen

[0119] In order to verify that the method of the present invention is applicable to a variety of antigens, this example constructs a fusion protein of SpyCatcher and the receptor domain RBD of the novel coronavirus spike protein (hereinafter referred to as SC-R). RBD is fused to the C-terminus of SpyCatcher, and after codon optimization of the SC-R protein amino acid sequence, the SC-R gene is inserted into the expression vector P34 by whole gene synthesis and double enzyme digestion. The accuracy of the final expression vector is confirmed by enzyme digestion and sequencing, and finally transferred to the DH5α cloning strain. The transfection-grade plasmid is extracted by a plasmid extraction kit, and then the plasmid is transfected into mammalian cells HEK293 by a transfection reagent for transient expression, and then the SC-R protein is purified by affinity chromatography.

[0120] The specific operation method is to pipette 80-100ng of the expression plasmid containing the SC-R gene into the prepared DH5α competent cells. The competent cells after the addition of the plasmid are transformed by heat shock. Subsequently, the transformed competent cells are added to LB liquid medium and placed in a shaker at 37°C, 200 rpm and shaken for about 30 minutes. Remove the cultured competent cells, aspirate a portion of the suspension and spread it on a plate containing ampicillin resistance, and place it in an incubator at 37°C for overnight incubation. Pick a single clone from the fresh culture plate and add it to 2-5mL LB medium and incubate at 37°C, 200 rpm for 8 hours. Inoculate it into 200mL LB medium at a ratio of 1:500 and incubate it at 37°C, 200 rpm for 16 hours. Collect the cultured bacterial liquid and centrifuge it, and remove the supernatant. Use Qiagen transfection-grade plasmid extraction kit for plasmid extraction.

[0121] HEK293 cell recovery and passaging. Turn on the water bath to 37°C in advance; preheat the culture medium at 37°C in advance. Take out the frozen HEK293 cells from the liquid nitrogen tank. Immediately put the frozen cells into a 37°C water bath, shake them gently to melt quickly (about 1 minute), and take them out. Disinfect the outer wall of the tube with 75% ethanol, put it in a biosafety cabinet, transfer it to a 15mL centrifuge tube containing 10mL culture medium, and centrifuge at 800r / min for 5min. After centrifugation, remove the supernatant from the cells, take a small amount of fresh culture medium to resuspend the cells, and then transfer them to the culture flask, add fresh culture medium and shake gently to disperse the cells evenly, take the cell count and viability test, and control the density at 3-4×10 5 cells / mL, with a viability of >95%. Place in an incubator at 110 rpm, 37°C, and 5% CO2. After culturing for 2-3 days, the cells reached a density of 2.0×10 6 When the cell density reaches about 2×10 cells / mL, the cells need to be passaged. Remove part of the culture medium from the culture flask and discard it. Then add fresh culture medium to the culture flask and dilute the remaining cell culture (the remaining cell culture depends on the cell density, culture volume, density after dilution, etc.). Place it in an incubator at 110 rpm, 37°C, 5% CO2, and continue to culture. The cell density and viability should be tested every day. When the cell density reaches 2×10 6 When the cell count was around 10 cells / mL, the cells were passaged.

[0122] SC-R plasmid was transfected into HEK293 cells. First, HEK293 cells were suspended and cultured to 1000 mL 1 day before transfection, with an inoculation density of 1×10 6 cells / mL, and cultured in an incubator at 110 rpm, 37°C, and 5% CO2. On the day of transfection, the cell density was controlled at 1-1.5×10 6cells / mL. Add DNA and transfection reagent to transfection buffer, mix thoroughly, and incubate at 37°C. Add the DNA-transfection reagent mixture to the cells to be transfected and incubate in an incubator at 110 rpm, 37°C, 5% CO2. Approximately 4-6 days after transfection, remove the cell culture, centrifuge, and collect the supernatant or cells.

[0123] Purification of SC-R protein. The cell culture medium after 5 days of transfection was centrifuged, the supernatant was filtered with a 0.22 μm filter, and dialyzed into 1× PBS buffer, pH 7.4 at 4°C. After dialysis, it was purified using a Ni-IDA column. The results are shown in the figure. Figure 16 As shown, after purification by Ni-IDA affinity chromatography, the target protein SC-R was mainly present in the elution fractions Lane 3-5. The above target protein was collected and dialyzed into 1×PBS, 10% Glycerol, pH 7.4. After dialysis, it was filtered with a 0.22μm filter and packaged and frozen at -80°C.

[0124] The stability of SC-R protein was tested by freeze-thaw experiment. The specific operation method was to take a tube of SC-R protein frozen at -80°C, place it in an ice water bath for 5-10 minutes to slowly thaw, and then place it in a 4°C refrigerator for 0.5 hours. No abnormality was observed, indicating that the protein freeze-thaw experiment was normal.

[0125] The SC-R protein concentration was determined using a Bradford protein assay kit.

[0126] The purified SC-R protein was further verified by Coomassie Brilliant Blue staining and Western Blot detection. Figure 17 As shown, the results showed that the purity of SC-R protein was greater than 90%.

[0127] Example 12: Preparation of CpG-R

[0128] The purified SC-R in Example 11 was connected to Tag-HUH-CpG 2006 to obtain CpG-R. The specific operation method was the same as that in Example 5. The difference was that SC-R and Tag-HUH-CpG 2006 were mixed at a molar ratio of 2:1. The results of the Coomassie brilliant blue staining experiment were as follows: Figure 18As shown, the samples loaded into wells 1-5 of the polyacrylamide gel were, in order, ST-HUH protein, Tag-HUH-CpG 2006, SC-R conjugated with Tag-HUH-CpG 2006, SC-R conjugated with ST-HUH, and SC-R. The experimental results showed a single band at 15 kDa in lane 1, consistent with the theoretical molecular weight of ST-HUH protein; a single band at 27 kDa in lane 2, consistent with the theoretical molecular weight of Tag-HUH-CpG 2006; a ladder-shaped band at 53 kDa in lane 4, consistent with the theoretical molecular weight of the SC-R conjugate with ST-HUH protein; and a ladder-shaped band at 38 kDa in lane 5, consistent with the theoretical molecular weight of SC-R. The theoretical molecular weight of CpG-R is 64 kDa, 27 kDa larger than that of SC-R and 37 kDa larger than that of Tag-HUH-CpG 2006. In the third lane, there are two bands at molecular weights of 64 kDa and 27 kDa, respectively. The 64 kDa band is considered to be the conjugate of SC-R and Tag-HUH-CpG 2006 (hereinafter referred to as CpG-R), and the 27 kDa band is considered to be Tag-HUH-CpG 2006. This indicates that SC-R and Tag-HUH-CpG 2006 are successfully conjugated and that SC-R is completely connected to Tag-HUH-CpG 2006, but some Tag-HUH-CpG 2006 remains.

[0129] Example 13: Purification of CpG-R

[0130] Since unbound HUH-CpG 2006, Tag-HUH-CpG 2006 and part of SC-R remained in the binding product of Example 12, CpG-R was purified by gel filtration chromatography to remove excess HUH-CpG 2006 and Tag-HUH-CpG 2006. Figure 19 As shown in the peak diagram, four peaks appeared, which were CpG-R, SC-R, Tag-HUH-CpG 2006 (labeled as STH-CpG) and HUH-CpG 2006 in chronological order. The Coomassie brilliant blue staining method was also used to verify the sample after molecular sieve purification, and the specific operation method was the same as in Example 2. The experimental results are shown in FIG. Figure 20The results showed that CpG-R protein bands were visible at the 64kDa position in lanes 3-15, and two bands, CpG-R and SC-R, were visible in lanes 10-18. As the collection volume increased, Tag-HUH-CpG 2006 and HUH-CpG 2006 eluted in sequence. This verification result was consistent with the peak diagram of CpG-R purification by gel filtration chromatography, and the position of the protein bands was consistent with the theoretical molecular weight of CpG-R. Subsequently, the target protein samples in lanes 3-10 were combined, and the concentration of the CpG-R conjugate was detected using a BCA protein quantification kit (Thermo), and the CpG-R was frozen at -80°C. After purification of the CpG-R conjugate by affinity chromatography nickel column and gel filtration chromatography, its purity and yield met the target requirements.

[0131] Example 14: Immunological experiment of CpG-R

[0132] As in Example 7, ELISA experiments were used to detect the specific antibody titers in the serum of immunized mice. In this study, BALB / c mice were randomly divided into 6 groups, namely PBS group, RBD group (marked as R), SC-RBD and ST-HUH conjugate group (marked as RS), CpG-R group (marked as RC), RBD+HUH-CpG 2006 (H) group (marked as R+CH), and RBD+HUH-CpG 2006 (L) group (marked as R+CL). H indicates that the dosage of CpG adjuvant is 50 μg / mouse, and L indicates that the dosage of CpG adjuvant is 4.5 μg / mouse. The mice were subcutaneously immunized on days 0 and 14, and blood was collected from the tail vein on days 7 and 21. The ELISA experimental method was used to detect the IgG antibody titers in the serum on days 7 and 21, and the experimental results are as follows. Figure 21As shown, on day 7, the serum IgG antibody titer in the CpG-R group was not significantly different from that in the RBD and RS groups. However, there were significant differences between the CpG-R group and both the RBD+HUH-CpG 2006(L) group and the RBD+HUH-CpG 2006(H) group (0.01<P<0.05). The results on day 21 showed that compared with day 7, the serum IgG antibody titer in all groups on day 21 was significantly increased, and there were significant differences in serum antibody titers between the groups on day 21, with the CpG-R group having the highest serum IgG antibody titer. The CpG-R group and the other four groups were subjected to variance analysis. The results showed that there was no significant difference between the CpG-R group and the RS group; there was a significant difference between the CpG-R group and the RBD+HUH-CpG 2006(H) group (**, P<0.01, error means standard error), and the serum antibody titer of mice in the CpG-R group was 8 times that of the RBD+HUH-CpG 2006(H) group; there were significant differences between the CpG-R group and the RBD+HUH-CpG 2006(L) group and the RBD group (****, P<0.0001, error means standard error), and the serum IgG antibody titer of mice in the CpG-R group was 25 times that of the RBD+HUH-CpG 2006(L) group, and 69 times that of the RBD group, indicating that the ability of RBD coupled with CpG2006 adjuvant to stimulate antibody production was significantly improved.

[0133] Example 15: Construction of SC-HUH plasmid

[0134] Research has shown that the SpyCatcher and SpyTag linkers in the SpyCatcher / SpyTag isopeptide bond system are flexible, and that the SpyTag linker promotes protein solubility. Therefore, fusing the SpyTag linker to the antigen is more beneficial for antigen preparation. In this patent application, a plasmid expressing the SpyCatcher and HUH fusion protein (hereafter referred to as the SC-HUH plasmid) was also constructed.

[0135] The reagents used in this example are the same as those in Example 1. The difference is that the plasmid constructed this time is pET28a-SC-HUH (T7 promoter, Kan r , His tag) plasmid, which was designed by the inventors and fully synthesized by Sangon Biotechnology (Shanghai).

[0136] The SpyCatcher-HUH expression vector (hereafter referred to as SC-HUH) was constructed using enzyme ligation. Based on the SpyCatcher amino acid sequence, the HUH protein amino acid sequence was linked to the SpyCatcher C-terminus using two sets of EAAAK rigid protein linkers. After codon optimization, the SC-HUH protein amino acid sequence was fully synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Sangon Biotech).

[0137] According to the SC-HUH sequence, primers SC-HUH-F: GCCATGGGCGGGGCGATGG (SEQ ID NO.36), and SC-HUH-R: CTCGAGAACCGCGCTGGTCGC (SEQ ID NO.37) were designed. The SC-HUH fragment was amplified using SC-HUH as a template. PCR verification and recovery of the target fragment of 752 bp. The SC-HUH fragment and the pET28a(+) plasmid were double-digested with restriction endonucleases Nco I and Xho I. The two fragments were added to a system at the same time, connected with T4 ligase at 16°C overnight, and then transformed into BL21 (DE3) competent cells. 800 μL LB liquid culture medium was added and cultured in a shaker at 37°C and 220 r / min for 2 hours. The bacterial suspension was completely spread on an LB solid plate containing kanamycin resistance, placed in a constant temperature incubator at 37°C for 12 hours, and then a single clone colony was picked and inoculated into LB liquid culture medium (Kanamycin). + ), placed in a shaking incubator at 37°C and 220 r / min for 12 hours, the pET28a(+) plasmid containing the SC-HUH gene was named pET28a-SC-HUH, and the BL21(DE3) strain containing the pET28a-SC-HUH plasmid was named BL21 / SC-HUH. The accuracy of the final expression vector was confirmed by enzyme digestion and sequencing. The specific operation method was to collect the cultured bacterial solution and centrifuge it, and remove the supernatant. The plasmid was extracted using the Tiangen Plasmid Extraction Kit. The results of the gene sequence determination of the pET28a-SC-HUH plasmid are shown in Figure 2. Figure 22 The results showed that the newly constructed pET28a-SC-HUH plasmid matched the theoretical sequence 100%, indicating that the pET28a-SC-HUH plasmid was successfully constructed. Finally, the BL21 / SC-HUH strain was stored at -80°C.

[0138] Example 16: Purification of SC-HUH

[0139] To verify the protein expression ability of the BL21 / SC-HUH strain, the same method as in Example 2 was used for detection. The results of the Coomassie brilliant blue staining experiment were as follows: Figure 23As shown in A, there is a clear protein expression band at the 26kDa position. Western-Blot experiments also used HRP-labeled Anti-His antibodies to specifically detect SC-HUH protein. The results are shown in Figure 23 As shown in B, there is also a protein expression band at the 26 kDa position, which is consistent with the theoretical molecular weight of the target protein SC-HUH, indicating that the BL21 / ST-HUH strain has the ability to correctly express the SC-HUH protein.

[0140] The SC-HUH protein was purified and prepared using the same method as in Example 2, except that the bacterial solution used in this example was BL21 / SC-HUH. Figure 24 This is the result of Coomassie brilliant blue staining after SC-HUH protein was purified by nickel column affinity chromatography. Figure 25 The following is a Coomassie blue staining result of molecular sieve purification of SC-HUH protein. The results demonstrate successful purification of SC-HUH protein using both nickel affinity chromatography and molecular sieve purification. The target SC-HUH protein was concentrated, quantified, and stored at -80°C.

[0141] Example 17: Ligation of SC-HUH and HUH-CpG 2006

[0142] To obtain a conjugate of SC-HUH and HUH-CpG 1018 (hereinafter referred to as STH-CpG1018), the same experimental method as in Example 3 was used to connect SC-HUH and HUH-CpG 2006 to obtain a conjugate of the two (hereinafter referred to as SCH-CpG 2006). The conjugation system was also verified using Coomassie Brilliant Blue staining. Theoretically, the molecular weight of SC-HUH conjugated with HUH-CpG 2006 increases, and the protein band position of the conjugate in the polyacrylamide gel shifts upward. The Coomassie Brilliant Blue staining experimental results are shown in Figure 2. Figure 26 As shown in Figure A, the HUH-CpG 2006 and SC-HUH coupling system has a band at the 40 kDa position. Compared with SC-HUH, this band is shifted upward, consistent with theoretical results, indicating that SC-HUH and HUH-CpG 2006 are successfully coupled. Furthermore, the coupling reaction of SC-HUH and HUH-CpG 2006 was further verified by fluorescence luminescence experiments using the same method as in Example 10. The SC-HUH and HUH-CpG 2006 coupling system was subjected to polyacrylamide gel electrophoresis and then subjected to fluorescence luminescence experiments. The results are shown in Figure 10. Figure 26As shown in Figure 2, compared with FHUH-CpG2006, the SC-HUH and FHUH-CpG 2006 coupling system has a band at the 40 kDa position, which is consistent with the theoretical molecular weight of the SCH-CpG2006 conjugate, further indicating that SC-HUH and HUH-CpG 2006 are successfully coupled, but the connection ratio is low.

[0143] In summary, the method for coupling the antigen designed in the present invention to the CpG adjuvant is also applicable after the position of the SpyCatcher / SpyTag system linker is interchanged. This shows that the design method of the present invention has flexibility and universal applicability to the SpyCatcher / SpyTag system and similar systems.

[0144] Example 18: Experimental attempt to covalently couple antigens to CpG directly via the HUH protein system

[0145] In the field, conventional conjugation techniques used to directly express antigens by fusing them with HUH family proteins and leveraging the functionality of the HUH protein system to achieve conjugation between the antigen and the CpG adjuvant often fail to produce the desired conjugated product. This study used three antigens to conduct further experiments to determine whether the antigens could be stably conjugated to CpG directly through fusion with HUH proteins.

[0146] In this example, the outer membrane protein Omp19 of Brucella, the hemagglutinin protein HA of influenza virus and the RBD domain of the S protein of novel coronavirus were selected as antigens. The optimized amino acid sequences of these three proteins were designed in series with the amino acid sequence of HUH protein through two sets of rigid fusion protein linkers EAAAK to complete the plasmid construction and protein expression; the three fusion proteins were named Omp19-HUH, HA-HUH and RBD-HUH respectively. The Omp19-HUH fusion protein expression plasmid was constructed according to the method of Example 1. The plasmid construction map and enzyme digestion test results are shown in FIG. Figure 27 Purify the Omp19-HUH fusion protein according to the method of Example 2, Figure 28 This is the result of Coomassie brilliant blue staining after the Omp19-HUH protein was purified by nickel column affinity chromatography. Figure 29 The results of the Coomassie Brilliant Blue staining experiment of the Omp19-HUH protein after molecular sieve purification were shown in Table 1. HA-HUH and RBD-HUH fusion protein expression plasmids were constructed and the HA-HUH and RBD-HUH fusion proteins were expressed and purified according to the methods of Example 1 and Example 11, respectively. Figure 30 The map of HA-HUH plasmid construction and enzyme digestion test results are shown. Figure 31This is the result of Coomassie Brilliant Blue staining after HA-HUH protein was purified by nickel column affinity chromatography, which showed that HA-HUH fusion protein was successfully obtained. Figure 32 For the RBD-HUH plasmid construction map and enzyme digestion test results, Figure 33 The results are shown as follows: the RBD-HUH fusion protein expression plasmid was transfected into HEK293 cells. After transfection, the cell culture was taken out and the results of SDS-PAGE and Western Blot analysis were performed. After analysis, the plasmid of RBD-HUH fusion protein was transfected into HEK293 cells and induced to express intracellularly. Therefore, RBD-HUH protein could not be obtained. Using the same experimental method as Example 3, the two fusion proteins Omp19-HUH and HA-HUH were connected to HUH-CpG2006 respectively, and then separated by polyacrylamide gel, and then analyzed by fluorescence luminescence experiment and Coomassie brilliant blue staining experiment. The analysis results are shown in FIG. Figure 34 and 35 ; Figure 34 The results of the connection verification between Omp19-HUH and HUH-CpG 2006 are shown in Figure 2. Figure 35 The results show that the HA-HUH and HUH-CpG 2006 fusion proteins were not successfully linked to the HUH-CpG 2006 fusion protein. This may be due to the natural structure of the antigen and steric hindrance, which seriously interfere with the function of the HUH protein.

Claims

1. A method for site-specific covalent binding of a CpG adjuvant to an antigen, comprising the following steps: a. The first molecule of the isopeptide bond molecule adhesive is fused to the N-terminus or C-terminus of the HUH protein to produce the first molecule adhesive-HUM fusion protein; b. A specific recognition ssDNA sequence containing a core sequence matching the HUH protein used in step a is connected to the 5' or 3' end of the CpG adjuvant to produce a CpG-ssDNA linker; c. incubating the first adhesive molecule-HUM fusion protein produced in step a with the CpG-ssDNA linker produced in step b, and the HUH protein specifically recognizes the ssDNA sequence and binds to produce a CpG-ssDNA-HUH conjugate; d. The isopeptide bond molecule used in step a first molecule of the isopeptide bond molecule binder is matched with the second molecule of the antigen N-terminus or C-terminus fusion expression to produce a second molecule of the binder - antigen fusion protein; e. The CpG-ssDNA-HUH conjugate produced in step c is incubated with the second binder molecule-antigen fusion protein produced in step d to produce a CpG adjuvant-antigen conjugate, wherein the CpG adjuvant and the antigen are site-specifically covalently bound at a molar ratio of 1:

1.

2. The method of claim 1, wherein the CpG adjuvant is CpG 1018, CpG 2216, CpG 2336, CpG 2007, CpG BW006 / 684, CpG D-SL01, CpG 2395, CpG M362, CpG D-SL03, or CpG 2006 / 7909.

3. The method of claim 1, wherein the HUH protein and the matching specific recognition ssDNA sequence containing the core sequence are respectively protein PCV2 and a sequence containing the core sequence TATTAC, protein DCV and a sequence containing the core sequence TATTAC, protein FBNYV and a sequence containing the core sequence TATTAC, protein BBTV and a sequence containing the core sequence TATTAC, protein WDV and a sequence containing the core sequence TATTAC, protein TYLCV and a sequence containing the core sequence TATTAC, protein CpCDV and a sequence containing the core sequence TATTAC, protein MSMV and a sequence containing the core sequence TATTAC, protein CLCV and a sequence containing the core sequence TATTAC, protein TGMV and a sequence containing the core sequence TATTAC, protein RepB and a sequence containing the core sequence TACTAC, protein RepBm and a sequence containing the core sequence TACTAC, protein TraI and a sequence containing the core sequence GGTGC, protein mMobA and a sequence containing the core sequence CCCTCCC, or protein NES and a sequence containing the core sequence CCCTTA.

4. The method of claim 3, wherein the HUH protein and the matching specific recognition ssDNA sequence containing the core sequence are protein PCV2 and sequence TAAGTATTAC, protein DCV and sequence TTATATTATTAC, protein DCV and sequence AAGTATTACCAG, protein FBNYV and sequence CTTAGTATTAC, protein BBTV and sequence CTTATTATTAC, protein WDV and sequence TTATAATATTAC, protein TYLCV and sequence TATAAATATTAC, protein CpCDV and sequence AAATTAATATTAC, protein MSMV and sequence ATAA TAATATTAC, protein CLCV and the sequence CAATAATATTAC, protein TGMV and the sequence TTTAATATTAC, protein RepB and the sequence TGCTTCCGTACTACGACCCCCCA, protein RepBm and the sequence TGCTTCCGTACTACGACCCCCCA, protein TraI and the sequence TTTGCGTGGGGTGTGGTGCTTT, protein mMobA and the sequence CCAGTTTCTCGAAGAGAAACCGGTAAGTGCACCCTCCC, or protein NES and the sequence ACGCGAACGGAACGTTCGCATAAGTGCGCCCTTACGGGATTTAAC.

5. The method of claim 1, wherein the first isopeptide bond molecular binder molecule and the matching second isopeptide bond molecular binder molecule are respectively SpyCatcher and SpyTag, SpyTag and SpyCatcher, SpyCatcherΔN1ΔC1 and SpyTag, SpyTag and SpyCatcherΔN1ΔC1, SpyLigase and SpyTag / KTag, SpyTag / KTag and SpyLigase, SnoopCatcher and SnoopTag, SnoopTag and SnoopCatcher, SpyCatcher002 and SpyTag002, SpyTag002 and SpyCatcher002, SnoopLigase 2 and SnoopTagJr / DogTag, SnoopTagJr / DogTag and SnoopLigase 2, SpyDock and SpyTag002, or SpyTag002 and SpyDock.

6. The method of claim 1, wherein the antigen is a protein antigen or a carbohydrate antigen.

7. The method according to claim 6, wherein the protein antigen or carbohydrate antigen is a protein antigen or carbohydrate antigen derived from bacteria, viruses, fungi, spirochetes, mycoplasmas, rickettsiae, chlamydiae, parasites or tumors.

8. The method of claim 7, wherein the protein antigen is Brucella protein antigen Omp19 or novel coronavirus RBD.

9. The method of claim 7, wherein the carbohydrate antigen is Shigella surface polysaccharide OPS.

10. The CpG adjuvant-antigen conjugate prepared by the method of claim 1, wherein the CpG adjuvant and the antigen are site-specifically covalently bound at a molar ratio of 1:1, wherein the 5' end or 3' end of the CpG adjuvant is covalently linked to a specific recognition ssDNA sequence containing a core sequence that matches the HUH protein through a phosphodiester bond, the HUH protein is covalently coupled to the specific recognition ssDNA sequence that matches the HUH protein through phosphotyrosine, the N-terminus or C-terminus of the HUH protein is covalently linked to a first molecule of an isopeptide bond molecular adhesive through a peptide bond, the first molecule of the isopeptide bond molecular adhesive is covalently coupled to a matching second molecule of the isopeptide bond molecular adhesive through an isopeptide bond formed between a lysine residue and asparagine or aspartic acid, and the second molecule of the isopeptide bond molecular adhesive is covalently linked to the N-terminus or C-terminus of the antigen through a peptide bond.

11. The CpG adjuvant-antigen conjugate of claim 10, wherein the CpG adjuvant is CpG 1018, CpG 2216, CpG 2336, CpG 2007, CpG BW006 / 684, CpG D-SL01, CpG 2395, CpG M362, CpG D-SL03 or CpG2006 / 7909.

12. The CpG adjuvant antigen conjugate of claim 10, wherein the first isopeptide bond molecule binder molecule and the matching second isopeptide bond molecule binder molecule are SpyCatcher and SpyTag, SpyTag and SpyCatcher, SpyCatcherΔN1ΔC1 and SpyTag, SpyTag and SpyCatcherΔN1ΔC1, SpyLigase and SpyTag / KTag, SpyTag / KTag and SpyLigase, SnoopCatcher and SnoopTag, SnoopTag and SnoopCatcher, SpyCatcher002 and SpyTag002, SpyTag002 and SpyCatcher002, SnoopLigase 2 and SnoopTagJr / DogTag, SnoopTagJr / DogTag and SnoopLigase, respectively.

2. SpyDock and SpyTag002, or SpyTag002 and SpyDock.

13. The CpG adjuvant antigen conjugate of claim 10, wherein the HUH protein and the matching specific recognition ssDNA sequence containing the core sequence are respectively protein PCV2 and a sequence containing the core sequence TATTAC, protein DCV and a sequence containing the core sequence TATTAC, protein FBNYV and a sequence containing the core sequence TATTAC, protein BBTV and a sequence containing the core sequence TATTAC, protein WDV and a sequence containing the core sequence TATTAC, protein TYLCV and a sequence containing the core sequence TATTAC, protein CpCDV and a sequence containing the core sequence TATTAC, protein MSMV and a sequence containing the core sequence TATTAC, protein CLCV and a sequence containing the core sequence TATTAC, protein TGMV and a sequence containing the core sequence TATTAC, protein RepB and a sequence containing the core sequence TACTAC, protein RepBm and a sequence containing the core sequence TACTAC, protein TraI and a sequence containing the core sequence GGTGC, protein mMobA and a sequence containing the core sequence CCCTCCC, or protein NES and a sequence containing the core sequence CCCTTA.

14. The CpG adjuvant antigen conjugate of claim 13, wherein the HUH protein and the matching specific recognition ssDNA sequence are protein PCV2 and sequence TAAGTATTAC, protein DCV and sequence TTATATTATTAC, protein DCV and sequence AAGTATTACCAG, protein FBNYV and sequence CTTAGTATTAC, protein BBTV and sequence CTTATTATTAC, protein WDV and sequence TTATAATATTAC, protein TYLCV and sequence TATAAATATTAC, protein CpCDV and sequence AAATTAATATTAC, protein MSMV and sequence ATAA TAATATTAC, protein CLCV and the sequence CAATAATATTAC, protein TGMV and the sequence TTTAATATTAC, protein RepB and the sequence TGCTTCCGTACTACGACCCCCCA, protein RepBm and the sequence TGCTTCCGTACTACGACCCCCCA, protein TraI and the sequence TTTGCGTGGGGTGTGGTGCTTT, protein mMobA and the sequence CCAGTTTCTCGAAGAGAAACCGGTAAGTGCACCCTCCC, or protein NES and the sequence ACGCGAACGGAACGTTCGCATAAGTGCGCCCTTACGGGATTTAAC.

15. The CpG adjuvant-antigen conjugate according to claim 10, wherein the antigen is a protein antigen or a carbohydrate antigen.

16. The CpG adjuvant-antigen conjugate according to claim 15, wherein the protein antigen or sugar antigen is a protein antigen or sugar antigen derived from bacteria, viruses, fungi, spirochetes, mycoplasmas, rickettsiae, chlamydiae, parasites or tumors.

17. The CpG adjuvant-antigen conjugate of claim 16, wherein the protein antigen is the Brucella protein antigen Omp19 or the novel coronavirus RBD.

18. The CpG adjuvant-antigen conjugate of claim 16, wherein the saccharide antigen is Shigella surface polysaccharide OPS.

19. Use of the CpG adjuvant-antigen conjugate according to any one of claims 10 to 18 in preparing a vaccine.

20. A vaccine characterized in that Comprising the CpG adjuvant-antigen conjugate according to any one of claims 10-18.

Images