Saline-alkaline tolerant microbial agent as well as preparation method and application thereof
By preparing the composite microbial agent of Bacillus subtilis and Pichia jiyemon, the problems of difficulty in accumulating organic matter in the soil and low microbial activity in saline-alkali land were solved, the growth of plants in saline-alkali land was promoted, and the saline-alkali tolerance was improved.
Patent Information
- Application Number
- CN202510428099.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-07-08
Smart Images

Figure SMS_1 
Figure HDA0005347329170000011 
Figure HDA0005347329170000012
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial fermentation and soil improvement, and particularly relates to a salt- and alkali-resistant microbial agent, a preparation method and an application thereof. Background Art
[0002] Like arable land, saline-alkali land, a land resource characterized by salt accumulation, not only carries important functions such as pollution purification, biological resources, biodiversity, global carbon storage, natural and cultural heritage, and scenic tourism, but also serves as a vital agricultural production resource on which human survival depends. The management of saline-alkali land aims to reduce crop stress, maintain crop health, and ensure high yields and quality, and is of vital importance to ecological and environmental safety and human health.
[0003] Soil salinization leads to a significant decrease in organic carbon storage, and soil fertility and crop productivity also decrease. This is mainly because: (1) the input of exogenous organic matter in the salinized environment is low, and the accumulation of soil salt has an adverse effect on plant growth. (2) High salinity and alkaline conditions also inhibit microbial activity, reduce the turnover rate of organic matter, and reduce the accumulation of microbial residual organic matter. Although the application of organic fertilizers, straw return to the field, and green manure planting can theoretically increase the content of soil organic matter, due to the low basic soil fertility of saline-alkali land, the mineralization and decomposition of organic matter is greater than the sealing effect, making it difficult to accumulate organic matter. The academic community calls it the "Matthew effect"; secondly, due to limited resources, technology and economic conditions, the implementation effect of the above measures varies from region to region. Overall, improve saline-alkali soil. Jia Qi, Jing Hefang, Zhang Xinhui. Effects of composite microorganisms on the physical and chemical properties of saline-alkali soil [J]. China Rural Water Conservancy and Hydropower disclosed the use of composite microorganisms composed of Bacillus pumilus and Bacillus cereus to increase soil water holding capacity and reduce soil salinity, but there are few technical solutions in the existing technology that use microbial agents to improve saline-alkali land and achieve results. Summary of the Invention
[0004] In order to solve the technical problem that economic plants are difficult to grow normally in saline-alkali land, the present invention provides the following technical methods:
[0005] The present invention discloses a salt-alkali resistant microbial agent. The salt-alkali resistant composite microbial agent comprises at least Pichia guilliermondii YSY119, and preferably further comprises Bacillus subtilis YSY2; the Bacillus subtilis YSY2 was deposited in the China Center for Type Culture Collection on March 18, 2025, with a preservation number of CCTCC M 2025517; the Pichia guilliermondii YSY119 was deposited in the China Center for Type Culture Collection on March 17, 2025, with a preservation number of CCTCC M 2025488.
[0006] Preferably, the colony count ratio of Bacillus subtilis YSY2 to Pichia guilliermondii YSY119 is 1:1-3.
[0007] Preferably, the colony count ratio of Bacillus subtilis YSY2 to Pichia guilliermondii YSY119 is 1:1.
[0008] Preferably, the colony count ratio of Bacillus subtilis YSY2 to Pichia guilliermondii YSY119 is 1:3.
[0009] A method for preparing a salt- and alkali-tolerant microbial agent by fermentation, the preparation method comprising the following steps:
[0010] (1) Activating Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 respectively;
[0011] (2) subjecting the activated Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 to primary fermentation respectively;
[0012] (3) Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 after primary fermentation were subjected to secondary fermentation respectively;
[0013] (4) Finally, the Bacillus subtilis YSY2 and the Pichia guilliermondii YSY119 after the secondary fermentation are mixed in a volume ratio of 1:1-3 to obtain the salt-alkali tolerant microbial agent.
[0014] Preferably, in step (1), the specific step of activation is to inoculate Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 into LB solid medium and culture at 28° C. for 48 hours.
[0015] Preferably, the specific method of the primary fermentation in step (2) is: inoculating activated colonies of Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 into LB liquid culture medium and culturing at 28° C. and 220 r / min for 24 h.
[0016] Preferably, the specific method of the secondary fermentation in step (3) is: the bacterial liquid of Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 after the primary fermentation is inoculated into LB liquid culture medium again and cultured at 28°C and 220r / min for 48-72h.
[0017] Preferably, in step (3), the inoculation amount of the bacterial liquid of Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 after the primary fermentation is 1-5%.
[0018] Preferably, in step (4), the volume ratio of the bacterial liquid of Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 after the secondary fermentation is 1:1-3.
[0019] The present invention discloses a salt-alkali resistant microbial agent and a preparation method thereof, and the salt-alkali resistant microbial agent is used in at least one of the following applications:
[0020] (1) Improve the salt and alkali tolerance of plants;
[0021] (2) Promote plant growth in saline-alkali land.
[0022] Preferably, the plant is pepper.
[0023] Preferably, the saline-alkali land has a salt content of 10.13-14.25 g / kg and a pH value of 8-10.
[0024] Beneficial effects of the present invention:
[0025] The invention discloses a salt-alkali resistant microbial agent containing Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119. Mixing the microbial agent with saline-alkali soil can improve the salt-alkali resistance of plants and promote the growth of plants in saline-alkali soil. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is a colony image of Bacillus subtilis YSY2.
[0027] Figure 2 This is a colony image of Pichia guilliermondii YSY119.
[0028] Figure 3 This is the evolutionary tree of Bacillus subtilis YSY2.
[0029] Figure 4 This is the evolutionary tree of Pichia guilliermondii YSY119.
[0030] Figure 5 This is the result of the salt tolerance experiment of Bacillus subtilis YSY2 in LB solid culture medium.
[0031] Figure 6 This is a graph showing the results of a salt tolerance experiment of Pichia guilliermondii YSY119 in LB solid culture medium.
[0032] Figure 7This figure shows the results of using Pichia guilliermondii YSY119 in pepper cultivation under saline-alkali conditions in pots.
[0033] Figure 8 This is a graph showing the results of using salt-alkali-tolerant microbial agents in pepper cultivation under saline-alkali conditions in pots. DETAILED DESCRIPTION
[0034] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.
[0035] Example 1 Classification and identification of strains
[0036] The strain YSY2 was identified to its species using 16S rDNA identification technology. The 16S rRNA gene was amplified using bacterial universal primers. After PCR amplification, the PCR product was detected by electrophoresis on a 1% agarose gel. The gene product amplified by PCR was sequenced. The 16S rRNA gene sequence of the strain XJ33 is shown in SEQ ID NO. 1:
[0037] SEQ ID NO.1 Bacillus subtilis
[0038]
[0039] The strain YSY119 was identified by 18S rDNA identification technology. The 18S rRNA gene was amplified using universal primers for fungi. After PCR amplification, the PCR product was detected by electrophoresis on 1% agarose gel. The gene product obtained by PCR was sequenced. The 18S rRNA gene sequence of the strain YSY119 is shown in SEQ ID NO. 2.
[0040] SEQ ID NO.2 Pichia pastoris
[0041] TCGGAAGGATCATTACAGTATTCTTTTGCCAGCGCTTAACTGCGCGGCGAAAAACCTTACACACAGTGTCTTTTTGATACAGAACTCTTGCTTTGGTTTGGCCTAGAGATAGGTTGGGCCAGAGGTTTAACAAAACACAATTTA ATTATTTTTACAGTTAGTCAAATTTTGAATTAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAAC GCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCCCGGGTTTGGTATTGAGTGATACTCTTAGTCGGACTAGGCGTTTGCTTGAAAAGTATTGGCATGGGTAGTACTAGATAGT GCTGTCGACCTCTCAATGTATTAGGTTTATCCAACTCGTTGAATGGTGTGGCGGGATATTTCTGGTATTGTTGGCCCGGCCTTACAACAACCAAACAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATC
[0042] The sequenced gene sequences of strains YSY2 and YSY119 were entered into the NCBI database and compared with BLAST software. Strains with high homology to the strains were selected and multiple sequence alignment was performed using MEGA7.0 software to establish a phylogenetic tree. Figure 3-4As shown. The comparison results showed that strain YSY2 was similar to Bacillus subtilis, and its morphological characteristics and physiological and biochemical properties were closest to Bacillus subtilis. Therefore, strain YSY2 was identified as Bacillus subtilis and named Bacillus subtilis YSY2. It was deposited in the China Center for Type Culture Collection, Wuhan, China (Wuhan University), with the strain deposit number CCTCC M 2025517 and the deposit date March 18, 2025. The comparison results showed that strain YSY119 was similar to Pichia guilliermondii, and its morphological characteristics and physiological and biochemical properties were closest to Pichia guilliermondii. Therefore, the strain YSY119 was identified as Pichia guilliermondii, and the strain was named Pichia guilliermondii YSY119, and deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan, China (Wuhan University), with the strain deposit number being CCTCC M 2025488, and the deposit date being March 17, 2025.
[0043] Salt tolerance testing of strains: Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 were activated using conventional solid LB medium. Salt-tolerant strains were screened using the three-zone streak method. The sodium chloride concentrations in the solid LB medium were 10% and 14%, respectively. Three replicates were performed for each strain. Growth was recorded over a 7-day growth period. The results, shown in Figures 5-6, show that both Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 can tolerate a sodium chloride concentration of 14%.
[0044] Example 2 Preparation of salt-alkali tolerant microbial agent
[0045] (1) Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 strains screened from the activated bacteria library were respectively inoculated into LB solid medium and cultured at 28°C for 48 h;
[0046] (2) Use a 50 ml conical flask to fill it with 20 ml of LB liquid culture medium. Inoculate the strains Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 in different conical flasks using a sterile inoculating rod in a clean bench. Adjust the shaker to 28°C and 220 r / min. After shaking for 24 hours, the strains Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 were obtained respectively. Then, 2.5-12.5 ml of the strains Bacillus subtilis YSY2 and YSY119 (Meyerozyma guilliermondii) culture liquid were transferred to 250 ml conical flasks containing 100 ml of LB culture medium and continued to culture. Adjust the shaker to 28°C and 220 r / min for 48 hours. In a clean bench, use sterile tweezers and a pipette to drop 10 μl of bacterial solution onto a hemocytometer. Cover the plate with a coverslip and count the viable bacteria under an electron microscope. The viable counts of strains (Bacillus subtilis) YSY2 and YSY119 (Meyerozyma guilliermondii) were 1.21 billion CFU / ml and 1.35 billion CFU / ml, respectively.
[0047] (3) The bacterial cultures of Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 were mixed in proportion to prepare a salt- and alkali-tolerant microbial agent.
[0048] Example 3 Application of salt-alkali tolerant microbial agents
[0049] The nutritional status of the experimental saline-alkali potted soil is as follows: organic matter content 20.17-23.04g / kg, salt content 10.13-14.25g / kg, pH value 8-10, soil bulk density 1.62-1.83g / cm 3 Plant peppers in saline-alkali soil and observe their growth.
[0050] Treatment 1: Dilute the yeast Pichia guilliermondii YSY119 obtained in Example 2 300-fold and mix with saline-alkali soil at a dosage of 100 mL / kg. Repeat three times. The nutritional status of the saline-alkali soil potted in the experiment: organic matter content 20.17 g / kg, salt content 10.13 g / kg, pH 8, soil bulk density 1.62 g / cm 3 .
[0051] Blank control (CK1): Use clean water mixed with saline-alkali soil at a dosage of 100 mL / kg, repeated 3 times.
[0052] Treatment 2: The microbial agent prepared in Example 2 was diluted 300 times and mixed with saline-alkali soil at a dosage of 100 mL / kg. The mixture was repeated three times. The ratios of the colony counts of Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 in the bacterial suspensions were 1:1, 1:2, and 1:3, respectively. The nutritional status of the saline-alkali soil potted in the experiment was as follows: organic matter content 23.04 g / kg, salt content 14.25 g / kg, pH 10, and soil bulk density 1.83 g / cm 3 .
[0053] Blank control (CK2): Use clean water mixed with saline-alkali soil at a dosage of 100 mL / kg, repeated 3 times.
[0054] Table 1 Fresh weight results of peppers under different treatments
[0055]
[0056] The results are as follows Figure 7-8 As shown in Table 1, after the saline-alkali soil was treated with Pichia guilliermondii YSY119, the average fresh weight of the peppers in the three treatment groups was significantly increased compared with the control group CK1, and the root system of the peppers was better developed; after the saline-alkali soil was treated with the salt-alkali tolerant microbial agent containing Bacillus subtilis YSY2 and Pichia guilliermondii YSY119 in a volume ratio of 1:1-3, the average fresh weight of the peppers was significantly increased compared with the control group CK2 and treatment group 1, and the root system of the peppers was better developed, indicating that Pichia guilliermondii YSY119 and the microbial agent prepared by mixing Pichia guilliermondii YSY119 with Bacillus subtilis YSY2 can promote the growth of peppers in saline-alkali soil and improve their salt-alkali tolerance.
Claims
1. A salt-tolerant and alkali-tolerant microbial inoculant, characterized in that, The salt-tolerant microbial inoculant contains Meyerozyma guilliermondii YSY119; Meyerozyma guilliermondii YSY119 was deposited at the China Center for Type Culture Collection on March 17, 2025, with the deposit number CCTCC M 2025488.
2. The microbial inoculum according to claim 1, wherein The microbial inoculant also contains Bacillus subtilis YSY2, which was deposited at the China Center for Type Culture Collection on March 18, 2025, with the deposit number CCTCC M 2025517.
3. The salt-tolerant microbial inoculant according to claim 2, characterized in that, The colony number ratio of Bacillus subtilis YSY2 to Meyerozyma guilliermondii YSY119 is 1:1 - 3.
4. A method for fermenting and preparing the salt-tolerant microbial inoculant according to any one of claims 1-3, characterized in that, The preparation method comprises the following steps: (1) Activate Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 separately. (2) Then perform primary fermentation on the activated Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 respectively. (3) Then perform secondary fermentation on the Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 after primary fermentation respectively. (4) Finally, mix the Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 after secondary fermentation according to a volume ratio of 1:1 - 3 to obtain the salt-tolerant microbial inoculant.
5. The preparation method according to claim 4, characterized in that The specific steps for activation in step (1) are to inoculate Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 into an LB solid medium and culture at 28°C for 48 h.
6. The preparation method according to claim 4, characterized in that The specific method for primary fermentation in step (2) is: inoculate the colonies of the activated Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 into an LB liquid medium and culture at 28°C and 220 r / min for 24 h.
7. The preparation method according to claim 6, wherein In step (3), the specific method of secondary fermentation is as follows: The bacterial solutions of Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 after primary fermentation are inoculated again into the LB liquid medium and cultured at 28 °C and 220 r / min for 48 - 72 h.
8. The preparation method according to claim 7, characterized in that, In step (3), the inoculation amount of the bacterial solutions of Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 after primary fermentation is 1 - 5%.
9. The preparation method according to any one of claims 4-8, characterized in that, In step (4), the volume ratio of the bacterial solutions of Bacillus subtilis YSY2 and Meyerozyma guilliermondii YSY119 after secondary fermentation is 1:1 - 3.
10. Use of the salt-tolerant microbial inoculant according to any one of claims 1 to 3 or the salt-tolerant microbial inoculant obtained by the preparation method according to any one of claims 4 to 9 in at least one of the following, characterized in that The application is as follows: (1) Improve the salt and alkali tolerance of plants; (2) Promote the growth of plants in saline-alkali land.
11. The application according to claim 10, wherein The plant is pepper.
12. The application according to claim 11, wherein The salt content in the saline-alkali land is 10.13 - 14.25 g / kg, and the pH value is 8 - 10.
Citation Information
Cited By
Preparation method of microbial agent for improving soil alkalinity
CN121674241A