Bacillus velezensis XYDY-1, biocontrol inoculant and application of biocontrol inoculant

Abstract

The invention belongs to the technical field of biological control of plant diseases, and relates to bacillus velezensis XYDY-1, a biocontrol microbial inoculum and application of the biocontrol microbial inoculum. The bacillus velezensis XYDY-1 screened by the invention is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number of the bacillus velezensis XYDY-1 is CGMCC No. 33126. The bacillus velezensis XYDY-1 as well as bacterial suspension, sterile fermentation liquor, bacteria fermentation liquor and volatile gas thereof can be used for effectively preventing and treating peanut fungal diseases and wheat fungal diseases, and particularly can be used for effectively inhibiting mycelial growth of pathogenic bacteria such as peanut black rot, peanut basal rot, peanut leaf rot and wheat stem rot. As a green biocontrol microbial agent, the strain can safely and effectively control the occurrence and development of plant diseases. The bacillus velezensis XYDY-1 also has a remarkable growth promoting effect, and has relatively high economic significance in agricultural production.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological control of plant diseases, and specifically relates to a strain of Bacillus velezensis XYDY-1, a biocontrol agent and its application. Background Art

[0002] Peanut is an important oil crop and cash crop in China. However, the occurrence of soil-borne diseases and leaf diseases seriously threatens the sustainable development of the peanut industry. In recent years, fungal diseases such as peanut black rot, peanut basal rot and peanut leaf rot have frequently occurred in peanut production. Among them, peanut black rot caused by the peanut black rot pathogen belongs to the quarantine pathogen of imported plants, which harms the peanut stem base, roots, pegs and pods, etc. Once the disease occurs, it is very difficult to control, and it can cause a reduction in production of more than 50% or even a complete harvest failure.

[0003] Wheat is an important food crop in China. As a major food source, it is also the main guarantee for China's food security. In recent years, wheat basal rot has spread rapidly in the main wheat-producing areas of China and has become one of the main diseases threatening wheat production. Wheat basal rot is a type of fungal stem base disease caused by various Fusarium spp., which has the characteristic of compound infection. When the disease occurs severely, it will cause rotten seeds, dead seedlings, and white ears in the later stage, significantly reducing the quality and yield of wheat and posing a serious threat to food security.

[0004] Currently, the control of soil-borne diseases and leaf diseases mainly relies on chemical control. However, the long-term use of chemical pesticides not only leads to an increase in the drug resistance of pathogenic bacteria, but also causes environmental pollution and agricultural product safety problems, restricting the sustainable development of the peanut and wheat planting industries. Therefore, it has become an urgent task to develop economic, safe and efficient control measures. Biological control uses beneficial microorganisms to inhibit or reduce the number of pathogenic organisms and control the occurrence and development of plant diseases. As a green prevention and control method, it has significant advantages. Therefore, exploring and creating efficient biological agent resources is an important way to achieve safe and effective control of such diseases. Summary of the Invention

[0005] The purpose of the present invention is to solve the above problems existing in the prior art, and propose a strain of Bacillus velezensis XYDY-1, a biocontrol agent and its application. The XYDY-1 strain is isolated from the rhizosphere soil of peanuts in Dongying saline-alkali land, has a significant inhibitory effect on the pathogenic bacteria of peanut and wheat fungal diseases, and can promote the growth of peanuts, with a significant growth-promoting effect.

[0006] The technical solution of the present invention is as follows:

[0007] The present invention provides a strain of Bacillus velezensis XYDY-1, which is deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms with the deposit number of CGMCC No. 33126.

[0008] The present invention also provides a biocontrol agent containing the above-mentioned Bacillus velezensis XYDY-1.

[0009] Furthermore, the active ingredient of the biocontrol agent is one or more of the following (a) to (d):

[0010] (a) The bacterial suspension of Bacillus velezensis XYDY-1;

[0011] (b) The sterile fermentation broth of Bacillus velezensis XYDY-1;

[0012] (c) The volatile gas of Bacillus velezensis XYDY-1;

[0013] (d) The fermented broth with bacteria of Bacillus velezensis XYDY-1.

[0014] The present invention also protects the application of the above-mentioned Bacillus velezensis XYDY-1 in controlling plant fungal diseases, especially in controlling peanut fungal diseases and wheat fungal diseases.

[0015] Furthermore, the peanut fungal diseases are any one or more of peanut black rot, peanut basal rot, and peanut leaf rot; the wheat fungal disease is wheat stem base rot.

[0016] The present invention also provides the application of the biocontrol agent of Bacillus velezensis XYDY-1 in controlling plant fungal diseases, especially in controlling peanut fungal diseases and wheat fungal diseases; wherein, the peanut fungal diseases are any one or more of peanut black rot, peanut basal rot, and peanut leaf rot; the wheat fungal disease is wheat stem base rot.

[0017] Furthermore, Bacillus velezensis XYDY-1 can inhibit the mycelial growth of the pathogens of peanut black rot, peanut basal rot, peanut leaf rot, and wheat stem base rot.

[0018] Furthermore, any one or more of the bacterial suspension, sterile fermentation broth, fermented broth with bacteria, and volatile gas of Bacillus velezensis XYDY-1 can inhibit the mycelial growth of the pathogens of peanut black rot, peanut basal rot, peanut leaf rot, and wheat stem base rot.

[0019] The present invention also provides the use of the Bacillus velezensis XYDY-1 in the preparation of protease, cellulase, amylase, chitinase and / or β-1,3-glucanase.

[0020] The present invention protects the use of the bacterial fermentation broth of the Bacillus velezensis XYDY-1 in promoting peanut growth.

[0021] Further, the root irrigation is carried out with the bacterial fermentation broth of strain XYDY-1.

[0022] Strain preservation information:

[0023] Bacillus velezensis XYDY-1 was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on December 19, 2024, with the deposit number CGMCC No. 33126 and the deposit address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0024] Advantages of the present invention:

[0025] A strain of Bacillus velezensis XYDY-1 and its fermentation products (bacterial suspension, sterile fermentation broth, bacterial fermentation broth and volatile gas) screened by the present invention can effectively control peanut fungal diseases and wheat fungal diseases, and can especially effectively inhibit the growth of the pathogens of peanut black rot, peanut basal rot, peanut leaf rot and wheat stem base rot. As a green biocontrol agent, it can safely and effectively control the occurrence and development of plant diseases.

[0026] Meanwhile, Bacillus velezensis XYDY-1 can also produce protease, cellulase, amylase, chitinase and β-1,3-glucanase, promote peanut growth, has a significant growth-promoting effect, and has high economic significance in agricultural production. Description of the drawings

[0027] Figure 1 is the colony morphology of Bacillus velezensis XYDY-1 on LA medium;

[0028] Figure 2 is the phylogenetic tree constructed by Bacillus velezensis XYDY-1 based on 16S rDNA and gyrB;

[0029] Figure 3 is the whole genome map of Bacillus velezensis XYDY-1;

[0030] Figure 4 is the antibacterial effects of the bacterial suspension and sterile fermentation broth of Bacillus velezensis XYDY-1 against the pathogens of peanut black rot, peanut basal rot, peanut leaf rot and wheat stem base rot;

[0031] Figure 5 It is the liquid chromatogram of each component of the sterile fermentation broth of Bacillus velezensis XYDY-1;

[0032] Figure 6 It is the antibacterial effect of the volatile gas of Bacillus velezensis XYDY-1 against Phomopsis personata, Rhizoctonia bataticola, Phyllosticta arachidicola and Pseudocercosporella herpotrichoides;

[0033] Figure 7 It is the detection of the activities of protease, amylase and cellulase of Bacillus velezensis XYDY-1;

[0034] Figure 8 It is the control effect of the fermented broth with bacteria of Bacillus velezensis XYDY-1 against peanut black rot;

[0035] Figure 9 It is the influence of the fermented broth with bacteria of Bacillus velezensis XYDY-1 on peanut growth. Detailed implementation manners

[0036] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0037] In order to further understand the present invention, the present invention will be further described in conjunction with the accompanying drawings and embodiments.

[0038] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0039] LA medium: 5 g of yeast extract, 10 g of tryptone, 10 g of NaCl, 20 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0040] LB medium: 5 g of yeast extract, 10 g of tryptone, 10 g of NaCl, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0041] PDA medium: 200 g of potato, 20 g of glucose, 20 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0042] Protease detection medium: 10 g of imported skim milk powder, 15 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0043] Amylase detection medium: 2 g of soluble starch, 10 g of beef extract, 10 g of glucose, 7 g of peptone, 20 g of agar, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0044] Cellulase detection medium: 2 g of carboxymethyl cellulose sodium, 0.2 g of congo red, 1 g of K2HPO4, 0.5 g of MgSO4, 2 g of (NH4)2SO4, 2 g of peptone, made up to 1000 mL with deionized water, autoclaved at 121 °C for 25 min.

[0045] Example 1 Isolation, screening and identification of Bacillus velezensis XYDY-1

[0046] (1) Isolation and preservation of strains

[0047] Soil sampling: Approximately 100 g of soil samples from the rhizosphere of peanut in Dongying saline-alkali land were placed in a sterile test tube and brought back to the laboratory for storage at 4 °C for later use.

[0048] Isolation of strains: 10 g of soil samples were added to 90 mL of sterile water, shaken at 28 °C for 30 min, allowed to stand for 10 min, and the supernatant was taken. Using the 10-fold serial dilution method, it was diluted successively to 10 -2 、10 -3 、10 -4 and 10 -5 For each concentration, 100 μL was taken and spread on LA medium, and each concentration was repeated 3 times. It was incubated in the dark at 28 °C for 24 h.

[0049] Purification of strains: Single colonies with different morphologies were selected, and the strains of each single colony were purified 3 times by streaking on LA medium plates. Strains were screened according to different colony morphologies and numbered. At the same time, they were placed in a 50% sterilized glycerol tube and stored at -80 °C for later use.

[0050] (2) Screening of strain XYDY-1

[0051] Using the peanut black rot pathogen as the indicator bacterium, a 6-mm-diameter peanut black rot pathogen cake was inoculated in the center of the LA medium plate. 5 μL of the culture solution of the test strain was respectively pipetted and inoculated 2 cm away from the pathogen. It was incubated in the dark at 25 °C for 7 - 10 d, and the antibacterial situation in each plate was observed to screen out the biocontrol strain XYDY-1 with inhibitory effect on the peanut black rot pathogen.

[0052] As Figure 1As shown, it is the colony morphology of strain XYDY-1 on LA medium.

[0053] (3) Strain identification of strain XYDY-1

[0054] The genomic DNA of strain XYDY-1 was amplified by PCR using the 16S rDNA universal primers 27F (5’AGAGTTTGATCMTGGCTCAG 3’) (SEQ ID NO:3) and 16S-R (5’AAGGAGGTGATCCAGCCGCA 3’) (SEQ ID NO:4), and the gyrB gene primers UP-1E (5’CAGGAAACAGCTATGACCAYGSNGGNGGNAARTTYR 3’) (SEQ ID NO:5) and APrU (5’TGTAAAACGACGGCCAGTGCNGGRTCYTTYTCYTGRCA 3’) (SEQ ID NO:6). The PCR products were sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing.

[0055]

[0056]

[0057] The obtained sequences were submitted to the GenBank database for BLAST analysis and comparison. Based on the 16S rDNA and gyrB sequences, a phylogenetic tree was constructed using MEGA 11.0 software, as Figure 2 shown. The results showed that strain XYDY-1 and Bacillus velezensis strain UA0243 were on the same branch, and the similarity between strain XYDY-1 and Bacillus velezensis strain UA0243 reached 93%, indicating that strain XYDY-1 was Bacillus velezensis. Strain XYDY-1 was deposited in the China General Microbiological Culture Collection Center with the deposit number CGMCC No. 33126.

[0058] Example 2 Whole-genome sequencing analysis of Bacillus velezensis XYDY-1

[0059] Sequencing was performed based on the Nanopore third-generation sequencing technology platform and the second-generation sequencing technology platform. The genome size of Bacillus velezensis XYDY-1 was 3,929,792 bp, and the GC content was 46.5% ( Figure 3 ). Analysis of the genome of strain XYDY-1 found that this strain had gene clusters for producing surfactin, butirosin, macrolide antibiotics, fengycin, siderophores, and bacilysin.

[0060] Example 3 Inhibitory effect of Bacillus velezensis XYDY-1 bacterial suspension on the mycelial growth of pathogenic bacteria

[0061] (1) Preparation of the bacterial suspension: Strain XYDY-1 was inoculated into LB medium and cultured with shaking at 28 °C for 24 h, then centrifuged at high speed for 5 min, and the supernatant was discarded.

[0062] (2) Activation of the pathogenic bacteria: Agar discs of the pathogenic bacteria of peanut black rot, peanut basal rot, peanut leaf rot, and wheat basal rot were respectively inoculated into the center of PDA medium and cultured in the dark at 25 °C for 3 - 7 d for standby.

[0063] (3) Plate confrontation: An agar disc with a diameter of 5 mm of the pathogenic bacteria was inoculated in the center of LA medium, and 10 μL of the bacterial suspension of XYDY-1 was dropped at about 2 cm on both sides of the agar disc. Inoculating 10 μL of LB medium was used as a control. Each treatment was repeated 6 times and cultured in the dark at a constant temperature of 25 °C.

[0064] The inhibition rate was calculated according to the mycelial growth rate method. Inhibition rate (%) = (control colony growth diameter - treatment colony growth diameter) / control colony growth diameter × 100. It was found that strain XYDY-1 had a significant inhibitory effect on all 4 pathogenic bacteria (see Figure 4) The inhibition rates of the mycelial growth of XYDY-1 against peanut black rot, peanut basal rot, peanut leaf rot and wheat basal rot were 69.98%, 77.06%, 66.25% and 66.25% respectively.

[0065] Example 4 Inhibitory effect of the sterile fermentation broth of Bacillus velezensis XYDY-1 on the mycelial growth of pathogenic bacteria

[0066] (1) Preparation of sterile fermentation broth: Pick a single colony of strain XYDY-1 with a toothpick and place it in a triangular flask containing 100 mL of LB medium. Incubate it at 28 °C with shaking for 24 h. After high-speed centrifugation, collect the supernatant and filter it through a sterile 0.22 μm filter membrane to obtain the sterile fermentation broth.

[0067] (2) Activation of pathogenic bacteria: Take the pathogen discs of peanut black rot, peanut basal rot, peanut leaf rot and wheat basal rot and inoculate them in the center of PDA medium. Incubate them in the dark at 25 °C for 3-7 d for standby.

[0068] (3) Co-culture of sterile fermentation broth and pathogenic bacteria mycelia: Mix the sterile fermentation broth with PDA medium and pour plates (the final concentration of the sterile fermentation broth is 20%). Inoculate a pathogen disc (diameter 5 mm) in the center of the plate. Use the plate added with an equal amount of LB medium as a control. Set 6 replicates for each treatment. Incubate it in the dark at 25 °C, measure the mycelial length, and calculate the inhibition rate. The results showed that compared with the control, the sterile fermentation broth of strain XYDY-1 significantly reduced the growth of pathogenic bacteria such as peanut black rot, peanut basal rot, peanut leaf rot and wheat basal rot (see Figure 4 ), and the mycelial growth inhibition rates were 96.98%, 78.35%, 97.5% and 97.5% respectively.

[0069] (4) Metabolome analysis of the sterile fermentation broth of Bacillus velezensis XYDY-1

[0070] Use ultra-high performance liquid chromatography and high-resolution mass spectrometry (UHPLC-HRMS) liquid chromatography-mass spectrometry technology to separate and identify the molecular structure of the sterile fermentation broth of strain XYDY-1. After detection and identification, this strain can produce antibacterial active substances such as isoniazid (RT: 0.813 min), metronidazole (RT: 0.922 min), palm chloramphenicol (RT: 0.937 min), jinggangmycin (RT: 3.978 min), nalidixic acid (RT: 4.849 min), 8-hydroxyquinoline (RT: 5.608 min), tunicamycin (RT: 7.533 min), pyocyanin (RT: 7.87 min) and surfactin (RT: 11.002 min) ( Figure 5 ).

[0071] Example 5 Inhibitory Effect of Volatile Gases Produced by Bacillus velezensis XYDY-1 on the Mycelial Growth of Pathogenic Fungi

[0072] Take 50 μL of the bacterial suspension of XYDY-1 and spread it evenly on the LA medium plate. In the center of another LA medium plate, place a 5-mm-diameter fungal plug of the pathogenic fungus. Seal the two plates with sealing film. As a control, take 50 μL of LB medium and spread it evenly on the LA medium plate. In the center of another LA medium plate, place a 5-mm-diameter fungal plug of the pathogenic fungus. Seal the two plates with sealing film. Set 6 replicates for each treatment, measure the mycelial growth, and calculate the inhibition rate. The results show that the volatile gases produced by strain XYDY-1 significantly reduced the mycelial growth of pathogenic fungi such as peanut black rot, peanut basal rot, peanut leaf rot, and wheat basal rot, and the inhibition rate was between 34.96% and 69.86%( Figure 6 ).

[0073] Example 6 Study on the Hydrolytic Enzyme Activity of Bacillus velezensis XYDY-1

[0074] (1) Protease detection

[0075] Take 10 μL of the bacterial suspension of strain XYDY-1 and drop it onto the protease detection medium plate. Incubate at 28 °C for 2 days. The appearance of a hydrolytic clear zone around the colony indicates the production of protease. The results show that strain XYDY-1 produced a hydrolytic clear zone on the protease detection medium, indicating that XYDY-1 has the ability to produce protease( Figure 7 ).

[0076] (2) Amylase detection

[0077] Take 10 μL of the bacterial suspension of strain XYDY-1 and drop it onto the amylase detection medium plate. Incubate at 28 °C for 5 days. The appearance of a hydrolytic clear zone around the colony indicates the production of amylase. The results show that strain XYDY-1 produced a hydrolytic clear zone on the amylase detection medium, indicating that XYDY-1 has the ability to produce amylase( Figure 7 ).

[0078] (3) Cellulase detection

[0079] Take 10 μL of the bacterial suspension of strain XYDY-1 and drop it onto the cellulase detection medium plate. Incubate at 28 °C for 5 days. The appearance of a hydrolytic clear zone around the colony indicates the production of cellulase. The results show that strain XYDY-1 produced a hydrolytic clear zone on the cellulase detection medium, indicating that XYDY-1 has the ability to produce cellulase( Figure 7 ).

[0080] (4) Chitinase detection

[0081] The chitinase activity of strain XYDY-1 was detected using the chitinase kit from Keming Biotechnology Co., Ltd. The definition of enzyme activity: Under the condition of 37 °C, the amount of enzyme that decomposes chitin to produce 1 mg of N-acetylglucosamine per milliliter of culture solution per hour is defined as one enzyme activity unit. Chitinase activity (mg / h / mL) = (ΔA + 0.2753) ÷ 6.4108 × Vtotal reaction ÷ Vsample × 10 = 3.899 × (ΔA + 0.2753). After detection, the chitinase activity of strain XYDY-1 was 1.108 mg / h / mL.

[0082] (5) Detection of β-1,3-glucanase

[0083] The β-1,3-glucanase activity of strain XYDY-1 was detected using the β-1,3-glucanase kit from Keming Biotechnology Co., Ltd. The calculation method of β-1,3-GA activity is β-1,3-GA (mg / h / mL) = [(ΔA + 0.0192) ÷ 0.0958 × V1] ÷ V1 = 10.438 × (ΔA + 0.0192). After detection, the β-1,3-glucanase activity of strain XYDY-1 was 0.837 mg / h / mL.

[0084] The above results showed that strain XYDY-1 could secrete a variety of hydrolases, including protease, amylase, cellulase, chitinase and β-1,3-glucanase.

[0085] Example 7 Control effect of the fermented broth of Bacillus velezensis XYDY-1 on peanut black rot

[0086] Peanut variety Huayu 910 was sown in flower pots. After 4 weeks, the control group (CK) was inoculated with the pathogen of peanut black rot and 10 mL of LB medium, and the treatment group (XYDY-1) was inoculated with the pathogen of peanut black rot and irrigated with the fermented broth of strain XYDY-1 cultured for 3 days (10 mL / plant). There were 3 pots in each of the control group and the treatment group, with 3 seedlings in each pot, and the experiment was repeated 3 times. Each treatment was carried out once a week. After 4 weeks, the incidence and disease index of peanuts in each treatment were counted, and the control effect of peanut black rot was calculated. The pot experiment results showed that the control effect of the fermented broth of strain XYDY-1 on peanut black rot reached 56.41% ( Figure 8 ).

[0087] Example 8 Effect of the fermented broth of Bacillus velezensis XYDY-1 on peanut growth

[0088] The peanut variety Huayu 910 was sown in flowerpots. After 2 weeks, the roots were irrigated with the bacterial fermentation broth of strain XYDY-1 (10 mL / plant), and an equal amount of LB medium was inoculated as a control (CK). There were 3 pots for both the control and the treatment, with 3 seedlings in each pot, and the treatment was carried out once a week. After 4 weeks, the fresh weight of the plants was weighed, and the dry weight of the plants was weighed after drying. The results are as Figure 5 shown. Statistical analysis found that, compared with the control, the bacterial fermentation broth of strain XYDY-1 could extremely significantly increase the fresh weight and dry weight of Huayu 910 plants, increasing by 39.02% and 39.09% respectively compared with the control ( Figure 9 ).

[0089] The above description is only the preferred embodiment of the present invention and is not a limitation of the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, modifications, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A strain of Bacillus velezensis XYDY-1, characterized in that, The Bacillus velezensis XYDY-1 is deposited in the China General Microbiological Culture Collection Center with the deposit number of CGMCC No. 33126.

2. A biocontrol agent containing the Bacillus velezensis XYDY-1 described in claim 1.

3. The biocontrol agent according to claim 2, characterized in that, Its active ingredient is one or more of the following (a) to (d): (a) The bacterial suspension of the Bacillus velezensis XYDY-1; (b) The sterile fermentation broth of the Bacillus velezensis XYDY-1; (c) The volatile gas of the Bacillus velezensis XYDY-1; (d) The fermented broth with bacteria of the Bacillus velezensis XYDY-1.

4. Use of Bacillus velezensis XYDY-1 or its biocontrol agent according to any one of claims 1-3 in controlling plant fungal diseases, characterized in that, The plant fungal diseases include peanut fungal diseases and wheat fungal diseases.

5. The application according to claim 4, wherein Any one or more of the Bacillus velezensis XYDY-1, its bacterial suspension, sterile fermentation broth, fermented broth with bacteria and volatile gas can inhibit the mycelial growth of the pathogens of peanut black rot, peanut basal rot, peanut leaf rot and wheat basal rot.

6. The application of the Bacillus velezensis XYDY-1 described in claim 1 in the preparation of protease, cellulase, amylase, chitinase and / or β-1,3-glucanase.

7. The application of the fermented broth with bacteria of the Bacillus velezensis XYDY-1 described in claim 1 in promoting peanut growth.

8. The application according to claim 7, characterized in that, Irrigate the roots with the fermented broth with bacteria of strain XYDY-1.

Images