Kitasatospora for preventing and treating pathogenic bacteria infection, bacteriostatic agent and application thereof

Abstract

The application discloses a kit for preventing and treating pathogenic bacteria infection, a bacteriostatic agent and application thereof. Kitasatospora sp. The kit for preventing and treating pathogenic bacteria infection is named as Kit NC-K143, and the bacteriostatic agent is named as Bacteriostatic Agent NC-K143. The Kit NC-K143 is classified and named as NC-K143, and the strain has been preserved in the China Center for Type Culture Collection on March 27, 2025, with a preservation number of CCTCC NO: M 2025616. The Kit NC-K143 has inhibiting effects on various bacteria and yeast-like fungi, especially gram-positive bacteria, and the inhibiting effect on Staphylococcus aureus is the best. The Kit NC-K143 can be used for preparing a medicine for preventing and treating human pathogenic bacteria infection, and has important significance for reducing the use of a large amount of antibiotics, reducing environmental pollution and reducing the generation of drug-resistant bacteria.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and in particular to a bacteriostatic agent for preventing and treating pathogenic bacterial infections, *Cyperus nitida* NC-K143, and its application. Background Technology

[0002] Staphylococcus aureus is an important pathogenic bacterium in humans, belonging to the genus Staphylococcus, and is a representative of Gram-positive bacteria. Penicillin has played a crucial role in controlling Staphylococcus aureus infections, but with the use of antibiotics, various drug-resistant strains have emerged, including penicillin-resistant Staphylococcus aureus (PRSA), methicillin-resistant Staphylococcus aureus (MRSA), and vancomycin-resistant Staphylococcus aureus (VRSA). MRSA, as a typical example of a superbug, has developed multidrug resistance and has become one of the key multidrug-resistant bacteria monitored in clinical practice.

[0003] Therefore, there is an urgent need to develop different prevention and control technologies, especially those targeting drug-resistant strains. The use of biocontrol strains and their active products as novel biocontrol microbial agents to control pathogens is attracting increasing attention. Therefore, screening and identifying biocontrol strains with significant antagonistic effects against Staphylococcus aureus is of great significance for the treatment of Staphylococcus aureus infections, especially drug-resistant Staphylococcus aureus infections. Summary of the Invention

[0004] In order to solve the above-mentioned technical problems, the present invention provides a *Syntrophus kiwi* NC-K143 for preventing and treating pathogenic bacterial infections, a bacteriostatic agent, and its application.

[0005] In a first aspect, the present invention provides a *Syntrophus kiwi* NC-K143 for preventing and treating pathogenic bacterial infections, which is achieved through the following technical solution.

[0006] Kitasporium NC-K143, a strain for preventing and treating pathogenic bacterial infections, is classified and named... Kitasatospora sp. The strain NC-K143 was deposited at the China Center for Type Culture Collection (CCTCC) on March 27, 2025, with accession number CCTCC NO: M2025616 and address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0007] Furthermore, *Cyclophorus niger* NC-K143 grew well in Gao's No. 1 medium, with rod-shaped cells; when cultured on LB agar plates, the colonies were round, reddish-brown, opaque, with a dry, wrinkled surface, irregular edges, a central depression, and embedded in the surface of the solid medium.

[0008] Furthermore, the fermentation medium for *Sporidis kimosporin* NC-K143 consisted of 20.0 g / L sucrose, 30.0 g / L soluble starch, 2.0 g / L peptone, 8.0 g / L soybean flour, 0.5 g / L MgSO4·7H2O, 0.5 g / L K2HPO4·7H2O, 2.0 g / L NaCl, 3.0 g / L CaCO3, and an initial pH of 8.0.

[0009] Secondly, the present invention provides the use of *Synthia spp.* NC-K143 for preventing and treating pathogenic bacterial infections, which is achieved through the following technical solution.

[0010] The application of the above-mentioned *Sargassum fusiforme* NC-K143 in the preparation of drugs for the prevention and treatment of pathogenic bacterial infections.

[0011] Furthermore, the pathogens include Candida krusei, Candida hemorrhagicum, Candida auris, Candida albicans, Pseudomonas aeruginosa, Bacillus belye, Bacillus cereus, Staphylococcus aureus, and Clostridium perfringens.

[0012] Thirdly, the present invention provides an antibacterial agent, which is achieved through the following technical solution.

[0013] An antibacterial agent comprising the aforementioned *Cyperus nitida* NC-K143.

[0014] Fourthly, the present invention provides an application of an antibacterial agent, which is achieved through the following technical solution.

[0015] The application of the above-mentioned antibacterial agent in the preparation of drugs for preventing and treating pathogenic bacterial infections.

[0016] This application has the following beneficial effects:

[0017] This invention addresses the current lack of highly effective and safe drug treatments for Staphylococcus aureus infections, coupled with the problem of Staphylococcus aureus developing resistance to common methicillin antibiotics. Through the isolation, screening, and efficacy testing of Staphylococcus aureus antagonistic bacteria, a new strain of *Staphylococcus niger* NC-K143 with antagonistic activity against Staphylococcus aureus was isolated and screened. Based on this, a novel biocontrol agent was developed, which is of great significance for reducing the use of large amounts of antibiotics, mitigating environmental pollution, and preventing the emergence of drug-resistant bacteria. Attached Figure Description

[0018] Figure 1This is a colony morphology diagram of *Cyperus nitida* NC-K143 from the present invention;

[0019] Figure 2 This is a microscopic morphological image of *Cyperus nitida* NC-K143 of the present invention;

[0020] Figure 3 This is a diagram illustrating the antibacterial effect of the present invention, *Cyperus niger* NC-K143.

[0021] Figure 4 The diagram shows the antibacterial effect of the present invention, *Cyperus nitida* NC-K143, on different culture media.

[0022] Figure 5 This is a graph showing the cytotoxicity results of different concentrations of the supernatant of *Cyperus nitida* NC-K143 in this invention.

[0023] Figure 6 This is a diagram showing the molecular identification results of *Cyperus nitida* NC-K143 in this invention;

[0024] Figure 7 This is a phylogenetic tree diagram of *Cyperus nitidissima* NC-K143 of this invention;

[0025] Figure 8 This is a graph showing the results of the inhibition of Staphylococcus aureus growth by different concentrations of the supernatant of *Synthia spp.* NC-K143 in this invention. Detailed Implementation

[0026] The invention will be further described below with reference to the accompanying drawings and embodiments. Unless otherwise specified, the experimental methods used in this invention are conventional methods, and the experimental equipment, materials, reagents, etc. used can all be purchased from relevant material sales companies.

[0027] Example 1: Isolation and purification of bacterial strains

[0028] 1. Culture medium

[0029] Gao's No. 1 culture medium: KNO3 1.0 g, K2HPO4·3H2O 0.5 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O 0.01 g, soluble starch 20.0 g, agar 20.0 g, distilled water 1.0 L, pH 7.2-7.4, sterilized at 121℃ for 20 minutes.

[0030] 2. Experimental Procedure

[0031] 2.1 Culture medium preparation

[0032] Prepare Gao's No. 1 agar medium to make bacterial culture plates.

[0033] 2.2 Sample Collection

[0034] Plant rhizosphere soil was collected from schools, hospitals, parks, and other locations in different regions, placed in bags, and recorded.

[0035] 2.3 Grind the soil and prepare it into a suspension.

[0036] Grind the soil into small pieces, chop it up, and resuspend it in sterile water. Prepare a soil dilution solution at a concentration of 1:10 (g / ml). -1 Take the supernatant and serially dilute it 10-fold (10 -2 10 -3 10 -4 10 -5 )spare.

[0037] 2.4 Bacterial Isolation

[0038] Select the above 10 -2 10 -3 10 -4 and 10 -5 0.1 ml of each of the four concentrations was spread onto prepared Gao's No. 1 solid culture medium plates. The inoculated culture dishes were inverted and incubated at 28°C for 3 days. Afterward, single clones of different morphologies were picked as much as possible.

[0039] 3. Results

[0040] 500 bacterial strains were isolated using the method described above.

[0041] Example 2: Plate antagonism test of isolated bacteria against Staphylococcus aureus

[0042] 1. Culture medium

[0043] 1.1 Solid Culture Media

[0044] LB solid medium: 10g tryptone, 5g yeast extract, 10g sodium chloride, 15g agar powder, add distilled water and bring the volume to 1L. Sterilize at 121℃ for 20 minutes.

[0045] 1.2 Liquid culture medium

[0046] LB liquid medium: without agar, otherwise the same as LB solid medium.

[0047] 2. Experimental Procedure

[0048] 2.1 Plate Antagonism Test - Initial Screening

[0049] 2.1.1 Activation of microbial strains

[0050] Staphylococcus aureus and bacteria were activated: Staphylococcus aureus and isolated bacteria were transferred to LB agar plates and Gao's No. 1 agar plates, respectively, and incubated at 35℃ and 28℃ for 2 days, respectively, for later use.

[0051] 2.1.2 Preparation of Staphylococcus aureus plates

[0052] Activated Staphylococcus aureus was inoculated into liquid culture medium and cultured in shake flasks at 35°C and 200 rpm. The next day, LB agar plates were poured onto the plates, and after the medium cooled to 45°C, 0.1 ml (OD) was added to every 15 ml of solid LB agar. 600 Take approximately 2.0% of the Staphylococcus aureus fermentation broth, mix well, pour into a plate, and dry for later use.

[0053] Note: OD 600 It refers to the absorbance of a certain solution at a wavelength of 600nm.

[0054] 2.1.3 Initial screening using plate antagonism test

[0055] Use a sterilized toothpick to pick up a single colony of the activated isolated bacteria and spot it onto a Staphylococcus aureus plate. Perform three replicates for each bacterial strain and incubate at 35°C. Observe the experimental results at 24h, 36h, and 48h, mainly observing the presence or absence of inhibition zones.

[0056] 2.2 Plate Antagonism Test - Secondary Screening

[0057] 2.2.1 Activation of microbial strains

[0058] Same as 2.1.1, activate the selection of isolated bacteria with inhibition zones in the initial screening.

[0059] 2.1.2 Preparation of Staphylococcus aureus plates

[0060] Same as 2.1.2, after the flat plate is dried, use a 5mm diameter hole punch to make holes for later use.

[0061] 2.2.3 Isolation of bacteria for liquid fermentation

[0062] The activated and isolated bacteria were transferred into liquid Gao's No. 1 medium and cultured in shake flasks at 28°C and 200 rpm for 48 hours (OD). 600 Approximately 2.0).

[0063] 2.2.4 Plate Antagonism Test for Secondary Screening

[0064] Use a pipette to draw 10 μl of the isolated bacterial fermentation broth and place it into a well of a Staphylococcus aureus plate. Dry the plate, repeat in triplicate, and incubate at 35°C. Observe the experimental results at 24 h, 36 h, and 48 h, focusing on the presence and size of inhibition zones.

[0065] 3. Results

[0066] Bacteria with antagonistic effects were obtained through initial screening tests, and then further screened by perforating plates in a plate antagonism test to obtain bacteria with relatively good antagonistic effects. Strain NC-K143 is one of these strains. See also Figure 1 and Figure 2 The images show the colony morphology and microscopic morphology of strain NC-K143. Figure 3 The method involves adding 0.1 ml of Staphylococcus aureus fermentation broth to a plate, then punching holes with a punch, placing the fermentation broth of strain NC-K143 into the holes, drying it, and incubating it at 35°C.

[0067] Depend on Figure 3 The obvious inhibition zone indicates that strain NC-K143 has a significant antagonistic effect against Staphylococcus aureus.

[0068] Example 3: Optimization of fermentation conditions for the isolated NC-K143 strain

[0069] 1. Experimental steps:

[0070] 1.1 Preparation of seed culture for NC-K143 strain

[0071] Pick a single colony of NC-K143 with an inoculation loop and inoculate it into Gao's No. 1 liquid medium. Incubate at 28°C and 200 rpm for 48 hours for later use.

[0072] 1.2 Prepare a series of culture media with the following formula, and autoclave them for later use.

[0073] ISP1 medium formulation: 5g casein peptone, 3g yeast extract, 15g agar (liquid, excluding) pH 7.0 ±0.2, add 1 L deionized water, boil until completely dissolved. Sterilize at 121ºC for 15 min.

[0074] ISP2 culture medium formula: 10g malt extract, 4g yeast extract, 4g D-glucose, pH 7.2 ± 0.2, add 1 L deionized water, boil until completely dissolved. Sterilize at 121ºC for 15 min.

[0075] ISP3 medium formulation: 20g oat flour, 0.001g ferrous sulfate heptahydrate, 0.001g manganese chloride tetrahydrate, 0.001g zinc sulfate heptahydrate, pH 7.3 ± 0.2, add 1 L deionized water, boil until completely dissolved. Sterilize at 121ºC for 15 min.

[0076] ISP4 culture medium formula: 10g soluble starch, 1g dipotassium hydrogen phosphate, 1g magnesium sulfate heptahydrate, 1g sodium chloride, 2g ammonium sulfate, 2g calcium carbonate, 0.001g ferrous sulfate heptahydrate, 0.001g manganese chloride tetrahydrate, 0.001g zinc sulfate heptahydrate, pH 7.2 ± 0.2. Add 1 L deionized water and boil until completely dissolved. Sterilize at 121ºC for 15 min.

[0077] Culture medium formula No. 6: 20.0g sucrose, 30.0g soluble starch, 2.0g peptone, 8.0g soybean flour, 0.5g MgSO4·7H2O, 0.5g K2HPO4·7H2O, 2.0g NaCl, 3.0g CaCO3, add 1 L deionized water, initial pH 8.0, boil until completely dissolved. Sterilize at 121ºC for 15 min.

[0078] Culture medium formula No. 7: 20 g / L soybean meal, 2 g / L soybean peptone, 20 g / L glucose, 5 g / L soluble starch, 2 g / L yeast powder, 4 g / L NaCl, 0.5 g / L K2HPO3, 0.5 g / L MgSO4·H2O, 2 g / L CaCO3, add 1 L deionized water, sterilize at 121ºC for 15 min.

[0079] 1.3 Preparation of fermentation broth for NC-K143 strain in different culture media

[0080] Add 2 ml of prepared culture medium to each 10 ml centrifuge tube, followed by 10 μl of NC-K143 strain seed culture. Incubate at 28°C and 200 rpm for 5 days. Centrifuge the fermentation broth at 12,000 rpm for 10 minutes and collect the supernatant for later use.

[0081] 1.4 Preparation of Staphylococcus aureus plates

[0082] As in Example 2, section 2.1.2, after the flat plate is dried, holes are punched with a 5mm diameter punch for later use.

[0083] 1.5 Antibacterial activity test

[0084] Take 50 μL of the supernatant from the different culture media prepared in 1.3 and add it to the wells of the plate prepared in 1.4. Incubate at 37°C for 24 hours and observe the presence and size of inhibition zones. Select the culture medium with the largest inhibition zone as the optimal culture medium for subsequent experiments.

[0085] 2. Experimental Results:

[0086] like Figure 4As shown, the fermentation broths of ISP1, ISP2, and ISP3 media had almost no activity, while the activity of ISP4, 6, and 7 media was acceptable. By measuring the diameter of the inhibition zone, it was found that the fermentation broth of medium 6 had the strongest activity. Therefore, medium 6 was selected as the optimal fermentation medium for NC-K143 strain.

[0087] Example 4: Cytotoxicity detection of fermentation broth of strain NC-K143

[0088] 1. Experimental steps:

[0089] 1.1 Resuscitation of A549 cells

[0090] Remove the cryovials from the liquid nitrogen tank and immerse them directly in 37°C warm water, shaking them occasionally to thaw them quickly. Collect the cells by centrifugation at 1000 rpm for 5 minutes, then resuspend the cells in DMEM containing 10 (v / v)% FBS and seed them into culture flasks. Incubate at 37°C in a 5 (v / v)% CO2 incubator. Change the culture medium the next day and continue culturing.

[0091] 1.2 A549 cell plating

[0092] Prepare A549 cell suspension and count cells. Finally, seed 96-well plates and add 100 μL of DMEM containing 1 (v / v)% FBS to each well. 4 Cells were incubated overnight at 37°C in a 5 (v / v)% CO2 incubator.

[0093] 1.3 Preparation of fermentation broth for strain NC-K143

[0094] Add 2 ml of medium No. 6 to each 10 ml centrifuge tube, and then add 10 μl of NC-K143 strain seed culture to each tube. Incubate at 28℃ and 200 rpm for 5 days. Centrifuge the fermentation broth at 12000 rpm for 10 minutes and collect the supernatant for later use.

[0095] 1.4 Toxicity test of antagonistic bacteria fermentation broth

[0096] This experiment included a blank control group with no cells, i.e., DMEM containing only 1 (v / v)% FBS; a sample control (natural release) well, i.e. containing only cells without treatment; a well with maximum cell enzyme activity, i.e. containing lysis buffer; and treatment with strain NC-K143: the fermentation broth prepared in 1.3 was used to treat cells at final concentrations of 0% (with an equal volume of blank medium added to the experimental group), 5%, 10%, and 20%.

[0097] 1.5 Detection of LDH release from cells

[0098] Twelve hours later, the supernatant of each group was collected and the LDH release was detected (the specific method is the same as the lactate dehydrogenase cytotoxicity test kit C0017 from Beyotime Biotechnology Co., Ltd.).

[0099] Calculation formula: Cytotoxicity or mortality rate (%) = (Absorbance of treated sample - Absorbance of sample control well) / (Absorbance of maximum enzyme activity of cells - Absorbance of sample control well) × 100. Note: The absorbance of the background blank control well should be subtracted from the absorbance of each group.

[0100] 2. Results

[0101] like Figure 5 As shown in the figure, 0%, 5%, 10%, and 20% represent the amount of LDH released by cells after treatment with the supernatant of the strain of this invention. Higher LDH release indicates greater cell death, thus the toxicity of a substance to cells can be determined by detecting the amount of LDH released. In this figure, the LDH release after treatment with the supernatant of the strain at different concentrations is very low (below 10%), indicating that the biocontrol bacterium has very weak or even non-toxic cytotoxicity. This demonstrates that the fermentation broth of this strain, when used to make a biological agent, is safe and has good reproducibility.

[0102] Example 5: Identification of the isolated bacterial strains

[0103] Physiological and biochemical experiments of strain 1

[0104] (1) Salt tolerance test:

[0105] The strains were inoculated onto a medium containing NaCl concentrations ranging from 0 to 13% (w / v) with a 1% concentration gradient, and cultured at 28°C for 7 to 14 days. The growth status of the test strains was observed and recorded.

[0106] (2) Temperature tolerance test:

[0107] The test strains were inoculated onto sterilized Gao's No. 1 medium and incubated at constant temperatures of 4, 10, 16, 20, 25, 28, 30, 37, 40 and 45°C for 2 weeks, respectively. The growth of the strains under different temperature conditions was observed and recorded.

[0108] (3) pH tolerance test:

[0109] Gao's No. 1 medium was used as the basal medium for pH tolerance testing. The pH value of the medium was adjusted using NaOH and HCl solutions, with a pH range of 4.0-13.0 and a gradient of 1.0 pH increments. The test strains were inoculated onto the medium, and the pH growth range of the strains was observed and recorded.

[0110] (4) Experiment on the utilization of the sole carbon source:

[0111] A single carbon source (0.5%, w / v) was added to the basal medium for carbon source utilization, with a blank control included. The medium was sterilized at 115℃ for 10 min. The tested single carbon sources included inositol, D-trehalose, D-fructose, D-raffinose, D-sorbitol, D-galactose, D-mannitol, D-glucose, rhamnose, xylose, sucrose, and ribose. After inoculation, the strains were cultured in shake flasks at 28℃ for 1-2 weeks, and the growth of the strains was observed and recorded.

[0112] (5) Experiment on the utilization of the only nitrogen source:

[0113] A single nitrogen source (0.5%, w / v) was added to the nitrogen-utilizing basal medium, with a blank control included, and the medium was sterilized at 112℃ for 20 min. The tested single nitrogen sources included L-asparagine, L-lysine, L-cysteine, L-threonine, L-valine, L-methionine, L-serine, D-arginine, and creatine. The inoculated strains were cultured in shake flasks at 28℃ for 1-2 weeks, and the growth of the strains was observed and recorded.

[0114] (6) Nitrate reduction test:

[0115] Inoculate the test strain into nitrate-reducing medium and incubate at 28°C for 1-2 weeks. After incubation, take a small amount of culture medium, add one drop each of Griess's reagent A and B, and observe. If the solution turns pink or orange, the result is positive. If there is no color change, add a small amount of zinc powder to the solution. If it turns red, the result is negative. If there is no color change, it is considered that the nitrate has been reduced to other substances and treated as a positive result.

[0116] (7) Gelatin liquefaction test:

[0117] The test strains were inoculated into gelatin liquefaction medium and incubated at 30°C for 1-3 weeks. The gelatin liquefaction was observed on days 7, 14, and 21. The test tubes were first cooled at 4°C for 15-20 minutes before being removed to observe the liquefaction. A positive result was indicated by a liquid upper layer on the gelatin liquefaction medium, while a negative result was indicated by a liquid upper layer.

[0118] (8) Milk coagulation and peptone test:

[0119] The test strains were inoculated into milk coagulation and peptonization medium and incubated at 28°C. Observations were taken on days 5, 10, 20, and 30. The presence of clumps in the medium indicates coagulation, while the appearance of liquid after coagulation indicates peptonization.

[0120] (9) Aescin hydrolysis test:

[0121] The test strain was inoculated into aesculin medium and cultured at 28°C for 1-3 weeks. The result was positive if the culture medium turned black, and negative if it did not turn black. A medium without inoculation of the strain was set up as a control.

[0122] (10) H2S generation test:

[0123] Inoculate the test strain onto Chesna medium and incubate at 28°C for 5-14 days. If the culture turns black, it indicates that the generated H2S combines with ferric citrate to form FeS, which is a positive result. If the culture does not change color, it is a negative result. Set up a control.

[0124] (11) Catalase test:

[0125] Add 3% H2O2 to the colonies of the test strain that have grown well after a period of incubation, and observe the results. If a large number of bubbles are produced within 30 seconds, the result is positive; if no bubbles are produced, the result is negative.

[0126] (12) Melanin production test:

[0127] Inoculate the test strain into ISP6 and ISP7 media and incubate at 28°C for 1-2 weeks. If black, diffusible pigment is observed on the media, the result is positive; otherwise, it is negative.

[0128] The ISP6 medium (peptone-yeast extract iron medium) formula is as follows: peptone 15.0 g, iodine peptone 5.0 g, ferric ammonium citrate 0.5 g, K2HPO4 1.0 g, Na2S2O3 0.08 g, agar 15.0 g, distilled water 1.0 L, pH 7.0-7.2.

[0129] ISP7 medium (tyrosine medium) formulation: L-tyrosine 0.5 g, glycerol 15.0 g, K₂HPO₄ 0.5 g, MgSO₄·7H₂O 0.5 g, L-asparagine 1.0 g, NaCl 0.5 g, FeSO₄·7H₂O 0.01 g, trace salt (Ho-Le trace elements) 1.0 mL, agar 20.0 g, distilled water 1.0 L, pH 7.2-7.4. 1 L of Ho-Le trace element solution formulation is as follows: boric acid 2.85 g, manganese chloride tetrahydrate 1.8 g, ferrous sulfate heptahydrate 1.36 g, sodium tartrate 1.77 g, copper chloride dihydrate 26.9 mg, zinc chloride 20.8 mg, cobalt chloride hexahydrate 40.4 mg.

[0130] The morphological, cultural, physiological, and biochemical characteristics of this strain are shown in Table 1:

[0131] NC-K143: Grows well in Gao's No. 1 medium. The strain cells are rod-shaped. When cultured on LB agar plates, the colonies are round, reddish-brown, opaque, with a dry, wrinkled surface, irregular edges, and a central depression, embedded in the surface of the solid medium. The summary of biochemical identification results is shown in Table 1.

[0132] Table 1. Physicochemical experimental results of strain NC-K143

[0133]

[0134] Note: "++" indicates excellent growth, "+" indicates growth or a positive result, and "-" indicates no growth or a negative result.

[0135] 2. Molecular identification of the strain

[0136] 2.1 Extraction of bacterial genome

[0137] Single colonies were picked from Gao's No. 1 plates and inoculated into fresh Gao's No. 1 liquid medium. The culture was incubated at 28°C with shaking at 200 rpm for 2 days. 1 mL of the bacterial suspension was collected by centrifugation. Genomic DNA was extracted according to the instructions of the fungal genomic DNA extraction kit (CW0552S, Kangwei Century, China).

[0138] 2.2 16S rDNA Gene amplification

[0139] Using 2 × Taq Master Mix (Dye Plus) (product number: P112-01) from Qingke Biotechnology, with genomic DNA as a template, and using 16S-F / 16S-R, atpD-F / atpD-R, gyrB-F / gyrB-R, recA-F / recA-R, rpoB-F / rpoB-R, and trpB-F / trpB-R as primers, 16S-F / 16S-R was amplified. rDNA The genes atpD, gyrB, recA, rpoB, and trpB were amplified. The amplification system consisted of 50 ng of genomic DNA, 0.4 μM of forward primer, 0.4 μM of reverse primer, 25 μL of 2 × Taq Master Mix, and H2O to a final volume of 50 μL. The DNA amplification program was as follows: pre-denaturation at 95℃ for 3 minutes, denaturation at 95℃ for 10 seconds, annealing at Tm for 10 seconds, extension at 72℃ for 1 minute / Kb, 35 cycles, and a final extension at 72℃ for 5 minutes. The amplified fragments were detected as single bands by 1% (g / ml) agarose gel electrophoresis (fragment lengths were approximately 1360 bp, 1400 bp, 2100 bp, 1131 bp, 3486 bp, and 822 bp, respectively). Figure 6As shown in the image, the sequence was sent to a sequencing company (Hunan Qingke Biotechnology Co., Ltd., China). After obtaining the sequence, it was compared and analyzed using BLAST (http: / / www.ncbi.nlm.nih.gov) in GenBank to obtain the names of similar identified strains and thus identify the bacterial species.

[0140] Table 2. Primer Information

[0141]

[0142] 2.3 16S rDNA Sequencing and alignment analysis of atpD, gyrB, recA, rpoB and trpB genes

[0143] The gene sequence determination results of strain NC-K143 are as follows:

[0144] 16S rDNA Gene sequence (SEQ ID NO.13)

[0145]

[0146] atpD gene sequence (SEQ ID NO.14)

[0147]

[0148] gyrB gene sequence (SEQ ID NO.15)

[0149]

[0150] recA gene sequence (SEQ ID NO.16)

[0151] GATCGAGCGGCAGTTCGGCAAGGGCTCGGTGATGCGCCTCGGCGAGAAGGCCAACGAGCCGATCGAGGTGATCCCCACGGGGTCCACCGCCCTGGACGTCGCCCTCGGGGTCGGCGGCATCCCGCGCGGCCGGGTGATCGAGATCTACGGCCCCGAGTCCTCCGGCAAGACCACGCTGACCCTGCACCTGGCGGCCAACGCCCAGCGGGCCGGCGGCACGGTCGCCTTCGTCGACGCGGAGCACGCGCTCGACCCGGAGTACGCCAAGAAGCTCGGCGTGGACACCGACGCCCTGCTGGTCAGCCAGCCGGACACCGGTGAGCAGGCCCTGGAGATCACCGACATGCTGATCCGCTCCGGCGCGATCGACCTGGTGATCATCGACTCCGTCGCGGCGCTCGTGCCGCGCGCGGAGATCGAGGGCGAGATGGGCGACTCGCACGTCGGTCTGCAGGCCCGTCTGATGAGCCAGGCGCTGCGGAAGATCGCCGGTGCGCTGAACCAGTCGAACACCACTGCGATCTTCATCAACCAGCTGCGCGAGAAGATCGGGGTCATGTTCGGCTCGCCGGAGACCACGACCGGTGGCCGGGCGCTGAAGTTCTACGCCTCGGTCCGGCTGGACATCCGCCGGATCGAGACCCTGAAGGACGGCACCGAGGCGGTCGGTAACCGCACCCGCGTCAAGGTCGTCAAGAACAAGGTCGCCGCGCCGTTCAAGCAGGCCGAGTTCGACATCCTCTACGGCGTCGGCATCAGCCGCGAGGGCGGCCTGATCGACATGGGTGTGGAGCACGGCTTCATCCGCAAGTCGGGTGCCTGGTACACCTACGAGGGCGACCAGCTCGGCCAGGGCAAGGAGAACGCCCGCAACTTCCTGCGGGACAACCCGCAGCTGGCCGACGAGATCGAGCGGAAGATCAAGGGCAAGCTGGGCATCGGCCCGAAGGT

[0152] rpoB gene sequence (SEQ ID NO.17)

[0153]

[0154] trpB gene sequence (SEQ ID NO.18)

[0155] ACAGCAGCCGCAGCGCCTGCATGGCGGCGTCGTCCGGTGGCCGGACGGTACTCGGCCCGGCCGGTGTCCTTCAGCCAGGCGTGCTCCGGGCCGACGCCCGGGTAGTCCAGGCCGGCCGAGATCGAGTGCGACTCGATGGTCTGCCCGTCCTCGTCCTGCAGGACGTAGGTGCGCGAGCCGTGCAGCACGCCCGGGTCGCCCTTGGTGAGGGTCGCGGCGTGCTTCGGGGTCTCGGCGCCCTCGCCGGCCGCCTCGCAGCCGATCAGCCGCACCCCGGCGTCCGGGATGAACTCGTGGAAGATGCCCATCGCGTTGGAGCCGCCGCCGACGCAGGCGACGACCGCGTCGGGCAGCCGCCCGGTGCGGTCCAGCACCTGCTGCCGGGCCTCGACGCCGATCACCCGGTGGAAGTCGCGGACCATCATCGGGAAGGGGTGCGGGCCGGCGACGGTGCCGAACAGGTAGTGGGTGGAGTCGACGTTGGCGACCCAGTCCCGGAACGCCTCGTTGATGGCGTCCTTGAGGGTGCGGCTGCCGGAGGTCACGGCCACCACCTCGGCGCCGAGCATCCGCATCCGGGCCACGTTCAGCGCCTGGCGCTGGGTGTCGACCTCGCCCATGTAGATGGTGCAGTCGAAGCCGAACAGCGCGCAGGCGGTGGCGGTGGCCACGCCGTGCTGGCCGGCGCCGGTCTCGGCGATGATCCGGGTCTTGCCCATCCG

[0156] 3 Phylogenetic tree construction and analysis

[0157] The obtained 16S rDNAThe original sequences of the atpD, gyrB, recA, rpoB, and trpB genes were assembled and verified using DNAStar analysis software, then submitted to GenBank to obtain accession numbers. Sequence homology searches were performed using the Blast program on NCBI (http: / / www.ncbi.nlm.nih.gov). The corresponding gene sequences of relevant strains were downloaded and assembled into a single sequence according to the gene order of atpD, gyrB, recA, rpoB, and trpB. A phylogenetic tree based on the merged gene sequence of atpD, gyrB, recA, rpoB, and trpB was constructed using the Neighbour-joining method in MEGA 7.0 software. The species classification of the strain was determined based on sequence homology and phylogenetic relationships. Results are shown below. Figure 7 .

[0158] This application used physiological and biochemical analysis, as well as BLAST analysis of six gene sequences, to identify no strains with high similarity. However, phylogenetic tree construction using multiple sequences revealed that this strain belongs to a new species, which was subsequently named... Kitasatospora sp. NC-K143.

[0159] Example 6: Determination of the antibacterial spectrum of strain NC-K143 and the growth inhibition curve of Staphylococcus aureus.

[0160] The antibacterial activity of NC-K143 against Gram-negative bacteria, Gram-positive bacteria, and yeast-like fungi (4 strains each, for a total of 12 strains) was detected in vitro using the pore-diffusion method. The selected fungi and the antibacterial results are shown in Table 3. The larger the diameter of the inhibition zone, the greater the antibacterial effect.

[0161] 1. Experimental Methods

[0162] 1.1 Strain activation

[0163] Each glycerol bacterium frozen at -80℃ was streaked onto LB agar plates. Twelve pathogenic bacteria were incubated at 37℃ for 24 hours for later use. Among them, Clostridium perfringens (number: ATCC13124) was cultured anaerobically.

[0164] 1.2 Preparation of NC-K143 fermentation supernatant

[0165] Select fermentation medium No. 6, which has the best antibacterial effect. The specific method is as follows: add 2 ml of medium No. 6 to each 10 ml centrifuge tube, and then add 10 μl of NC-K143 strain seed liquid. Incubate at 28℃ and 200 rpm for 5 days. Centrifuge the fermentation broth at 12000 rpm for 10 minutes and collect the supernatant for later use.

[0166] 1.3 Antibacterial test

[0167] Hole-diffusion method: Prepare bacterial suspensions of each pathogen (grown to the logarithmic phase with an OD600 of approximately 2.0). When LB solid medium cools to 45°C, add 100 μL of bacterial suspension to 15 ml of medium, mix quickly, and pour the plate. Make a hole (6 mm in diameter) in the center of the medium, and then add 50 μL of fermentation supernatant of the test bacteria NC-K143 to the hole. Repeat this process three times for each petri dish. Incubate at 37°C, and measure the diameter of the inhibition zone after 24 hours.

[0168] 1.4 Determination of growth inhibition curve

[0169] Staphylococcus aureus was cultured in LB liquid medium and grown to OD. 600 The concentration was approximately 2.0. Then, it was diluted 100-fold with LB liquid medium. The prepared NC-K143 fermentation supernatant was added to the diluted bacterial culture to achieve final concentrations of 0%, 5%, 10%, and 20% for the NC-K143 fermentation supernatant. The culture was then carried out, and the OD was measured periodically. 600 And with time as the x-axis, OD 600 Plot the growth curve on the ordinate.

[0170] 2. Results and Analysis

[0171] 2.1 The results of the antibacterial activity of strain NC-K143 against human pathogens are shown in Table 3.

[0172] Table 3. Summary of the antibacterial spectrum of strain NC-K143

[0173]

[0174] As can be seen from the table above, this strain can inhibit a variety of bacteria and yeast-like fungi, especially Gram-positive bacteria, and can be widely used. Among them, the inhibitory effect on Staphylococcus aureus is the best.

[0175] 2.2 The inhibitory effect of different final concentrations of NC-K143 fermentation supernatant on the growth curves of Staphylococcus aureus is shown in the figure. Figure 8 The horizontal axis represents time, and the vertical axis represents OD600 (i.e., Staphylococcus aureus turbidity). The higher the OD600 value, the more turbid the bacterial solution, and the better the bacterial growth. Compared with the 0% group, the growth of Staphylococcus aureus in the 5%, 10%, and 20% groups was significantly inhibited, and the inhibition effect was more obvious with the higher the concentration of NC-K143 fermentation supernatant.

[0176] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape, and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A gliothele NC-K143 for preventing and treating pathogenic bacteria infection, named as (NC-K143). Kitasatospora sp. The strain has been deposited with China Center for Type Culture Collection on March 27, 2025, and the accession number is CCTCC M 2025616.

2. The Nakamurella sp. NC-K143 according to claim 1, characterized by: Kitasatospora Kitasatospora NC-K143 grows well in Kitasato No. 1 medium, and the cell is rod-shaped. When cultured on LB agar plate, the colony is round, reddish-brown, opaque, dry and wrinkled on the surface, irregular in edge, concave in center, and inlaid on the surface of solid medium.

3. The Nakamurella sp. NC-K143 according to claim 1, characterized by: The fermentation medium of Kitasatospora NC-K143 comprises sucrose 20.0 g / L, soluble starch 30.0 g / L, protein peptone 2.0 g / L, soybean powder 8.0 g / L, MgSO4·7H2O 0.5 g / L, K2HPO4·7H2O 0.5 g / L, NaCl 2.0 g / L, CaCO3 3.0 g / L, and the initial pH is 8.

0.

4. Use of Kitasatospora NC-K143 of claim 1 in the preparation of a drug for preventing and treating infection of pathogenic bacteria, wherein the pathogenic bacteria are selected from the group consisting of Candida krusei, Candida guilliermondii, Candida auris, Candida albicans, Pseudomonas aeruginosa, Bacillus velezensis, Bacillus cereus, Staphylococcus aureus, Clostridium perfringens.

5. A bacteriostatic agent characterized in that: Kitasatospora NC-K143 of claim 1.

6. Use of the bacteriostatic agent of claim 5 in the preparation of a drug for preventing and treating infection of pathogenic bacteria, wherein the pathogenic bacteria are selected from the group consisting of Candida krusei, Candida guilliermondii, Candida auris, Candida albicans, Pseudomonas aeruginosa, Bacillus velezensis, Bacillus cereus, Staphylococcus aureus, Clostridium perfringens.

Images