Low-pH-tolerant escherichia coli and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to low-pH-tolerant escherichia coli and application thereof. According to the escherichia coli LZ1, the strain is sent to the China Center for Type Culture Collection (CCTCC), the preservation date is November 11, 2024, and the preservation number is CCTCC NO: M 20242513. According to the invention, the mutS gene of the coding DNA mismatch repair protein in the Escherichia coli MG1655 genome is knocked out, and based on an adaptive evolution breeding technology, the Escherichia coli with excellent low pH tolerance is obtained, and meanwhile, it is accidentally found that the Escherichia coli also has good tolerance in an alkaline environment, so that the Escherichia coli with excellent low pH tolerance can be obtained. Therefore, the Escherichia coli LZ1 with low pH tolerance and broad-spectrum pH tolerance can be obtained, so that the Escherichia coli LZ1 can be used as a potential chassis cell for synthesis of different compounds, and has good practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to an Escherichia coli tolerant to low pH and its application. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the overall understanding of the present invention, and it is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] In the modern bio-fermentation industry, while microorganisms use substrates represented by sugars to synthesize target products in large quantities, organic acids represented by acetic acid and lactic acid are often produced due to metabolic overflow, resulting in a decrease in the pH of the culture medium. Most microorganisms cannot grow well in a low pH environment. Therefore, reducing the pH can also be an effective strategy to reduce the risk of contamination by miscellaneous bacteria. However, the pH tolerance of most fermentation strains themselves is not high. Therefore, regulating and controlling the pH of the fermentation medium has become an important and crucial link, but the addition of alkaline substances increases the production cost of the product. Therefore, if a fermentation strain tolerant to a low pH environment can be obtained, on the one hand, the low pH environment can be used to avoid contamination by other microorganisms, and on the other hand, the cost of adding alkaline substances can be reduced.

[0004] As the most commonly used microbial synthesis chassis cell, Escherichia coli generally shows better growth in an environment close to neutral with a pH of 6.5 - 7.5, while its growth will be inhibited to a certain extent in an acidic pH environment, especially in an environment with a pH less than 5.0, and it cannot be normally used for fermentation production. Therefore, growth in a low pH environment is a huge challenge for Escherichia coli. Summary of the Invention

[0005] In view of the above-mentioned prior art, the present invention provides an Escherichia coli tolerant to low pH and its application. The present invention knocks out the mutS gene encoding DNA mismatch repair protein in the genome of Escherichia coli MG1655, and based on the adaptive evolution breeding technology, an Escherichia coli with excellent low pH tolerance is obtained. At the same time, it is also unexpectedly found that it also has good tolerance in an alkaline environment, so as to obtain an Escherichia coli tolerant to low pH and having broad-spectrum pH tolerance, thereby effectively expanding its application fields and scope. Based on the above research results, the present invention is completed.

[0006] The present invention is achieved by the following technical solutions:

[0007] In the first aspect of the present invention, an Escherichia coli LZ1 strain is provided. This strain has been deposited at the China Center for Type Culture Collection (address: Wuhan University, Luojia Mountain, Wuchang, Hubei Province), with the deposition date being November 11, 2024, and the deposition number being CCTCC NO: M 20242513. This strain can grow normally in an environment with a low pH (such as pH 4.0), and can also grow normally in a neutral environment. Moreover, its growth rate is faster under neutral conditions, and it also has good growth performance in an alkaline environment.

[0008] In the second aspect of the present invention, a method for constructing the above-mentioned Escherichia coli LZ1 is provided. The construction method includes:

[0009] Knocking out the mutS gene encoding the DNA mismatch repair protein in the genome of Escherichia coli MG1655 to increase the probability of gene mutation during the continuous evolution process, and further obtaining the Escherichia coli cells by continuously subculturing them in an acidic medium with gradually decreasing pH based on the adaptive evolution breeding technique.

[0010] Among them, the Red homologous recombination technique can be used to knock out the mutS gene, and no specific limitation is made here.

[0011] In the third aspect of the present invention, a method for culturing the above-mentioned Escherichia coli is provided. The culturing method includes inoculating the Escherichia coli LZ1 into a fermentation medium for fermentation culture to obtain the product.

[0012] The fermentation medium can be any known bacterial medium. In a specific embodiment of the present invention, the medium is an LBG medium.

[0013] The pH of the fermentation medium can be acidic, neutral, or alkaline.

[0014] In the fourth aspect of the present invention, a microbial inoculum is provided, which contains the Escherichia coli LZ1 or its fermented product or its metabolite.

[0015] In the fifth aspect of the present invention, the above-mentioned Escherichia coli LZ1 or the above-mentioned microbial inoculum is provided for use as a chassis microorganism in the synthesis of compounds based on microorganisms.

[0016] Furthermore, in the above application, the application environment for the synthesis of compounds can be an acidic environment, a neutral environment, or an alkaline environment.

[0017] Advantages of the above one or more technical solutions:

[0018] The acid-resistant Escherichia coli LZ1 provided by the above technical solution can grow under acidic, neutral, and alkaline environmental conditions. In particular, it can grow normally in an environment with a pH of 4.4 - 7.0. On the one hand, the low-pH environment can be used to avoid the contamination of other microorganisms, and on the other hand, the cost of adding alkaline substances can be reduced. Escherichia coli LZ1 can be used as a potential chassis cell for the synthesis of different compounds, so it has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0020] Figure 1 Comparison of the growth of the starting strain MG1655ΔmutS(A) and the final evolved strain LZ1(B) of the present invention in LBG medium at pH = 6.5, 6.0, 5.5, 5.0, 4.5, and 4.0.

[0021] Figure 2 Growth of the final evolved strain LZ1 and the starting strain MG1655ΔmutS of the present invention in LBG medium at pH = 4.0 - 7.0.

[0022] Figure 3 Growth of the final evolved strain LZ1, the starting strain MG1655ΔmutS, and the wild strain MG1655 of the present invention in LBG medium at pH = 7.0.

[0023] Figure 4 Growth of the final evolved strain LZ1 and the starting strain MG1655ΔmutS of the present invention in LBG medium at pH = 8 - 12. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0024] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0025] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. It should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments and not for limiting the protection scope of the present invention.

[0026] In a typical specific embodiment of the present invention, an Escherichia coli LZ1 strain is provided. This strain has been deposited with the China Center for Type Culture Collection (address: Wuchang Luojia Hill, Wuhan University, Hubei Province). The deposit date is November 11, 2024, and the deposit number is CCTCC NO: M 20242513. This strain can grow normally in a low pH environment (such as pH 4.0), can also grow normally in a neutral environment, and its growth rate is faster under neutral conditions; it can also have good growth performance in an alkaline environment.

[0027] In another specific embodiment of the present invention, a method for constructing the above-mentioned Escherichia coli LZ1 is provided. The construction method includes:

[0028] Knock out the mutS gene encoding the DNA mismatch repair protein in the genome of Escherichia coli MG1655 to increase the probability of gene mutation during continuous evolution. Further, based on the adaptive evolution breeding technology, continuous subculture of Escherichia coli cells is carried out in an acidic medium with gradually decreasing pH to obtain it.

[0029] Among them, the Red homologous recombination technology can be used to knock out the mutS gene, and specific limitations are not made here.

[0030] In another specific embodiment of the present invention, a method for culturing the above-mentioned Escherichia coli is provided. The culturing method includes inoculating the Escherichia coli LZ1 into a fermentation medium for fermentation culture to obtain it.

[0031] Among them, the fermentation medium can be a common bacterial medium. In a specific embodiment of the present invention, the selected medium is LBG medium. In the present invention, the culturing method is not specifically limited, and any conventional bacterial fermentation culturing method can be used for culturing.

[0032] The pH of the fermentation medium can be acidic, neutral or alkaline. The specific pH is 4.0 - 10.0, further 4.0 - 7.0, and more specifically 4.4 - 7.0.

[0033] In another specific embodiment of the present invention, a microbial inoculant is provided, which contains the Escherichia coli LZ1 or its fermentate or its metabolite.

[0034] In the present invention, the term "fermentate" is used to refer to the fermentation product. The corresponding fermentate can be a liquid obtained from the process of fermenting and culturing Escherichia coli LZ1. Therefore, it can also be called fermentation broth; the liquid may contain bacteria (cell bodies), but it does not necessarily need to contain bacteria. The liquid preferably contains metabolites produced by the Escherichia coli LZ1 of the present invention.

[0035] In addition, in the embodiments of the present invention, for a fermentation broth or a culture solution containing cell bodies, the cell bodies growing in the fermentation broth or the culture solution are separated from the liquid by centrifugation, filtration, sedimentation or other means known in the art. The liquid remaining after removing the cell bodies is the "supernatant", and in the present invention, the extracellular metabolites of Escherichia coli LZ1 are contained in the supernatant. In the embodiments of the present invention, the inoculant may also contain the supernatant.

[0036] In addition, in the embodiments of the present invention, for a fermentation broth or a culture solution containing cell bodies, the cell bodies growing in the fermentation broth or the culture solution are separated from the liquid by centrifugation, filtration, sedimentation or other means known in the art to obtain cell bodies. The cell bodies can be broken to obtain cell body fragments. The breaking method can be ultrasound (such as ice bath ultrasound for cell disruption) or other means known in the art. Or, further, the supernatant is collected by centrifuging the cell body fragments. The supernatant is denoted as cell-free extract, and in the present invention, the intracellular metabolites of Escherichia coli LZ1 are contained in the cell body fragments or the cell-free extract. In the embodiments of the present invention, the inoculant may also contain the cell body fragments or the cell-free extract.

[0037] In addition, in the embodiments of the present invention, for the convenience of storage, transportation, improving the survival rate of strains, etc., the inoculant can also be a solid, and further preferably a freeze-dried powder. That is, it is obtained by further freeze-drying the above-mentioned Escherichia coli LZ1 or its fermentate or its metabolite. The freeze-drying technology (including vacuum freeze-drying technology) can be carried out by conventional methods and will not be elaborated here.

[0038] In another specific embodiment of the present invention, the microbial inoculant may further include excipients acceptable for the inoculant.

[0039] In another specific embodiment of the present invention, the excipients are selected from one or more of a dispersant, a wetting agent, a disintegrant, a binder, an antifreeze, a thickener, a filler and a solvent. The present invention has no special restrictions on the source of the excipients acceptable for the inoculant, and generally commercially available products can be used.

[0040] In yet another specific embodiment of the present invention, there is provided the use of the above-mentioned Escherichia coli LZ1 or the above-mentioned microbial inoculum as a chassis microorganism in the synthesis of compounds based on microorganisms.

[0041] In yet another specific embodiment of the present invention, in the said use, the application environment for the synthesis of compounds can be an acidic environment, a neutral environment or an alkaline environment, with a specific pH of 4.0 - 10.0, further a pH of 4.0 - 7.0, and even further a pH that can be 4.4 - 7.0.

[0042] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The raw material reagents used in the embodiments of the present invention are all commercially available products without special instructions, and the experimental methods and instrument equipment used are all conventional laboratory techniques. The starting strain in the embodiments is the Escherichia coli K-12MG1655 strain, with an ATCC number of 700926. The Addgene numbers of the used pTKRed are 41062 respectively, and the pCP20 plasmid can refer to the literature "Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic resistance determinant" (Gene, 1995, 158(1): 9 - 14.).

[0043] Example 1 Knockout of the mutS gene encoding the DNA mismatch repair protein in wild-type Escherichia coli K-12MG1655

[0044] 1) Gene knockout of Escherichia coli by Red homologous recombination technology. First, the starting strain MG1655 was activated and cultured in LB medium (5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride) at a culture temperature of 37 °C for 12 h. Then, the pTKred plasmid was transferred into the starting strain MG1655 to obtain the MG1655-pTKred strain. Using the MG1655 genome as a template, primers mutS-QF and mutS-QR with 50-bp homologous arms were designed. Using the plasmid pKD4 as a template, a recombinant fragment mutS-del containing 50-bp homologous sequences upstream and downstream of the mutS gene, FRT sites, and Kan resistance gene was obtained by PCR. The sequence order was "-50-bp upstream homologous arm-FRT site-Kan resistance gene-FRT site-50-bp downstream homologous arm-". The DNA fragment mutS-del was transferred into MG1655-pTKRed by electroporation. Using the recombinase expressed by the pTKRed plasmid, homologous recombination occurred under the screening pressure of Kan to obtain transformants. Colony PCR verification was performed using primers mutS-JF and mutS-JR to obtain a strain with Kan replaced at the genomic mutS. Then, the pCP20 plasmid was transferred in, and the Flp enzyme expressed by the pCP20 plasmid was used to cause homologous recombination of the FRT sites on both sides of the Kan resistance gene to remove the Kan resistance. By streaking on Kan and antibiotic-free plates, an endA knockout strain with Kan resistance removed was obtained and named MG1655ΔmutS. The primer sequences involved in the knockout of the mutS gene are as follows:

[0045] mutS-QF: CCATCACACCCCATTTAATATCAGGGAACCGGACATAACCCCGTGTAGGCTGGAGCTGCTTCG

[0046] mutS-QR: GTCAGTTGTCGTTAATATTCCCGATAGCAAAAGACTATCGGGAATTGTTAATGGGAATTAGCCATGGTCC

[0047] mutS-JF: CAAAGAAGAAGGGTTAGCCAACCGATACAATTTTGCG

[0048] mutS-JR: GGTCCACGATCAATATTATCGCCGACAGAAATAAG

[0049] Specific implementation method: Gene knockout steps: Transfer pTKRed into strain MG1655 to obtain strain MG1655-pTKRed; inoculate strain MG1655-pTKRed into a test tube and culture it at 30 °C for 12 h; transfer it to 50 mL of LB medium containing spectinomycin to make the initial inoculation OD 600 reach 0.05; add 20 μL of 1 M IPTG for induction after culturing for 30 min; continue culturing until OD 600 reaches 0.5 - 0.6; at this time, collect the bacteria with a 50 mL centrifuge tube, centrifuge at 4000 rpm for 10 min to collect the bacterial cells, and pour out the culture medium as much as possible; transfer the bacterial cells to a 1.5 mL Eppendorf tube, resuspend the bacterial cells with 1 mL of sterile ultrapure water, centrifuge at 12000 g for 1 min to collect the bacterial cells, and repeat the centrifugation-resuspension step 4 - 5 times. Finally, resuspend the bacterial cells with 50 - 100 μL of sterile ultrapure water. Add 20 - 30 μL of the DNA fragment mutS-del with homologous ends to the electrotransformation competent cells and transfer them to a pre-cooled clean 0.2 cm electrotransformation cup; use an electrotransformer for electrotransformation, and the electrotransformation parameters are 2.5 kV and 5 ms; quickly add 800 μL of LB medium to the electrotransformation cup after electrotransformation and mix it with the competent cells; transfer the 1 mL volume of the bacterial solution to a 1.5 mL Eppendorf tube and recover it at 37 °C for about 2 h; collect 500 μL of the recovered culture solution and spread it on an LB plate containing kanamycin, and culture it at 37 °C for 16 h. If colonies grow, verify them by colony PCR with the verification primers mutS-JF and mutS-JR, and find the positive clones; make the obtained positive clones into competent cells, transfer the pCP20 plasmid into the positive strain, pick a single clone and streak it on an antibiotic-free plate, and place it at 42 °C for 12 h; pick the grown single clones and streak them on LB+Kan, LB, and LB+Amp plates at the same time, and culture them at 37 °C for 12 h; pick the colonies that only grow on the antibiotic-free LB plate and verify them by colony PCR again; if the colony PCR verification is successful, the positive colonies with successful knockout are obtained and named MG1655ΔmutS.

[0050] Example 2 Adaptive evolution of strain MG1655ΔmutS

[0051] 1) Prepare LBG liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 2% glucose, and adjust the pH of the medium to 5.0 with hydrochloric acid solution;

[0052] 2) Take the overnight culture of TB-1LB medium at 37 °C, inoculate strain TB-1 into the LBG medium with pH = 5.0 at a ratio of 1 - 2% and perform evolutionary culture at 37 °C for 48 h;

[0053] 3) Take the bacterial liquid cultured for 48 h and inoculate it again into the LBG medium with pH = 5.0 at 37 °C for 48 h according to the same inoculation ratio;

[0054] 4) Repeat the above steps until the OD 600 value reaches 2.0, then lower the pH of the medium by 0.1, and continue to repeat this process. Finally, an evolved strain LZ1 that can grow under the conditions of pH = 4.0 - 7.0 and can grow normally in the environment of pH = 4.4 - 7.0 is obtained.

[0055] Example 3

[0056] 1) Preparation of LBG fermentation medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 2% glucose, and adjust the pH of the medium to 4.0 - 7.0 with hydrochloric acid solution;

[0057] 2) Inoculate the final evolved strain LZ1 and the starting strain MG1655ΔmutS into the prepared medium respectively, with an inoculation amount of 5%, and carry out fermentation culture for 24 h. The growth conditions of the strains are shown in Figure 1 and Figure 2 . It can be seen from the figure that in the range of pH 4.0 - 6.5, the final evolved strain LZ1 shows better cell growth than the initial strain MG1655ΔmutS. Among them, the growth of the evolved strain LZ1 is relatively similar in the range of pH 4.4 - 7.0. In the environment of pH 4.0 - 4.3, the maximum OD 600 value after 24 h of its culture drops below 2.0, but it is still significantly better than the growth of MG1655ΔmutS.

[0058] Example 4

[0059] 1) Preparation of LBG fermentation medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 2% glucose, and adjust the pH of the medium to 7.0;

[0060] 2) Inoculate the final evolved strain LZ1, the starting strain MG1655ΔmutS, and the wild - type Escherichia coli K - 12 MG1655 into the prepared LBG fermentation medium respectively, with an inoculation amount of 5%, and carry out fermentation culture for 24 h. The growth conditions of the strains are shown in Figure 3 . It can be seen from the figure that under the condition of pH 7.0, the final evolved strain LZ1 shows faster growth and a higher maximum OD 600 value, which fully shows that LZ1 not only has the acid - resistant characteristic of growing under the conditions of pH = 4.0 - 7.0, but also has obtained a faster growth rate under the neutral condition of pH = 7.0.

[0061] Example 5

[0062] 1) Preparation of LBG fermentation medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 2% glucose, and adjust the pH of the medium to 8.0 - 12.0 with sodium hydroxide solution;

[0063] 2) Inoculate the final evolved strain LZ1 and the starting strain MG1655ΔmutS into the prepared medium respectively, with an inoculation amount of 5%, and conduct fermentation culture for 24 h. The growth conditions of the strains are shown in Figure 4 . It can be seen from the figure that within the range of pH 8.0 - 12.0, the final evolved strain LZ1 shows better cell growth than the initial strain MG1655ΔmutS. Among them, the growth of the evolved strain LZ1 is relatively similar at pH 8.0 - 10.0, and its maximum OD after 24 h of culture in the environment of pH 11.0 - 12.0 600 value drops below 1.0, but it is still significantly better than the growth of MG1655ΔmutS. This shows that LZ-1 has the ability to maintain its growth in the weakly alkaline environment of pH 8.0 - 10.0.

[0064] It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to the given examples, those of ordinary skill in the art can modify or equivalently replace the technical solutions of the present invention according to needs, without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. An Escherichia coli LZ1 strain, which has been deposited with the China Center for Type Culture Collection. The deposit date is November 11, 2024, and the deposit number is CCTCC NO: M20242513.

2. The construction method of Escherichia coli LZ1 according to claim 1, characterized in that, The construction method includes: Knocking out the mutS gene encoding DNA mismatch repair protein in the genome of Escherichia coli MG1655, and continuously subculturing the Escherichia coli cells in an acidic medium with gradually decreasing pH based on adaptive evolution breeding technology.

3. The construction method according to claim 2, wherein The Red homologous recombination technology is used to knock out the mutS gene.

4. The culturing method of the Escherichia coli according to claim 1, characterized in that, The cultivation method includes inoculating the Escherichia coli LZ1 into a fermentation medium for fermentation cultivation.

5. The culturing method according to claim 4, wherein The medium is LBG medium.

6. The cultivation method according to claim 5, wherein, The pH of the fermentation medium is acidic, neutral or alkaline.

7. A microbial inoculant, characterized in that, The microbial inoculum contains the Escherichia coli LZ1 described in claim 1, or its fermented product, or its metabolite.

8. The microbial inoculum according to claim 7, wherein, The microbial inoculum further includes excipients acceptable for the inoculum.

9. The application of the Escherichia coli LZ1 described in claim 1 or the microbial inoculum described in any one of claims 7-8 as a chassis microorganism in the synthesis of compounds based on microorganisms.

10. The application according to claim 9, characterized in that, The application environment for compound synthesis is an acidic environment, a neutral environment or an alkaline environment.

Images