SiRNA for inhibiting mRNA expression of amyloid precursor protein APP, conjugate and pharmaceutical composition of siRNA and application of siRNA

Abstract

The invention relates to siRNA (small interfering Ribonucleic Acid) for inhibiting mRNA (messenger Ribonucleic Acid) expression of amyloid precursor protein APP (Amyloid Protein) as well as a conjugate, a pharmaceutical composition and application of the siRNA. The siRNA comprises a positive-sense strand and an antisense strand, and each nucleotide in the siRNA is independently modified or unmodified nucleotide; the positive-sense strand comprises a nucleotide sequence selected from one of nucleotide sequences as shown in SEQ ID NO.1 to 103 or a nucleotide sequence with no more than 3 base mutations of the nucleotide sequences as shown in SEQ ID NO.1 to 103, and the antisense strand comprises a nucleotide sequence selected from one of nucleotide sequences as shown in SEQ ID NO.106 to 208 or a nucleotide sequence with no more than 5 base mutations of the nucleotide sequences as shown in SEQ ID NO.106 to 208. The siRNA, the conjugate thereof and the pharmaceutical composition disclosed by the invention have good stability and relatively high APP mRNA (messenger Ribonucleic Acid) inhibitory activity.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to an siRNA for inhibiting the expression of amyloid precursor protein APP mRNA, its conjugate, a pharmaceutical composition and uses thereof. Background Art

[0002] The amyloid precursor protein APP gene is located on the long arm of chromosome 21 and encodes an APP protein containing 695 - 770 amino acid residues, which is highly expressed in the brain. At present, the true physiological function of APP has not been fully understood. It is mainly found that its cleavage of Aβ42 is related to Alzheimer's disease (AD). APP is a transmembrane protein and has two processing pathways in the central nervous system, the non-amyloidogenic pathway and the amyloidogenic pathway. In the former, APP (membrane-bound protein) is cleaved by α-secretase to produce sAPPα (extracellular matrix), and in the latter, it is cleaved by β-secretase to produce sAPPβ (extracellular matrix) and CTF99 (membrane-bound protein), and CTF99 is cleaved by γ-secretase to produce Aβ (extracellular matrix) and AICD (cytoplasm) (Wilkins HM et al., Brain Res Bull. 2017 July; 133:71–79.). Aβ is a β-peptide of 37 - 43 amino acids, and the common ones are Aβ40 around blood vessels and Aβ42 around neurons. The natural accumulation and aggregation of Aβ40 and Aβ42 have strong amyloidosis, and the abnormal aggregation of these two Aβ proteins is related to cerebral amyloid angiopathy (CAA) and AD.

[0003] CAA is a common age-related cerebral small vessel disease (CSVD), and its pathological change is the continuous deposition of β-amyloid in the middle and outer membranes of small and medium-sized arteries (rarely involving veins) in the cerebral cortex and medulla, often involving cortical and leptomeningeal blood vessels, without systemic amyloid deposition. It is divided into sporadic CAA and familial CAA, and among them, the Dutch type in familial CAA is caused by APP gene defect. So far, there is no specific treatment for CAA.

[0004] Alzheimer's disease (AD) is one of the most common neurodegenerative diseases globally. Clinically, it is characterized by the presence of extracellular amyloid plaques (formed by the aggregation of amyloid-beta 42 protein) and intracellular neurofibrillary tangles (formed by the aggregation of Tau protein), which in turn lead to neuronal dysfunction and cell death. AD can also be divided into sporadic AD and familial AD. The etiology of sporadic AD is complex, and 50% of familial AD is caused by mutations in three genes: amyloid precursor protein (APP), presenilin-1 (PS1) located on chromosome 14, and presenilin-2 (PS2) located on chromosome 1. Among them, familial AD caused by APP mutations accounts for 10% - 15%. Currently, the treatment of AD is symptomatic treatment rather than prevention or cure, and the efficacy of such treatment is limited.

[0005] The traditional treatment methods for Alzheimer's disease (AD) mainly rely on small molecule drugs, which mainly act on neurotransmitters and brain metabolism activating drugs - NMDA receptor antagonists. They need to be taken orally daily, and the patient compliance is poor; The drug lecanemab targeting Aβ antibodies was approved for marketing in January 2023 and is only used for people with mild cognitive impairment. It needs to be intravenously injected once every two weeks, and the dosing frequency is much higher than that of conventional siRNA drugs.

[0006] Currently, only Alnylam's ALN-APP among the siRNA drugs targeting APP is in clinical trials. The existing clinical data suggest that it is expected to administer an injection once every six months for the treatment of AD and CAA, greatly improving patient compliance and medication safety. However, in the evaluation of small animals, ALN-APP was found to have cardiac delivery efficiency, which may pose a certain safety risk. Summary of the Invention

[0007] The purpose of the present invention is to provide an siRNA, its conjugate, and a pharmaceutical composition that inhibit the expression of amyloid precursor protein APP mRNA, so as to cause a down-regulation of APP expression, reduce the production of Aβ from the source, and treat diseases related to the APP gene.

[0008] To achieve the above objective, the technical solution adopted by the present invention is:

[0009] In a first aspect of the present invention, an siRNA is provided, which includes a sense strand and an antisense strand, and each nucleotide in the siRNA is independently a modified or unmodified nucleotide;

[0010] The sense strand includes a nucleotide sequence selected from one of the nucleotide sequences shown in SEQ ID NO.1 to 103 or a nucleotide sequence with no more than 3 base mutations in the above sequences, and the antisense strand includes a nucleotide sequence selected from one of the nucleotide sequences shown in SEQ ID NO.106 to 208 or a nucleotide sequence with no more than 5 base mutations in the above sequences.

[0011] According to certain embodiments, the sense strand comprises a nucleotide sequence having no more than 2 base mutations, no more than 1 base mutation, compared to any one of the nucleotide sequences shown in SEQ ID NOs. 1 to 103.

[0012] According to certain embodiments, in the 5' to 3' direction, the base mutations of the sense strand can be at any position in the nucleotide sequence, such as any one, two, or three of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth positions.

[0013] According to certain embodiments, the antisense strand comprises a nucleotide sequence having no more than 5 base mutations, no more than 4 base mutations, no more than 3 base mutations, no more than 2 base mutations, no more than 1 base mutation, compared to any one of the nucleotide sequences shown in SEQ ID NOs. 106 to 208.

[0014] According to certain embodiments, in the 5' to 3' direction, the base mutations of the antisense strand can be at any position in the nucleotide sequence, such as any one, two, three, four, or five of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, twenty - first positions.

[0015] According to certain embodiments, the base at the 3' end of the nucleotide sequence shown in SEQ ID NOs. 1 to 103 is replaced with U, C, or G. Taking the sequence shown in SEQ ID NO. 1 as an example, it can be GCUUCAGAAAGAGCAAAAA, GCUUCAGAAAGAGCAAAAU, GCUUCAGAAAGAGCAAAAC, or GCUUCAGAAAGAGCAAAAG. The same applies to the remaining sequences, which are not listed one by one here, but the base - replacement sequences at their 3' ends should be considered as having been clearly listed.

[0016] According to certain embodiments, the base A, C, or G at the 5'-end of the nucleotide sequences shown in SEQ ID NOs. 106 to 208; and / or, the bases at positions 2, 3, 4, 5, 6, 7, 8 of the nucleotide sequences shown in SEQ ID NOs. 106 to 208 and the last two bases at the 3'-end are independently A, U, C, or G. Taking the sequence shown in SEQ ID NO. 106 as an example, it can be UUUUUGCUCUUUCUGAAGCAG, AUUUUGCUCUUUCUGAAGCAG, CUUUUGCUCUUUCUGAAGCAG, or

[0017] GUUUUGCUCUUUCUGAAGCAG; or, UUUUUGCUCUUUCUGAAGCAG, UUUUUGCUCUUUCUGAAGCAA, UUUUUGCUCUUUCUGAAGCAU, UUUUUGCUCUUUCUGAAGCAC, AUUUUGCUCUUUCUGAAGCAA, AUUUUGCUCUUUCUGAAGCAG, AUUUUGCUCUUUCUGAAGCAU, AUUUUGCUCUUUCUGAAGCAC, CUUUUGCUCUUUCUGAAGCAU, CUUUUGCUCUUUCUGAAGCAA, CUUUUGCUCUUUCUGAAGCAC, CUUUUGCUCUUUCUGAAGCAG, GUUUUGCUCUUUCUGAAGCAC, GUUUUGCUCUUUCUGAAGCAA, GUUUUGCUCUUUCUGAAGCAU, or

[0018] GUUUUGCUCUUUCUGAAGCAG; or, UUUUAGCUCUUUCUGAAGCAG, UUUUCGCUCUUUCUGAAGCAG, UUUUGGCUCUUUCUGAAGCAG, and so on. The same applies to the remaining sequences and any substitutions at positions 2 - 8, which are not listed one by one here, but the base substitution sequences should be considered as having been clearly listed.

[0019] According to certain embodiments, the antisense strand comprises 18 to 23 nucleotides, such as 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides.

[0020] According to certain embodiments, the sense strand comprises 16 to 21 nucleotides, such as 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides.

[0021] According to certain specific embodiments, the siRNA is selected from the sequences shown in Table 1.

[0022] According to certain specific embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, or all nucleotides of the sense strand or the antisense strand are modified nucleotides.

[0023] According to certain specific embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphate groups are phosphate groups with a modifying group.

[0024] According to certain specific embodiments, the modified nucleotides are selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof; and / or, the phosphate group with a modifying group is a phosphorothioate group formed by substituting at least one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom.

[0025] According to certain specific embodiments, the modified nucleotides are 2'-methoxy-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-O-CH2-CH2-O-CH3-modified nucleotides, 2'-O-CH2-CH=CH2-modified nucleotides, 2'-CH2-CH2-CH=CH2-modified nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl-modified nucleotides, phosphorothioate bond-modified nucleotides, VP-modified nucleotides, LNA, ENA, cET BNA, UNA, GNA, and a combination of one or more thereof, wherein R1 is H, OH, or CH3, and Base is a natural nucleobase, a modified nucleobase, a universal base, or an H atom.

[0026] According to certain specific embodiments, the sense strand contains both 2'-methoxy-modified nucleotides, 2'-fluoro-modified nucleotides, and phosphorothioate groups; and / or, the antisense strand contains both 2'-methoxy-modified nucleotides, 2'-fluoro-modified nucleotides, and phosphorothioate groups.

[0027] According to certain specific embodiments, in the 5' to 3' direction, the 2'-methoxy-modified nucleotides in the sense strand are located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or sixteen positions among the first to sixth positions and the tenth to last positions.

[0028] According to certain specific embodiments, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides in the sense strand are located at any one, two, or three positions among the seventh to ninth positions.

[0029] According to certain specific embodiments, in the 5' to 3' direction, at least one, at least two, at least three, or at least four of the linkages between the following nucleotides in the sense strand are phosphorothioate linkages: the first and second nucleotides, the second and third nucleotides, the last and second-to-last nucleotides, and the second-to-last and third-to-last nucleotides.

[0030] According to certain specific embodiments, in the 5' to 3' direction, the 2'-methoxy-modified nucleotides in the antisense strand are located at any one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, or seventeen positions among the first, third to fifth positions, seventh to thirteenth positions, fifteenth, seventeenth to last positions.

[0031] According to certain specific embodiments, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides in the sense strand are located at any one, two, three, or four positions among the second, sixth, fourteenth, and sixteenth positions.

[0032] According to certain specific embodiments, in the 5' to 3' direction, at least one, at least two, at least three, or at least four of the linkages between the following nucleotides in the antisense strand are phosphorothioate linkages: the first and second nucleotides, the second and third nucleotides, the last and second-to-last nucleotides, and the second-to-last and third-to-last nucleotides.

[0033] According to certain specific embodiments, in the 5' to 3' direction, the nucleotides at any one, two, three, four, five, six, or seven positions among the 2nd, 3rd, 4th, 5th, 6th, 7th, and 8th positions of the antisense strand are

[0034] According to certain specific embodiments, the nucleotide at the first position of the antisense strand contains a VP modification.

[0035] According to certain specific embodiments, the siRNA is selected from the sequences shown in Table 2 or Table 4.

[0036] In a second aspect of the present invention, there is provided an siRNA conjugate, which comprises one or more of the above siRNAs, and a conjugating group conjugated to any position of the siRNA.

[0037] According to certain specific embodiments, the conjugating group is connected to the 3'-end, 5'-end, or both the 3'-end and 5'-end of the sense strand of the siRNA, or any position of the sense strand.

[0038] Subsequently, relying on delivery molecules with better tissue specificity in CNS and superior anti-off-target molecules in the present invention, it is expected to obtain safer and more effective siRNA conjugates targeting APP, achieve more targeted tissue silencing, and reduce safety risks.

[0039] In a third aspect of the present invention, there is provided a pharmaceutical composition, which comprises the above siRNA or the above siRNA conjugate, and a pharmaceutically acceptable carrier or excipient.

[0040] According to certain specific embodiments, the pharmaceutical composition is used for inhibiting the expression of amyloid precursor protein APP mRNA.

[0041] The present invention also provides a kit, which contains the siRNA of the present invention, or the siRNA conjugate of the present invention, or the pharmaceutical composition of the present invention.

[0042] The present invention also provides the use of the above siRNA, the above siRNA conjugate, and the above pharmaceutical composition for preparing a medicament for treating and / or preventing diseases or disorders related to the expression of amyloid precursor protein APP gene.

[0043] According to certain specific embodiments, the diseases or disorders related to the expression of APP gene are selected from the group consisting of cerebral amyloid angiopathy (CAA) and Alzheimer's disease (AD).

[0044] In certain embodiments, the above siRNA, or the above siRNA conjugate, or the above pharmaceutical composition is formulated and administered to a subject in a desired dose.

[0045] In certain embodiments, the above siRNA, or the above siRNA conjugate, or the above pharmaceutical composition is administered by subcutaneous injection, intravenous injection, intrathecal injection, intramuscular injection or the like.

[0046] Due to the application of the above technical solutions, the present invention has the following advantages compared with the prior art:

[0047] The siRNA disclosed in the present invention is a human APP siRNA sequence, and its conjugates and pharmaceutical compositions have good stability and high APP mRNA inhibitory activity. Further, the siRNA disclosed in the present invention can further improve the safety of siRNA through anti-off-target modification. Based on the present invention, subsequent reliance on CNS delivery molecules enables targeted tissue silencing. In addition, siRNA has the potential to develop long-acting properties, allowing for longer dosing intervals and better patient compliance. Detailed Embodiments

[0048] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in this application should have the ordinary meanings understood by those skilled in the art.

[0049] The experimental methods in the following examples are all conventional methods unless otherwise specified. The raw materials, reagent materials, etc. used in the following examples are all commercially available products unless otherwise specified. The sense strand and antisense strand sequences in this application are in the order from the 5' end to the 3' end.

[0050] Definitions

[0051] In the foregoing and the following text, the "2'-fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose of the nucleotide is replaced by fluorine. Similarly, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides all refer to nucleotides in which the hydroxyl group at the 2' position of the ribose of the nucleotide is replaced by the corresponding substituent group. A VP-modified nucleotide refers to a nucleotide in which the phosphate group of the nucleotide is replaced by a vinyl phosphate group. In some embodiments, the 5'-terminal phosphate group of the antisense strand is replaced by VP.

[0052] "Alkyl" includes straight-chain, branched-chain or cyclic saturated alkyl groups. For example, alkyl includes, but is not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl and similar groups. Exemplarily, "C1-6 alkyl" in which "C1-6" refers to a group arranged in a straight-chain, branched-chain or cyclic form containing 1, 2, 3, 4, 5 or 6 carbon atoms.

[0053] "Alkoxy" as used herein refers to an alkyl group connected to the rest of the molecule through an oxygen atom (-O-alkyl), where the alkyl is as defined herein. Non-limiting examples of alkoxy include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentyloxy, etc.

[0054] "Nucleotide analog" refers to a group that can replace nucleotides in nucleic acids but has a structure different from adenosine ribonucleotide, guanosine ribonucleotide, cytidine ribonucleotide, uridine ribonucleotide, or thymidine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNA), or acyclic nucleotides.

[0055] BNA refers to constrained or inaccessible nucleotides. BNA can contain a bridged structure with a "fixed" C3'-endo sugar puckering in a five-membered ring, six-membered ring, or seven-membered ring. Usually, this bridge is incorporated at the 2'- and 4'-positions of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., where LNA is shown in Formula (1), ENA is shown in Formula (2), and cET BNA is shown in Formula (3):

[0056]

[0057] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of nucleotides, such as unlocked nucleic acids (UNA) or glycerol nucleic acids (GNA or SAFE-01), where UNA is shown in Formula (4), GNA is shown in Formula (5), and SAFE-01 is shown in Formula (6):

[0058]

[0059] In the above Formulas (4), (5), and (6), R is selected from H, OH, or alkoxy (O-alkyl).

[0060] Isonucleotides are compounds formed by changing the position of the base on the ribose ring in nucleotides. For example, compounds formed by moving the base from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in Formulas (7) or (8):

[0061]

[0062] In the compounds of the above Formulas (7)-(8), Base represents a nucleic acid base, such as A, U, G, C, or T; R is selected from H, OH, F, or the non-fluorine groups described above.

[0063] In some embodiments, the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET BNA, UNA, GNA, and SAFE-01. In some embodiments, the siRNA of the present invention contains deoxynucleotides, which can be dA, dT, dC, or dG.

[0064] As used above and below, the term "thiophosphate group" refers to a thiophosphate group formed by replacing one oxygen atom in the phosphodiester bond of a phosphate group with a sulfur atom. The "5'-phosphonucleotide" refers to the structure of the following formula:

[0065]

[0066] As used above and below, the expressions "complementary" and "antisense complementary" can be used interchangeably and have the meanings well-known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases of the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered to be complementary to each other, and the sequence of one strand can be deduced from the sequence of its complementary strand. Correspondingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at corresponding positions do not pair in a complementary form.

[0067] As used above and below, a nucleotide sequence has a "nucleotide difference" from another nucleotide sequence, which means that compared with the latter, the base type of the nucleotide at the same position has changed. For example, when a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, it is determined that there is a nucleotide difference between the two nucleotide sequences at that position. In some embodiments, when a nucleotide at the original position is replaced with a base-free nucleotide or its equivalent, a nucleotide difference can also be considered to have occurred at that position. A base-free nucleotide refers to a monomeric compound formed by replacing the nucleic acid base in a nucleotide with other groups or a hydrogen atom, and the other groups include, but are not limited to, substituted or unsubstituted aromatic groups or heteroaromatic groups.

[0068] As used above and below, an "overhang" refers to one or more unpaired nucleotides protruding from the duplex structure of the siRNA when the 3'-end of one strand of the siRNA extends beyond the 5'-end of the other strand, or vice versa. A "blunt end" or "blunt terminus" means that there are no unpaired nucleotides at that end of the siRNA, that is, there is no nucleotide overhang. A "blunt-ended" siRNA is an siRNA that is double-stranded throughout its length, that is, there are no nucleotide overhangs at either end of the molecule.

[0069] As used above and below, particularly when describing the methods for preparing the siRNAs, pharmaceutical compositions or siRNA conjugates of the present disclosure, unless otherwise specified, the nucleoside monomers refer to the modified or unmodified nucleoside phosphoramidite monomers used in solid-phase phosphoramidite synthesis according to the types and sequences of nucleotides in the siRNAs or siRNA conjugates to be prepared. Solid-phase phosphoramidite synthesis is a method used in RNA synthesis well-known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.

[0070] In the context of the present disclosure, unless otherwise specified, "conjugation" means the connection of two or more chemical moieties each having a specific function to each other in a covalent linkage; correspondingly, "conjugate" means a compound formed by the covalent connection between these individual chemical moieties. Further, "siRNA conjugate" refers to a compound formed by covalently connecting one or more chemical moieties having specific functions to an siRNA. The siRNA conjugate should be understood, according to the context, as the general term for multiple siRNA conjugates or the siRNA conjugate represented by a certain chemical formula. In the context of the present disclosure, "conjugating molecule" should be understood as a specific compound that can be conjugated to an siRNA through a reaction to ultimately form the siRNA conjugate of the present disclosure.

[0071] A variety of hydroxyl protecting groups can be used in the present disclosure. Generally, a protecting group renders a chemical functional group insensitive to specific reaction conditions and can be added to and removed from the functional group in the molecule without substantially damaging the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd ed, John Wiley & Sons, New York, 1991, which are incorporated herein by reference in their entireties respectively. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthine-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4''-trimethoxytrityl).

[0072] As used in this specification, "optional" or "optionally" means that the event or circumstance described thereafter may or may not occur, and the description includes both the case where the event or circumstance occurs and the case where it does not.

[0073] As used herein, the term "subject" refers to any animal, such as a mammal or a marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, rabbits, sheep, rats, and any kind of poultry.

[0074] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradicating or ameliorating the underlying disorder being treated. Additionally, a therapeutic benefit is obtained by observing an improvement in a subject through eradicating or ameliorating one or more of the physiological symptoms associated with the underlying disorder, even though the subject may still be afflicted with the underlying disorder.

[0075] As used herein, "prevention" refers to a method of obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit", an siRNA, an siRNA conjugate, or a pharmaceutical composition may be administered to a subject at risk of developing a particular disease or to a subject reporting one or more physiological symptoms of the disease, even if the diagnosis of the disease may not have been made.

[0076] The pharmaceutically acceptable carriers described in the present disclosure can be carriers conventionally used in the field of siRNA administration, such as, but not limited to, magnetic nanoparticles (such as nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and one or more of their derivatives. The excipients can be one or more of various preparations or compounds conventionally used in the art. For example, the other pharmaceutically acceptable excipients can include at least one of pH buffers, protectants, and osmotic pressure regulators.

[0077] The technical solutions provided by the present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and will not limit the protection scope of the present invention. In the text, if the actual source of the reagent is not given, such reagents can be obtained from any supplier of molecular biology reagents; and meet the quality / purity standards for use in molecular biology applications.

[0078] Example 1 Design and Synthesis of siRNA

[0079] 1) siRNA Design

[0080] With reference to human APP (NM_000484.4) mRNA as the target gene, 19 / 21 nt siRNAs were designed to meet the general rules of active siRNAs. The detailed list of unmodified sense and antisense strand sequences is shown in Table 1 below, and the detailed list of modified sense and antisense strand sequences is shown in Table 2 below.

[0081] 2) siRNA Synthesis

[0082] The siRNA sequence was synthesized at a 200 nanomole (nmol) scale on a Dr. Oligo48 synthesizer (Biolytic) using solid support-mediated phosphoramidite chemistry. The solid support is a universal solid support (Biolytic Technology Shenzhen Co., Ltd.). Nucleoside monomer raw materials such as 2'-F RNA and 2'-O-methyl RNA nucleoside phosphoramidite monomers were purchased from Shanghai Zhaowei or Suzhou GenePharma. The coupling time for all phosphoramidites (50 mM acetonitrile solution) was 6 minutes (min), 5-ethylthio-1H-tetrazole (ETT) was used as the activator (0.6 M acetonitrile solution), 0.22 M PADS dissolved in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Keloma) solution was used as the sulfurization reagent, the sulfurization reaction time was 3 minutes (min), and iodine pyridine / aqueous solution (Keloma) was used as the oxidant, with an oxidation reaction time of 2 minutes (min).

[0083] After the solid-phase synthesis was completed, the oligoribonucleotide was cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia water and ethanol at 50 °C for 16 hours. Then, it was centrifuged at high speed, the supernatant was transferred to another centrifuge tube, concentrated and evaporated to dryness, purified by C18 reverse-phase chromatography with a mobile phase of 0.1 M TEAA and acetonitrile, and DMTr was removed using a 3% trifluoroacetic acid solution. The target oligonucleotide was collected, freeze-dried, identified as the target product by LC-MS, and then quantified by UV (260 nm).

[0084] The obtained single-stranded oligonucleotides were annealed according to two complementary sequences in an equimolar ratio. Finally, the resulting double-stranded siRNA was dissolved in 1X PBS and adjusted to the concentration required for the experiment. These monomers are connected to each other by 5'-3'-phosphodiester bonds to form oligonucleotides.

[0085] Example 2 Synthesis of Ago Monomer, Cgo Monomer, and Ugo Monomer

[0086] 3.1. The synthesis route of the Ago monomer is as follows:

[0087]

[0088] (1) Dissolve anhydrous diisopropylamine (16.2 g, 160.0 mmol, 22.6 mL, 2.0 equiv) in 350 mL of anhydrous tetrahydrofuran. Cool the solution to a temperature between -70 °C and -78 °C. Protect the reaction system with nitrogen gas and slowly add n-butyllithium solution (2.5 M, 67.1 mL) (the addition process should take at least 10 minutes). Stir the reaction mixture at a temperature between -70 °C and -78 °C for an additional half hour. Dissolve compound 1 (9.44 g, 79.9 mmol, 9.17 mL, 1.0 equiv) in 175 mL of anhydrous tetrahydrofuran. Cool the solution to a temperature between -70 °C and -78 °C. Protect the reaction system with nitrogen gas and slowly add the solution obtained in the previous step (the addition process should take at least 10 minutes). Stir the reaction mixture at a temperature between -70 °C and -78 °C for an additional half hour. Maintain the previous temperature and slowly add hexamethylphosphoramide (26.1 g, 146 mmol, 25.6 mL, 1.82 equiv) and benzyl chloromethyl ether (17.5 g, 112 mmol, 15.5 mL, 1.4 equiv) to the reaction mixture obtained previously (the addition process should take at least 10 minutes). After the addition is complete, warm the reaction mixture to 0 °C and stir for 3 hours. Monitor the disappearance of compound 1 by TLC and LC-MS. Quench the reaction by adding 600 mL of saturated ammonium chloride solution in two portions. Extract the mixture with 200 mL of methyl tert-butyl ether. Collect the organic phase, wash the organic phase with saturated brine, dry the organic phase over anhydrous sodium sulfate, filter, and concentrate the filtrate. Purify the resulting crude product by silica gel column chromatography (petroleum ether / ethyl acetate = 100 / 1 to 1 / 1) to obtain light brown compound 2 (9.69 g, 40.7 mmol, 51% yield). 1 H NMR (400 MHz, CDCl3): δ 7.46 - 7.28 (m, 10H), 4.58 - 4.46 (m, 2H), 4.19 - 4.08 (m, 1H), 3.82 - 3.67 (m, 5H), 2.77 (q, J = 6.1 Hz, 1H), 1.24 (d, J = 6.5 Hz, 4H). LC-MS: C 13 H 18 O4, molecular weight 238.1, 239.1 (M + H).

[0089] (2) Dissolve compound 2 (14.7 g, 61.7 mmol, 1.0 equiv) in 150 mL of dichloromethane. Under nitrogen protection, add imidazole (16.8 g, 247.0 mmol, 4.0 equiv) and tert-butyldimethylchlorosilane (27.9 g, 185.0 mmol, 22.7 mL, 3.0 equiv) at room temperature. Stir the reaction mixture at room temperature for one hour. TLC and LCMS detection show the disappearance of compound 2. Add 100 mL of dichloromethane to the reaction mixture, wash the reaction mixture twice with 400 mL of saturated brine, dry the organic phase, filter and concentrate the organic phase. The obtained crude product is separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 100 / 1 to 10 / 1) to obtain a pale yellow oily compound 3 (12.0 g, 34.0 mmol, 55% yield). 1 H NMR (400 MHz, CDCl3): δ 7.40 - 7.25 (m, 5H), 4.52 (d, J = 2.4 Hz, 2H), 4.10 (t, J = 6.3 Hz, 1H), 3.75 - 3.65 (m, 4H), 3.59 (dd, J = 9.2, 5.3 Hz, 1H), 2.79 (dt, J = 8.4, 5.9 Hz, 1H), 1.17 (d, J = 6.2 Hz, 3H), 0.86 (s, 9H), 0.04 (d, J = 8.6 Hz, 6H). LC-MS: C 19 H 32 O4Si, molecular weight 352.1, 353.2 (M + H).

[0090] (3) Dissolve compound 3 (11.1 g, 31.5 mmol, 1.0 equiv) in tetrahydrofuran, cool it to between -70 °C and -60 °C, and dropwise add diisobutylaluminum hydride (1.0 M, 69.3 mL, 2.2 equiv) under nitrogen protection. Stir at this temperature for another two hours. LCMS detection shows the disappearance of compound 3. Warm up to 0 °C, add 20 mL of ethyl acetate, and then quench the reaction with 100 mL of sodium potassium tartrate solution, and continue to stir for half an hour. This mixture is washed with 100 mL of saturated brine, dried over anhydrous sodium sulfate, filtered and concentrated to obtain a pale yellow oily compound 4 (9.75 g, 30.0 mmol, 95% yield). 1 H NMR (400 MHz, CDCl3): δ 7.40 - 7.27 (m, 5H), 4.59 - 4.45 (m, 2H), 4.19 (dd, J = 6.2, 3.7 Hz, 1H), 4.01 (dd, J = 11.3, 4.0 Hz, 1H), 3.78 - 3.60 (m, 3H), 1.78 - 1.68 (m, 1H), 1.29 - 1.21 (m, 3H), 0.95 - 0.87 (m, 9H), 0.12 - 0.02 (m, 6H). LC-MS: C18 H 32 O3Si, with a molecular weight of 324.1, 325.2 (M+H).

[0091] (4) Dissolve compound 4 (9.75 g, 30.0 mmol, 1.0 equiv) in tetrahydrofuran, cool the temperature to 0 °C, and dropwise add p-toluenesulfonyl chloride (11.5 g, 60.1 mmol, 2.0 equiv) and methylimidazole (6.17 g, 75.1 mmol, 5.99 mL, 2.5 equiv) under nitrogen protection. After the addition is complete, warm the temperature to room temperature and continue stirring for 16 hours. LCMS detection shows the disappearance of compound 4. Add 20 mL of ethyl acetate to the reaction solution, quench the reaction with 100 mL of potassium sodium tartrate solution under an ice bath, and continue stirring for half an hour. Wash this mixture with 100 mL of saturated brine, dry it over anhydrous sodium sulfate, filter and concentrate to obtain a crude product of a pale yellow oily compound 5 (13.7 g, 28.6 mmol, 95% yield). 1 H NMR (400 MHz, CDCl3): δ 7.89 - 7.68 (m, 2H), 7.42 - 7.17 (m, 10H), 4.47 - 4.33 (m, 2H), 4.23 (dd, J = 9.6, 5.1 Hz, 1H), 4.13 - 4.06 (m, 1H), 4.01 - 3.94 (m, 1H), 3.52 - 3.34 (m, 2H), 2.43 (s, 3H), 2.02 - 1.89 (m, 1H), 1.10 (d, J = 6.3 Hz, 3H), 0.81 (s, 8H), 0.04 - 0.05 (m, 6H). LC-MS: C 25 H 38 O5SSi, with a molecular weight of 478.1, 479.2 (M+H).

[0092] (5) Under nitrogen protection, compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) and 35 mL of acetonitrile were added to a dry reaction flask. Acetonitrile was distilled off at 35 - 40 °C to remove the moisture in compound 5. Under nitrogen protection, 80 mL of N,N-dimethylformamide, compound 5-1 (9H-purin-6-amine) (4.25 g, 31.5 mmol, 1.1 equiv) and potassium carbonate (3.96 g, 28.6 mmol, 1.0 equiv) were added to another clean and dry reaction flask. The temperature was raised to 95 - 100 °C and stirring was continued for half an hour. At this temperature, a solution of compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) in N,N-dimethylformamide (60 mL) was added dropwise to the reaction solution, and stirring was continued for 12 hours. LCMS detection showed the disappearance of compound 5. The reaction solution was cooled to room temperature, 200 mL of ethyl acetate was added, and this mixed solution was washed successively with 200 mL of sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The crude product obtained was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1 to 10 / 1) to obtain a pale yellow oily compound 6 (6.2 g, 14.0 mmol, 49% yield). 1 H NMR(400MHz,CDCl3):δ8.37(s,1H),7.75(s,1H),7.39-7.24(m,6H),5.66(br,s,2H),4.47-4.34(m,3H),4.21(dd,J=14.1,8.8Hz,1H),4.07(dd,J=6.2,4.9Hz,1H),3.42-3.34(m,2H),2.10-1.96(m,1H),1.19(d,J=6.4Hz,3H),0.90(s,9H),0.06(d,J=6.0Hz,6H).LC-MS:C 23 H 35 N5O2Si, molecular weight 441.1, 442.3 (M + H).

[0093] (6) At room temperature, palladium carbon (3.0 g, 10% purity) was dissolved in 25 mL of methanol, and 25 mL of a methanol solution of compound 6 (5.2 g, 11.8 mmol, 1.0 equiv) and trifluoroacetic acid (134.0 mg, 1.18 mmol, 87.2 μL) were added. This reaction solution was stirred under a hydrogen pressure of 50 psi for 48 hours. LCMS detection showed the disappearance of compound 6. The reaction solution was filtered and concentrated to obtain a crude product, a pale yellow oily compound 7 (3.9 g, 11.1 mmol). 11H NMR (400 MHz, CDCl3): δ 8.21 (s, 1H), 8.12 (s, 1H), 4.50 - 4.36 (m, 1H), 4.33 - 4.22 (m, 1H), 4.15 - 4.02 (m, 1H), 3.53 (d, J = 5.9 Hz, 2H), 2.21 - 2.09 (m, 1H), 1.25 (d, J = 6.4 Hz, 3H), 0.88 (s, 9H), 0.05 (d, J = 3.1 Hz, 6H). LC-MS: C 16 H 29 N5O2Si, molecular weight 351.1, 352.2 (M + 1).

[0094] (7) Place compound 7 (3.9 g, 11.1 mmol, 1.0 equiv) in a clean and dry reaction flask. Under nitrogen protection, add 10 mL of pyridine, heat up to distill off pyridine, and repeat this operation once to remove the moisture in compound 7. Add 28 mL of pyridine, add trimethylchlorosilane (4.8 g, 44.4 mmol, 5.63 mL, 4.0 equiv) under ice bath, heat up to room temperature, and continue stirring for two hours. TLC detection shows that compound 7 has disappeared. Add benzoyl chloride (6.2 g, 44.4 mmol, 5.15 mL, 4.0 equiv) under ice bath, continue stirring for 2 hours. TLC detection shows that the raw materials have reacted and disappeared. Dropwise add 60 mL of water and 90 mL of concentrated ammonia water and continue stirring for half an hour. Extract the reaction solution with 250 mL of ethyl acetate. Wash the organic phase with saturated brine, dry it, filter it, and concentrate it. The obtained crude product is separated and purified by silica gel column chromatography (elution system: dichloromethane / methanol = 50 / 1 to 10 / 1) to obtain a pale yellow oily compound 8 (4.0 g, 8.78 mmol, 79% yield). 1 1H NMR (400 MHz, CDCl3): δ 9.22 - 8.90 (m, 1H), 8.79 (s, 1H), 8.07 - 8.04 (m, 2H), 8.03 (d, J = 1.4 Hz, 1H), 7.65 - 7.59 (m, 1H), 7.57 - 7.50 (m, 2H), 4.62 - 4.50 (m, 1H), 4.42 (dd, J = 14.3, 8.6 Hz, 1H), 4.24 - 4.09 (m, 1H), 4.05 (d, J = 6.3 Hz, 1H), 3.59 - 3.48 (m, 1H), 3.47 - 3.35 (m, 1H), 2.04 - 1.98 (m, 1H), 1.31 (d, J = 6.3 Hz, 3H), 0.98 - 0.84 (m, 9H), 0.11 (d, J = 10.1 Hz, 5H). LC-MS: C 23 H 33 N5O3Si, molecular weight 455.2, 456.3 (M + H).

[0095] (8) Compound 8 (4.0 g, 8.78 mmol, 1.0 equiv) was placed in a clean and dry reaction flask. 10 mL of pyridine was added under nitrogen protection. The pyridine was removed by heating and evaporation, and this operation was repeated once to remove the moisture in Compound 8. 28 mL of pyridine was added, and 4,4'-dimethoxytriphenylmethyl chloride (3.27 g, 9.66 mmol, 1.1 equiv) was added under an ice bath. The mixture was warmed to room temperature and stirred for 1 hour. TLC detection showed the disappearance of Compound 8. 150 mL of ethyl acetate was added to the reaction mixture, and it was washed with 200 mL of sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and the filtrate was concentrated. The obtained crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 10 / 1 to 0 / 1), and a pale yellow oily compound 9 (5.91 g, 7.8 mmol, 88% yield) was obtained. 1 1H NMR (400 MHz, CDCl3): δ 9.07 (br s, 1H), 8.82 (s, 1H), 8.04 (d, J = 7.1 Hz, 2H), 7.80 (s, 1H), 7.65 - 7.58 (m, 1H), 7.57 - 7.50 (m, 2H), 7.28 - 7.13 (m, 9H), 6.81 - 6.69 (m, 4H), 4.52 - 4.43 (m, 1H), 4.25 (dd, J = 14.2, 8.6 Hz, 1H), 4.07 (dd, J = 6.3, 4.2 Hz, 1H), 3.76 (d, J = 4.5 Hz, 6H), 3.22 (dd, J = 9.8, 5.4 Hz, 1H), 3.04 (dd, J = 9.8, 6.1 Hz, 1H), 2.34 (dd, J = 8.1, 4.5 Hz, 1H), 1.19 (d, J = 6.3 Hz, 3H), 0.90 - 0.77 (m, 9H), 0.07 - 0.09 (m, 6H). LC-MS: C 44 H 51 5O5Si, molecular weight 757.3, 758.4 (M + H).

[0096] (9) Compound 9 (3.00 g, 3.96 mmol, 1.0 equiv) was dissolved in tetrahydrofuran. Under nitrogen protection and in an ice bath, pyridinium hydrofluoride (2.26 g, 79.2 mmol, 2.1 mL, 20.0 equiv) and imidazole (10.8 g, 158.0 mmol, 40.0 equiv) were added. The temperature was raised to room temperature and stirring was continued for 2 hours. LCMS detection showed the disappearance of compound 9. 50 mL of ethyl acetate was added, and the mixture was washed with 100 mL of sodium bicarbonate solution and 50 mL of saturated brine, filtered after drying, the filtrate was concentrated, and the resulting crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 10 / 1 to 0 / 1), to obtain a pale yellow oily compound 10 (2.44 g, 3.79 mmol, 96% yield). 1 H NMR (400 MHz, DMSO-d6): δ 11.16 (br s, 1H), 8.70 (s, 1H), 8.33 (s, 1H), 8.05 (d, J = 7.4 Hz, 2H), 7.69 - 7.61 (m, 1H), 7.60 - 7.52 (m, 2H), 7.25 - 7.12 (m, 5H), 7.05 (t, J = 8.9 Hz, 4H), 6.78 (dd, J = 8.9, 3.1 Hz, 4H), 4.79 (d, J = 4.0 Hz, 1H), 4.51 - 4.28 (m, 2H), 3.81 (d, J = 4.0 Hz, 1H), 3.70 (s, 6H), 3.10 (dd, J = 9.8, 4.9 Hz, 1H), 2.89 (dd, J = 9.7, 5.1 Hz, 1H), 2.37 - 2.23 (m, 1H), 1.03 (d, J = 6.3 Hz, 3H). LC-MS: C 38 H 37 N5O5, molecular weight 643.2, 644.2 (M + H).

[0097] (10) Compound 10 (1.5 g, 2.33 mmol, 1.0 equiv) was placed in a clean and dry reaction flask. Under nitrogen protection, 4 mL of acetonitrile was added, and the mixture was heated to 35 - 40 °C to evaporate the acetonitrile. This operation was repeated once to remove the moisture in Compound 10. At room temperature, 15 mL of anhydrous dichloromethane was added to the above reaction flask. Then Compound 11-1 (1.05 g, 3.5 mmol, 1.11 mL, 1.5 equiv) and 4,5-dicyanoimidazole (358 mg, 3.03 mmol, 1.3 equiv) were added, and the mixture was stirred at room temperature for another hour. TLC detection showed the disappearance of Compound 10. 30 mL of dichloromethane was added, and the mixture was washed with sodium bicarbonate solution (50 mL × 2) and saturated brine (50 mL). The organic phase was dried, filtered, and the filtrate was concentrated. The obtained crude product was dissolved in 50 mL of methyl tert-butyl ether, and 100 mL of 1% aqueous sodium hydroxide solution was added, and the mixture was stirred for half an hour. The mixture was allowed to stand for phase separation, and the organic phase was collected, washed with saturated brine, dried, filtered, and concentrated. The crude product was prepared by C18 reverse-phase column to obtain a pale yellow product SA000001 (1.1 g, 1.3 mmol, 56% yield). 1 1H NMR (400 MHz, CD3CN): δ 9.33 (br s, 1H), 8.61 (br s, 1H), 7.99 (d, J = 11.0 Hz, 3H), 7.67 - 7.60 (m, 1H), 7.59 - 7.49 (m, 2H), 7.32 - 6.99 (m, 9H), 6.75 (td, J = 9.2, 6.5 Hz, 4H), 4.50 - 4.38 (m, 1H), 4.36 - 4.13 (m, 2H), 3.72 (dd, J = 4.8, 1.5 Hz, 6H), 3.66 - 3.45 (m, 3H), 3.25 (td, J = 9.6, 5.4 Hz, 1H), 3.01 (ddd, J = 17.9, 10.0, 5.8 Hz, 1H), 2.62 (t, J = 5.9 Hz, 1H), 2.53 (t, J = 5.9 Hz, 1H), 1.32 - 1.22 (m, 4H), 1.17 - 1.05 (m, 12H). 31 31P NMR (DMSO-d6, 162 MHz): δ ppm 147.7, 146.8. LCMS: C 47 H 54 N7O6P, molecular weight 843.3, 844.5 (M + H).

[0098] 3.2. The synthetic route of Cgo monomer is as follows:

[0099]

[0100] (1) At room temperature, compound 3-2 (8.5 g, 20.3 mmol, prepared in Example 5) and 1,2,4-triazole (19.5 g, 282.0 mmol, 13.9 equiv) were dissolved in pyridine (128.0 mL). Subsequently, under an ice-water bath condition, 4-chlorophenyl dichlorophosphate (56.9 mmol, 9.25 mL, 2.8 equiv) was added dropwise to the reaction system. The reaction solution was stirred at 30 °C for 16 hours. After the reaction was completed, the solvent pyridine was removed by distillation under reduced pressure. The remaining system was extracted with water and ethyl acetate three times, and the organic phases were combined and dried by rotary evaporation to obtain a yellow oily crude product, compound C-1 (9.5 g), which was directly used for the next reaction. Mass spectrometry identification of compound C-1 (C 24 H 35 N5O3Si, molecular weight 469.1, [M + H] = 470.3).

[0101] (2) At room temperature, compound C-1 (9.5 g, 20.2 mmol) was dissolved in 1,4-dioxane (95.0 mL). Subsequently, ammonia water (1.38 mol, 212.1 mL, 25% purity, 68.0 equiv) was added to the reaction system. The reaction solution was stirred at 30 °C for 16 hours. After the reaction was completed, the solvent was removed by distillation under reduced pressure. The remaining system was extracted with water and dichloromethane three times, and the organic phases were combined and dried by rotary evaporation to obtain a yellow solid crude product, compound C-2 (8.5 g), which was directly used for the next reaction. Mass spectrometry identification of compound C-2 (C 22 H 35 N3O3Si, molecular weight 417.1, [M + H] = 418.2).

[0102] (3) At room temperature, compound C-2 (8.5 g, 20.2 mmol) was dissolved in N,N-dimethylformamide (85.0 mL). Subsequently, acetic anhydride (3.1 g, 30.4 mmol, 2.85 mL, 1.5 equiv) was slowly added to the reaction system. The reaction solution was stirred at 30 °C for 3 hours. After the reaction was completed, the solvent was removed by distillation under reduced pressure. The remaining system was extracted with saturated sodium bicarbonate solution and ethyl acetate three times, and the organic phases were combined and dried by rotary evaporation. The obtained crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol 1:0 to 100:1) to obtain a yellow solid compound C-3 (4.2 g, reaction yield 43%). Compound C-3's 11H NMR data: (400 MHz, DMSO-d6) δ 10.7 (s, 1H), 7.79 (d, J = 7.2 Hz, 1H), 7.29 (m, 5H), 7.08 (d, J = 7.2 Hz, 1H), 4.36 (d, J = 1.2 Hz, 2H), 4.05 - 3.99 (m, 2H), 3.72 - 3.67 (m, 1H), 3.39 (dd, J = 6.4 Hz, 2H), 2.15 - 2.08 (m, 1H), 2.08 (s, 3H), 1.15 (d, J = 6.4 Hz, 3H), 0.85 (s, 9H), 0.02 (d, J = 6.8 Hz, 6H). Mass spectrometry identification of compound C-3 (C 24 H 37 N3O4Si, molecular weight 459.1, [M + H] = 460.2).

[0103] (4) At -78 °C, compound C-3 (4.3 g, 9.35 mmol) was dissolved in dichloromethane (46.0 mL), and then boron trichloride (1.0 M in DCM, 46.8 mL, 5.0 equiv) was slowly added to the reaction system. Subsequently, the reaction solution was stirred at -78 °C for 4 hours. After the reaction was completed, the reaction was quenched with triethylamine (40.0 mL) and methanol (88.0 mL). The remaining system was extracted with water and dichloromethane three times. The organic phases were combined and concentrated in vacuo. The crude product obtained was purified by C18 reverse-phase column chromatography to give white solid compound C-4 (0.96 g, reaction yield 40%). The 1 1H NMR data: (400 MHz, DMSO-d6) δ 10.7 (s, 1H), 8.01 (d, J = 7.2 Hz, 1H), 7.12 (d, J = 7.2 Hz, 1H), 4.60 (d, J = 4.8 Hz, 2H), 4.53 - 4.50 (m, 1H), 4.00 - 3.99 (m, 1H), 3.75 - 3.70 (m, 2H), 3.37 - 3.32 (m, 2H), 2.08 (s, 3H), 1.81 - 1.77 (m, 1H), 1.01 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound C-4 (C 11 H 17 N3O4, molecular weight 255.1, [M + H] = 256.2).

[0104] (5) At room temperature, compound C-4 (1.5 g, 5.88 mmol) was dissolved in pyridine (10.0 mL). Under an ice-water bath, 4,4'-dimethoxytriphenylmethyl chloride (2.4 g, 7.05 mmol, 1.2 equiv) was added to the reaction system. Subsequently, the reaction solution was stirred at room temperature for 4 hours. After the reaction was completed, the solvent pyridine was removed by distillation under reduced pressure. The remaining system was extracted with saturated sodium bicarbonate solution and ethyl acetate three times. The organic phases were combined and evaporated to dryness. The crude product obtained was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 4:1 to 0:1) to obtain white solid compound C-5 (0.7 g, reaction yield 70%). 1 1H NMR data of compound C-5: (400 MHz, CDCl3) δ 9.71 (s, 1H), 7.39 (d, J = 7.3 Hz, 3H), 7.35 - 7.21 (m, 7H), 7.06 (d, J = 7.1 Hz, 1H), 6.85 (d, J = 8.8 Hz, 4H), 4.71 (d, J = 3.3 Hz, 1H), 4.43 (dd, J = 13.8, 4.5 Hz, 1H), 4.23 - 3.99 (m, 2H), 3.80 (s, 6H), 3.50 - 3.38 (m, 1H), 3.31 (dd, J = 10.0, 4.1 Hz, 1H), 2.69 (t, J = 9.4 Hz, 1H), 2.21 (s, 3H), 1.08 (d, J = 6.1 Hz, 3H). 32 1H 35 N3O6, molecular weight 557.1, [M + H] = 558.4).

[0105] (6) Under nitrogen at room temperature, compound C-5 (2.0 g, 3.59 mmol) was dissolved in dichloromethane (20.0 mL). 4,5-Dicyanoimidazole (466.0 mg, 3.95 mmol, 1.1 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.4 g, 4.66 mmol, 1.48 mL, 1.3 equiv) were added to the reaction system respectively. Subsequently, the reaction solution was stirred at room temperature for 2 hours. After the reaction was completed, the reaction solution was dissolved in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL), and stirred at room temperature for another 0.5 hour. The remaining system was extracted with saturated sodium bicarbonate solution and dichloromethane three times. The organic phases were combined and evaporated to dryness. The crude product obtained was prepared by C18 reverse-phase column to obtain white solid compound SA000015 (1.5 g, reaction yield 55%). 11H NMR data: (400 MHz, CD3CN) δ 9.15 (s, 1H), 7.50 - 7.18 (m, 11H), 6.84 - 6.80 (m, 4H), 4.22 - 4.08 (m, 2H), 3.75 - 3.22 (m, 11H), 3.23 - 3.22 (m, 2H), 2.62 - 2.51 (m, 2H), 2.38 - 2.35 (m, 1H), 2.12 (s, 3H), 1.022 - 1.07 (m, 15H). 31 31P NMR data: (400 MHz, CD3CN) δ 147.5, 146.7. Mass spectrometry identification of compound SA000015 (C 41 H 52 N5O7P, molecular weight 757.1, [M + H] = 758.5).

[0106] 3.3. The synthetic route of Ugo monomer is as follows:

[0107]

[0108] (1) Under an ice - water bath condition, dissolve compound 1 - 4 (9.99 g, 30.8 mmol), compound U - 1 (commercially available, purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd.) (9.33 g, 43.1 mmol, 1.4 equiv) and triphenylphosphine (16.6 g, 63.2 mmol, 2.0 equiv) in dry tetrahydrofuran (350.0 mL) respectively. Subsequently, drop diisopropyl azodicarboxylate (13.1 g, 64.7 mmol, 12.6 mL, 2.1 equiv) into the reaction system. Then stir the reaction solution at room temperature for 2 hours. After the reaction is completed, extract the reaction solution 3 times with saturated sodium bicarbonate solution and ethyl acetate. Combine the organic phases and rotary evaporate to dryness. The obtained crude product is separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1 to 8:1) to obtain white solid compound 3 - 1 (16.1 g, reaction yield 99%). The 1 1H NMR data: (400 MHz, DMSO - d6) δ 7.89 - 7.74 (m, 4H), 7.56 - 7.53 (m, 2H), 7.33 - 7.29 (m, 5H), 5.80 - 5.73 (m, 1H), 4.46 - 4.38 (m, 2H), 4.00 - 3.91 (m, 2H), 3.60 - 3.50 (m, 1H), 3.49 - 3.43 (m, 2H) 2.17 - 1.98 (m, 1H), 1.13 (s, 3H), 0.83 (s, 9H), 0.01 (d, J = 6.0 Hz, 6H). Mass spectrometry identification of compound 3 - 1 (C 29 H 38N2O5Si, molecular weight 522.1, [M+H] = 523.2).

[0109] (2) At room temperature, compound 3-1 (8.05 g, 15.4 mmol) was dissolved in methanol (160.0 mL), and then sodium methoxide (2.77 g, 15.4 mmol, 30% purity, 1.0 equiv) was slowly added to the reaction system. Subsequently, the reaction solution was stirred at room temperature for 12 hours. After the reaction was completed, the solvent methanol was removed by distillation under reduced pressure. The remaining system was extracted with 1 M hydrochloric acid solution and ethyl acetate three times. The organic phases were combined and evaporated to dryness. The obtained crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1 to 0:1) to obtain white solid compound 3-2 (6.1 g, reaction yield 94%). The 1 1H NMR data of compound 3-2: (400 MHz, DMSO-d6) δ 11.1 (s, 1H), 7.48 (d, J = 8.0 Hz, 1H), 7.30 - 7.24 (m, 5H), 5.47 - 5.44 (m, 1H), 4.45 - 4.35 (m, 2H), 3.98 - 3.94 (m, 1H), 3.79 - 3.78 (m, 1H), 3.63 - 3.57 (m, 1H), 3.38 - 3.35 (m, 2H), 2.04 - 1.95 (m, 1H), 1.10 (s, 3H), 0.83 (s, 9H), 0.01 (d, J = 6.0 Hz, 6H). The mass spectrometry identification of compound 3-2 (C 22 H 34 N2O4Si, molecular weight 418.1, [M+H] = 418.2).

[0110] (3) At -70 °C, compound 3-2 (4.0 g, 9.56 mmol) was dissolved in dichloromethane (30.0 mL), and then boron trichloride (1.0 M in DCM, 66.9 mL, 7.0 equiv) was slowly added to the reaction system. Subsequently, the reaction solution was stirred at -70 °C for 3 hours. After the reaction was completed, the reaction was quenched with triethylamine (5.0 mL) and methanol (30.0 mL). The remaining system was extracted with water and dichloromethane three times. The organic phases were combined and evaporated to dryness. The obtained crude product was prepared by C18 reverse-phase column to obtain white solid compound 3-3 (0.7 g, reaction yield 33%). The 11H NMR data: (400 MHz, DMSO-d6) δ 7.54 (d, J = 8.0 Hz, 1H), 5.51 (d, J = 7.6 Hz, 1H), 3.88 - 3.84 (m, 1H), 3.72 - 3.70 (m, 1H), 3.61 - 3.59 (m, 2H), 1.75 - 1.68 (m, 1H), 1.09 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound 3-3 (C9H 14 N2O4, molecular weight 214.1, [M+H] = 215.2).

[0111] (4) Dissolve compound 3-1 (0.4 g, 1.87 mmol) in pyridine (4.0 mL) at room temperature. Add 4,4'-dimethoxytriphenylmethyl chloride (949.0 mg, 2.8 mmol, 1.5 equiv) to the reaction system under an ice-water bath. Then stir the reaction solution at room temperature for 2 hours. After the reaction is completed, distill off the solvent pyridine under reduced pressure. Extract the remaining system with saturated sodium bicarbonate solution and ethyl acetate three times. Combine the organic phases and evaporate to dryness. Purify the obtained crude product by silica gel column chromatography (petroleum ether / ethyl acetate 4:1 to 0:1) to obtain white solid compound 3-4 (0.7 g, reaction yield 70%). The 1 1H NMR data: (400 MHz, DMSO-d6) δ 11.3 (s, 1H), 7.37 (d, J = 8.0 Hz, 1H), 7.33 - 7.29 (m, 4H), 7.20 - 7.17 (m, 5H), 6.86 - 6.83 (m, 4H), 5.40 (d, J = 8.0 Hz, 1H), 4.61 (d, J = 4.8 Hz, 2H), 3.83 - 3.79 (m, 2H), 3.72 (s, 6H), 3.71 - 3.68 (m, 1H), 3.08 - 2.90 (m, 2H), 1.90 (s, 1H), 1.01 (d, J = 6.4 Hz, 3H). Mass spectrometry identification of compound 3-4 (C 30 H 32 N2O6, molecular weight 516.1, [M+H] = 517.4).

[0112] (5) Dissolve compound 3-4 (1.2 g, 2.32 mmol) in dichloromethane (12.0 mL) under nitrogen at room temperature. Add 4,5-dicyanoimidazole (357.0 mg, 3.02 mmol, 1.3 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.05 g, 3.48 mmol, 1.5 equiv) to the reaction system respectively. Then stir the reaction solution at room temperature for 2 hours. After the reaction is completed, dissolve the reaction solution in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL), and continue to stir at room temperature for 0.5 hour. Extract the reaction solution with ethyl acetate three times, combine the organic phases and evaporate to dryness. The obtained crude product is prepared by C18 reverse-phase column to obtain white solid compound SA000016 (1.2 g, reaction yield 71%). 1 1H NMR data: (400 MHz, CD3CN) δ 9.39 (s, 1H), 7.39 - 7.24 (m, 10H), 6.85 - 6.81 (m, 4H), 5.43 - 5.39 (m, 1H), 4.21 - 4.18 (m, 1H), 3.86 - 3.77 (m, 1H), 3.75 (s, 6H), 3.56 - 3.53 (m, 5H), 3.28 - 3.05 (m, 2H), 2.62 - 2.61 (m, 2H), 2.22 - 2.19 (m, 2H), 1.22 - 1.07 (m, 15H). 31 31P NMR data: (400 MHz, CD3CN) δ 147.6, 146.5. The mass spectrometry identification of compound SA000016 (C 39 H 49 N4O7P, molecular weight 716.1, [M + H] = 717.5).

[0113] The synthetic route of 3.4Ggo monomer is as follows:

[0114]

[0115] (1) Under the conditions of -78 °C and argon protection, the solution of butyllithium in tetrahydrofuran (2.5 M, 355.5 mL, 2.1 equiv) was slowly added dropwise to the solution of DIEA (85.7 g, 846.5 mmol, 119.6 mL, 2.0 equiv) in tetrahydrofuran (1.85 L). After the addition, the mixture was stirred at -78 °C for one hour. Subsequently, the solution of compound 1-1 (commercially available, purchased from Adamas) (50.0 g, 423.3 mmol, 48.6 mL, 1.0 equiv) in tetrahydrofuran (910.0 mL) was slowly added dropwise to the reaction solution and stirred for another hour. Then, HMPA (128.0 g, 714.3 mmol, 125.0 mL, 1.69 equiv) and benzyl chloromethyl ether (92.8 g, 592.6 mmol, 81.8 mL, 1.4 equiv) were slowly added dropwise to the reaction solution, and then the reaction solution was slowly warmed to 0 °C and stirred for 3 hours. After the reaction was completed, the reaction solution was extracted with ethyl acetate three times. The organic phases were combined and concentrated by rotary evaporation. The obtained crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 30:1 to 19:1) to obtain a yellow oily compound 1-2 (54.0 g, reaction yield 54%). The 1 1H NMR data: (400 MHz, CDCl3) δ 7.37 - 7.27 (m, 5H), 4.53 - 4.52 (m, 2H), 4.14 (s, 1H), 3.77 - 3.72 (m, 6H), 2.78 - 2.74 (m, 1H), 1.24 - 1.23 (d, J = 6.4 Hz, 4H). The mass spectrometry identification of compound 1-2 (C 13 H 18 O4, molecular weight 238.1, [M + H] = 239.2).

[0116] (2) At room temperature, compound 1-2 (51.0 g, 214.0 mmol) was dissolved in dichloromethane (510.0 mL). Then, imidazole (36.4 g, 535.1 mmol, 2.5 equiv) and tert-butyldimethylchlorosilane (48.4 g, 321.0 mmol, 39.5 mL, 1.5 equiv) were slowly added to the reaction solution and stirred for 4 hours. After the reaction was completed, the reaction solution was extracted with saturated sodium bicarbonate solution and dichloromethane three times. The organic phases were combined and concentrated by rotary evaporation. The obtained crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 150:1 to 120:1) to obtain a colorless oily compound 1-3 (61.9 g, reaction yield 82%). The 11H NMR data: (400 MHz, CDCl3) δ 7.34 - 7.27 (m, 5H), 4.55 - 4.48 (m, 2H), 4.13 - 4.07 (m, 1H), 3.72 - 3.67 (m, 4H), 3.60 - 3.57 (m, 1H), 2.80 - 2.77 (m, 1H), 1.17 - 1.59 (d, J = 6.0 Hz, 4H), 0.86 (s, 9H), 0.05 - 0.03 (d, J = 8.8 Hz, 6H). Mass spectrometry identification of Compound 1 - 3 (C 19 H 32 O4Si, molecular weight 352.1, [M + H] = 353.2).

[0117] (3) At -78 °C, Compound 1 - 3 (60.0 g, 170.2 mmol) was dissolved in tetrahydrofuran (600.0 mL). Subsequently, diisobutylaluminum hydride (1.0 M, 425.5 mL, 2.50 equiv) was slowly added to the reaction solution and stirred at -78 °C for 2 hours. After the reaction was completed, the reaction solution was extracted 3 times with saturated ammonium chloride solution and ethyl acetate. The organic phases were combined and evaporated to dryness. The crude product obtained was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 50:1 to 20:1) to obtain Compound 1 - 4 as a colorless oil (21.5 g, reaction yield 39%). The 1 1H NMR data: (400 MHz, CDCl3) δ 7.28 - 7.19 (m, 5H), 4.46 - 4.44 (m, 2H), 4.13 - 4.10 (m, 1H), 3.95 - 3.91 (m, 1H), 3.67 - 3.55 (m, 3H), 3.03 - 3.01 (m, 1H), 1.70 - 1.63 (m, 1H), 1.17 - 1.09 (m, 3H), 0.83 - 0.78 (m, 9H), 0.02 (d, J = 5.2 Hz, 6H). Mass spectrometry identification of Compound 1 - 4 (C 18 H 32 O3Si, molecular weight 324.1, [M + H] = 325.2).

[0118] (4) Under nitrogen at room temperature, compound 1-4 (5.5 g, 16.9 mmol), 2-amino-6-chloropurine (4.3 g, 25.4 mmol, 1.5 equiv), and triphenylphosphine (6.8 g, 25.9 mmol, 1.53 equiv) were dissolved in tetrahydrofuran (93.0 mL). Subsequently, diisopropyl azodicarboxylate (5.4 g, 26.6 mmol, 5.16 mL, 1.57 equiv) was slowly added to the reaction mixture under an ice-water bath. After the addition was complete, the reaction mixture was stirred at room temperature for 5 hours. After the reaction was completed, the reaction mixture was extracted 3 times with saturated ammonium chloride solution and ethyl acetate. The organic phases were combined and evaporated to dryness. The crude product obtained was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1 to 3:1) to obtain a yellow oily compound 1-5 (7.6 g, reaction yield 95%). The 1 1H NMR data of compound 1-5: (400 MHz, CDCl3) δ 7.51 (s, 1H), 7.16 - 7.08 (m, 5H), 4.99 (s, 2H), 4.83 - 4.77 (m, 7H), 4.26 - 4.12 (m, 2H), 3.97 - 3.85 (m, 3H), 3.67 - 3.55 (m, 3H), 3.23 - 3.09 (m, 2H), 2.05 - 2.00 (m, 1H), 1.87 (s, 2H), 1.09 (d, J = 6.4 Hz, 19H), 1.01 (d, J = 6.4 Hz, 3H), 0.74 - 0.70 (m, 9H), 0.01 (d, J = 14.0 Hz, 6H). The mass spectrometry identification of compound 1-5 (C 23 1 34 17ClN5O2Si, molecular weight 475.1, [M + H] = 476.2).

[0119] (5) At room temperature, compound 1-5 (11.0 g, 23.1 mmol) was dissolved in pyridine (110.0 mL). Isobutyryl chloride (3.69 g, 34.66 mmol, 3.63 mL, 1.5 equiv) was slowly added to the reaction mixture. Subsequently, the reaction mixture was stirred at room temperature for 3 hours. After the reaction was completed, the solvent pyridine was removed by distillation under reduced pressure. The remaining system was extracted 3 times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and evaporated to dryness. The crude product, a light brown oily compound 1-6 (22.0 g), was directly used in the next step. The mass spectrometry identification of compound 1-6 (C 27 1 40 17ClN5O3Si, molecular weight 545.1, [M + H] = 546.3).

[0120] (6) At room temperature, compound 1-6 (10.0 g, 18.3 mmol) was dissolved in trifluoroacetic acid (111.1 mL) and water (35.0 mL), and the reaction mixture was stirred at 35 °C for 12 hours. After the reaction was completed, water and trifluoroacetic acid were removed by distillation under reduced pressure. The remaining system was extracted with saturated sodium bicarbonate solution and ethyl acetate three times, and the organic phases were combined and evaporated to dryness. The crude product obtained was separated and purified by silica gel column chromatography (dichloromethane / methanol 100:1 to 25:1) to obtain white solid compound 1-7 (4.8 g, reaction yield 27%). The 1 1H NMR data of compound 1-7: (400 MHz, CDCl3) δ 12.0 (s, 1H), 11.6 (s, 1H), 7.91 (s, 1H), 7.28 - 7.18 (m, 5H), 4.80 (d, J = 4.40 Hz, 1H), 4.35 - 4.23 (m, 3H), 4.15 - 4.09 (m, 1H), 3.77 - 3.73 (m, 1H), 3.32 - 3.27 (m, 2H), 3.23 - 3.09 (m, 2H), 2.83 - 2.76 (m, 1H), 2.18 - 2.15 (m, 1H), 1.13 - 1.10 (m, 9H). The mass spectrometry identification of compound 1-7 (C 21 H 27 N5O4, molecular weight 413.1, [M + H] = 414.2).

[0121] (7) At room temperature under hydrogen (50 psi), compound 1-7 (4.3 g, 10.4 mmol) was dissolved in methanol (43.0 mL), and trifluoroacetic acid (592.9 mg, 5.2 mmol, 0.38 mL, 0.5 equiv) and palladium on carbon (2.69 g, 2.53 mmol, 2.43 equiv) were added to the reaction system respectively. Subsequently, the reaction mixture was stirred at 30 °C for 16 hours. After the reaction was completed, palladium on carbon was removed by filtration, and the remaining system was distilled under reduced pressure to obtain crude product white solid compound 1-8 (3.0 g, reaction yield 87%). The 1H NMR data of compound 1-8: (400 MHz, DMSO-d6) δ 12.1 (s, 1H), 11.6 (s, 1H), 7.95 (s, 1H), 4.26 - 4.05 (m, 2H), 3.74 - 3.71 (m, 1H), 3.29 (d, J = 4.8 Hz, 2H), 2.82 - 2.75 (m, 1H), 1.94 - 1.90 (m, 1H), 1.13 - 1.10 (m, 9H). The mass spectrometry identification of compound 1-8 (C 14 H 21 N5O4, molecular weight 323.1, [M + H] = 324.2).

[0122] (8) At room temperature, compound 1-8 (3.0 g, 9.28 mmol) was dissolved in pyridine (30.0 mL). Under an ice-water bath, 4,4'-dimethoxytriphenylmethyl chloride (3.46 g, 10.2 mmol, 1.1 equiv) was added to the reaction system. Subsequently, the reaction solution was stirred at 15 °C for 2 hours. After the reaction was completed, the solvent pyridine was removed by distillation under reduced pressure. The remaining system was extracted with saturated sodium bicarbonate solution and ethyl acetate three times. The organic phases were combined and dried by evaporation. The crude product obtained was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 3:1 to 0:1) to obtain white solid compound 1-9 (3.5 g, reaction yield 59%). 1 1H NMR data of compound 1-9: (400 MHz, DMSO-d6) δ 12.0 (s, 1H), 11.5 (s, 1H), 7.87 (s, 1H), 7.22 - 7.14 (m, 5H), 7.04 (t, J = 8.8 Hz, 4H), 6.78 - 6.74 (m, 4H), 4.75 (d, J = 3.6 Hz, 1H), 4.25 - 4.21 (m, 1H), 4.09 - 4.01 (m, 1H), 3.71 (d, J = 1.2 Hz, 1H), 3.07 - 3.04 (m, 1H), 2.24 - 2.22 (m, 1H), 1.13 - 1.06 (m, 9H). 35 H 39 Mass spectrometry identification of compound 1-9 (C

[0123] (9) Under nitrogen at room temperature, compound 1-9 (3.0 g, 4.79 mmol) was dissolved in dry acetonitrile (4.0 mL). Subsequently, the acetonitrile was removed by distillation under reduced pressure and repeated three times. The remaining system was dissolved in dichloromethane (30.0 mL). 4,5-Dicyanoimidazole (736.1 mg, 6.23 mmol, 1.3 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.17 g, 7.19 mmol, 2.28 mL, 1.5 equiv) were added to the reaction system respectively. Subsequently, the reaction solution was stirred at 15 °C for 1 hour. After the reaction was completed, the reaction solution was dissolved in dichloromethane (12.0 mL) and 1% sodium hydroxide solution (40.0 mL), and stirred at 15 °C for another 0.5 hour. The crude reaction product was prepared by C18 reversed-phase column to obtain white solid compound SA000014 (2.2 g, reaction yield 53%). 11H NMR data: (400 MHz, CD3CN) δ 11.86 (s, 1H), 9.58 (s, 1H), 7.58 - 7.54 (m, 1H), 7.29 - 7.15 (m, 9H), 6.76 (s, 4H), 4.24 - 4.05 (m, 3H), 3.73 - 3.52 (m, 10H), 3.24 - 3.22 (m, 1H), 3.02 - 2.94 (m, 1H), 2.86 - 2.72 (m, 4H), 1.25 - 1.03 (m, 23H). 31 31P NMR data: (400 MHz, CD3CN) δ 147.6, 146.8. Mass spectrometry identification of compound SA000014 (C 44 H 56 N7O7P, molecular weight 825.1, [M + H] = 826.5).

[0124] Example 3

[0125] The modified siRNA contains chemical modifications shown as Ago, Cgo, and Ugo at the nucleotide position at the 7th position in the 5'-region of the antisense strand. This modified siRNA was obtained by solid-phase synthesis with reference to Example 1.

[0126]

[0127] The inventors designed and synthesized a large number of siRNAs in the early stage. Among them, the unmodified siRNAs are shown in Table 1 below, and the modified siRNAs are shown in Table 2 (the sequences from top to bottom are the modified sequences corresponding to each siRNA in Table 1) and Table 4. Among them, the capital letters A, C, G, and U represent adenosine - 3'-phosphate, cytidine - 3'-phosphate, guanosine - 3'-phosphate, and uridine - 3'-phosphate respectively; the lowercase letter m indicates that the nucleotide adjacent to the left of this letter m is a 2'-methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the left is a 2'-fluoro-modified nucleotide; dA, dG, and dT represent deoxyadenosine - 3'-phosphate, deoxyguanosine - 3'-phosphate, and thymidine - 3'-phosphate respectively; Tgn represents (S)-ethylene glycol - 5'-methyluridine. The lowercase letter s between capital letters indicates that there is a phosphorothioate linkage between the two nucleotides adjacent to the left and right of s; when s is the first at the 3'-end, it indicates that the end of the nucleotide adjacent to the left of this letter s is a phosphorothioate group.

[0128] Table 1

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135] Among them, SA023-0104 and SA023-0105 are positive control sequences.

[0136] Table 2

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143] Example 4 In vitro Activity Screening of BE(2)-C Cell Line

[0144] The effect of siRNA targeting APP on the expression level of APP mRNA was tested in vitro. The final concentration of the initial transfection of siRNA was 10 nM, and compounds with better activity than SD004461 and SD004462 at a concentration of 10 nM were rescreened for activity at final concentrations of 10 nM and 0.1 nM.

[0145] BE(2)-C cells were cultured in DMEM high-glucose medium (Gibco, C11995500BT) containing 10% fetal bovine serum at 37 °C and 5% CO2, and then the cells were resuspended by trypsin digestion. siRNA was co-transfected into 1.5x10 4 cells using RNAiMAX (Thermo, 13778150). A 96-well plate was used. 0.3 μL of RNAiMAX was added to 19.7 μL of Opti-MEM containing siRNA in each well and incubated at room temperature for 15 minutes. The mixture was added to the 96-well plate, and then cells resuspended in 80 μL of fresh complete medium were added. The cells were incubated for 24 hours, RNA was extracted using a tissue cell extraction kit (Zhiang Biotech, MNTR / FX96), reverse transcription cDNA (Takara, 6210B) was performed, and the expression level of the APP gene was measured by probe-based qPCR (Applied Biosystems, 4444964). The specific operation method can be found in the corresponding instruction manual.

[0146] Primers and probes for the target gene APP:

[0147] Forward primer: CGGCAACCGGAACAACTTT;

[0148] Reverse primer: TCTCGGGCAAGAGGTTCCT;

[0149] Probe: CATGTCCCAAAGTTTAC;

[0150] Primers and probes for the internal reference gene GAPDH:

[0151] Forward primer: TGCACCACCAACTGCTTAGC;

[0152] Reverse primer: ACTGTGGTCATGAGTCCTTCCA;

[0153] Probe: TCATCCATGACAACTTTGGTA;

[0154] The results were expressed as the remaining percentage relative to the APP mRNA expression in cells not treated with siRNA (which was 100%). The smaller the remaining percentage, the higher the inhibitory activity of the siRNA. The results are shown in Table 3.

[0155] Table 3

[0156]

[0157]

[0158]

[0159] It can be seen from the results that the in vitro activities of multiple compounds are equivalent to or even better than that of the positive control compound SD004461. It is expected to obtain safer and more effective siRNA conjugates in the future. The better compounds are conjugated and the in vivo activities are preliminarily screened using the HDI model.

[0160] In addition, it can be seen from the above results that some siRNAs of the APP transcript seem to be more easily targeted by RNAi of the content of this application than other siRNAs, such as SD004335, SD004257, SD004341, SD004283, SD004345, SD004258, SD004260, SD004261. This indicates that these siRNA compositions may all have strong APP gene silencing activity. These preferred sequences are modified against off-target effects, as shown in Table 4.

[0161] Table 4

[0162]

[0163]

Claims

1. An siRNA, which comprises a sense strand and an antisense strand, and is characterized in that: Each nucleotide in the siRNA is independently a modified or unmodified nucleotide; the sense strand comprises one selected from the nucleotide sequences shown in SEQ ID NOs. 1 to 103 or a nucleotide sequence with no more than 3 base mutations in the above sequences, and the antisense strand comprises one selected from the nucleotide sequences shown in SEQ ID NOs. 106 to 208 or a nucleotide sequence with no more than 5 base mutations in the above sequences.

2. The siRNA according to claim 1, wherein: The base at the 3'-end of the nucleotide sequence shown in SEQ ID NOs. 1 to 103 is replaced with U, C or G; and / or, the base A, C or G at the 5'-end of the nucleotide sequence shown in SEQ ID NOs. 106 to 208; and / or, in the 5' to 3' direction, the bases at the 2nd to 8th positions and the last two bases at the 3'-end of the nucleotide sequence shown in SEQ ID NOs. 106 to 208 are independently A, U, C or G.

3. The siRNA according to claim 1 or 2, wherein: At least one nucleotide in the sense strand or the antisense strand is a modified nucleotide; and / or, at least one phosphate group is a phosphate group with a modifying group. The modified nucleotide is selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs or any combination of two or more thereof; and / or, the phosphate group with a modifying group is a phosphorothioate group formed by substituting at least one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom.

4. The siRNA according to claim 3, wherein: The modified nucleotide is one or a combination of more than one of 2'-methoxy-modified nucleotide, 2'-fluoro-modified nucleotide, 2'-O-CH2-CH2-O-CH3-modified nucleotide, 2'-O-CH2-CH=CH2-modified nucleotide, 2'-CH2-CH2-CH=CH2-modified nucleotide, 2'-deoxy nucleotide, 2'-methoxyethyl-modified nucleotide, phosphorothioate bond-modified nucleotide, VP-modified nucleotide, LNA, ENA, cET BNA, UNA, GNA, and wherein R1 is H, OH or CH3, and Base is a natural nucleobase, a modified nucleobase, a universal base or an H atom..

5. The siRNA according to claim 1 or 2, wherein: The sense strand contains 2'-methoxy-modified nucleotides, 2'-fluoro-modified nucleotides, and phosphorothioate groups simultaneously; and / or, the antisense strand contains 2'-methoxy-modified nucleotides, 2'-fluoro-modified nucleotides, and phosphorothioate groups simultaneously.

6. The siRNA according to claim 5, wherein: In the 5' to 3' direction, the 2'-methoxy-modified nucleotides in the sense strand are located at any one or more of the first to sixth positions, the tenth to the last positions; and / or, the 2'-fluoro-modified nucleotides in the sense strand are located at any one or more of the seventh to ninth positions; and / or, at least one of the linkages between the following nucleotides in the sense strand is a phosphorothioate group linkage: the first and second nucleotides, the second and third nucleotides, the last and the second last nucleotides, the second last and the third last nucleotides. In the 5' to 3' direction, the 2'-methoxy-modified nucleotides in the antisense strand are located at any one or more of the first position, the third to fifth positions, the seventh to thirteenth positions, the fifteenth position, the seventeenth position to the last position; and / or, the 2'-fluoro-modified nucleotides in the sense strand are located at any one or more of the second position, the sixth position, the fourteenth position, the sixteenth position; and / or, at least one of the linkages between the following nucleotides in the antisense strand is a phosphorothioate linkage: the first and second nucleotides, the second and third nucleotides, the last and the second last nucleotides, the second last and the third last nucleotides; and / or, the nucleotides at any one or more of the 2nd to 8th positions in the antisense strand are and / or, the nucleotide at the first position in the antisense strand contains a VP modification.

7. The siRNA according to claim 1, wherein: The siRNA is selected from the sequences shown in Table 1, Table 2 or Table 4.

8. An siRNA conjugate, characterized in that: It comprises one or more of the siRNAs described in any one of claims 1 to 7, and a conjugating group conjugated to any position of the siRNA.

9. A pharmaceutical composition, characterized in that: It comprises the siRNA described in any one of claims 1 to 7 or the siRNA conjugate described in claim 8, and a pharmaceutically acceptable carrier or excipient.

10. Use of the siRNA according to any one of claims 1 to 7, or the siRNA conjugate according to claim 8, or the pharmaceutical composition according to claim 9 for the preparation of a medicament for treating and / or preventing a disease or disorder associated with amyloid precursor protein APP gene expression.

Images