Salt-induced promoter PagVQ5Pro and application thereof

Abstract

The invention relates to a salt inducible promoter PagVQ5Pro and application thereof, and relates to the technical field of plant genetic engineering, and the nucleotide sequence of the promoter PagVQ5Pro is as shown in SEQ ID NO. 1. According to a GUS dyeing result, a transgenic line PagVQ5Pro-OE1, 3 for overexpressing the poplar promoter PagVQ5Pro can obviously enhance the GUS dyeing activity under a salt induction condition, so that the salt-induced expression of the poplar promoter PagVQ5Pro is proved, and a theoretical basis is laid for the application of the poplar promoter PagVQ5Pro in stress-resistant breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a salt-inducible promoter PagVQ5Pro and its application. Background Art

[0002] Populus L. is an important fast-growing timber tree species, which is widely used in papermaking, ecological restoration and the construction of carbon sink forests. However, soil salinization seriously restricts its planting range and productivity. Salt stress leads to ion imbalance, membrane system damage and growth inhibition in Populus L., and it is urgent to improve its salt tolerance through genetic improvement. At present, plant salt tolerance genetic engineering mostly focuses on the overexpression of functional genes (such as ion transporters, antioxidant enzyme genes), but their constitutive expression may cause energy consumption or growth inhibition under non-stress conditions. Therefore, developing stress-inducible promoters (such as salt stress-inducible promoters) to achieve precise regulation of genes in specific environments is the key to improving the safety and effectiveness of transgenic plants.

[0003] Previous studies have shown that the CDM1 promoter cloned from the promoter region of the Arabidopsis thaliana CDM1 gene has its expression significantly induced by salt; the rice promoter POsSalt1 can specifically initiate the expression of foreign genes in plants under salt stress. These all illustrate that there are promoter elements in plants that respond to salt stress, and they can regulate the expression of related genes under salt stress conditions, and thus may be involved in the salt tolerance mechanism of plants, which has great application value in agricultural biotechnology. However, there are few studies on stress-inducible promoters in Populus L. Therefore, the present invention provides a salt-inducible promoter PagVQ5Pro and its application. Summary of the Invention

[0004] The purpose of the present invention is to provide a salt-inducible promoter PagVQ5Pro and its application to solve the above problems.

[0005] The present invention achieves the above purpose through the following technical solutions:

[0006] The present invention provides a salt-inducible promoter PagVQ5Pro, and the nucleotide sequence of the promoter PagVQ5Pro is as shown in SEQ ID NO.1.

[0007] The present invention also provides an overexpression vector, and the overexpression vector contains the promoter PagVQ5Pro as described above.

[0008] As a further optimized scheme of the present invention, the overexpression vector is pMDC164.

[0009] The present invention also provides a genetically engineered bacterium, and the genetically engineered bacterium contains the above overexpression vector.

[0010] As a further optimized solution of the present invention, the genetically engineered bacterium is Agrobacterium tumefaciens.

[0011] The present invention also provides an application of a salt-inducible promoter PagVQ5Pro in the salt stress-induced expression of plants.

[0012] As a further optimized solution of the present invention, the promoter PagVQ5Pro drives the expression of a target gene under salt stress induction in poplar.

[0013] As a further optimized solution of the present invention, the plant is poplar.

[0014] The present invention also provides a method for obtaining a salt-inducible expression promoter PagVQ5Pro as described above. Using the nucleotide sequence shown in SEQ ID NO.1 as a template, the nucleotide sequence of PagVQ5Pro is cloned by using DNA molecular cloning technology. The primer sequences for DNA molecular cloning are as follows:

[0015] SEQ ID NO.2: GGATCAAGCCTCAAAATACCT;

[0016] SEQ ID NO.3: AGTGCGGCCTAACTATACCTT.

[0017] The beneficial effects of the present invention are as follows:

[0018] According to the GUS staining results of the present invention, the transgenic lines (PagVQ5Pro-OE1, 3) overexpressing the poplar promoter PagVQ5Pro can significantly enhance the GUS staining activity under salt induction conditions. Thus, it is proved that the poplar promoter PagVQ5Pro is induced by salt for expression, laying a theoretical foundation for its application in stress-resistant breeding. Description of the Drawings

[0019] Figure 1 It is an agarose electrophoresis diagram (WT: control group; transgenic lines PagVQ5Pro-OE1, 3 of the poplar promoter);

[0020] Figure 2 It is a salt induction staining result diagram of the leaves of the control group WT and the transgenic lines PagVQ5Pro-OE1, 3 of the poplar promoter in the salt induction experiment of poplar seedlings. Detailed Embodiments

[0021] The present application will be further described in detail below with reference to the accompanying drawings. It is necessary to point out here that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0022] 1. Materials

[0023] Unless otherwise specified, the methods used in this embodiment are all conventional methods known to those skilled in the art. The reagents and other materials used are all commercially available products unless otherwise specified.

[0024] 2. Methods

[0025] 2.1 Cloning of the promoter sequence

[0026] The nucleotide sequence of the PagVQ1 promoter shown in SEQ ID NO.1 was cloned from the poplar genome using the PagVQ5Pro gene cloning primers in Table 1. The PCR product was constructed into a T vector to obtain the PagVQ5Pro cloning vector, which was then preserved and sequenced. The successfully sequenced PagVQ5Pro cloning vector was used as a template for the next experiment.

[0027] Table 1 PagVQ5Pro gene cloning primer sequences

[0028]

[0029] 2.2 Construction of the overexpression vector of promoter PagVQ5Pro

[0030] The overexpression vector of PagVQ5Pro was constructed using the Gateway technology as follows:

[0031] 2.2.1 Primer design and PCR amplification

[0032] Gateway adapters were added to the F and R ends of the primers in the above step 2.1. The primer sequences with the gateway adapters are shown in Table 2, and cloning was performed using the PagVQ5Pro cloning vector as a template.

[0033] Table 2 Primer sequences for PCR amplification

[0034]

[0035] The PCR reaction system is shown in Table 3:

[0036] Table 3 PCR reaction system

[0037]

[0038] Each component was sequentially added to a sterilized PCR tube. After mixing and centrifuging, it was placed in a gradient PCR instrument for PCR amplification reaction. The procedure was as follows: pre-denaturation at 98°C for 10 min; denaturation at 98°C for 30 sec; annealing at 55°C for 30 sec; extension at 72°C for 1 min; final extension at 72°C for 10 min. Among them, the three steps of denaturation-annealing-extension were set for 35 cycles. After the reaction ended, 2.5 μl of 10×DNA Loading Buffer was added to the PCR tube for agarose gel electrophoresis, and then the band position was observed in the gel imaging system.

[0039] 2.2.2, Gel extraction of PCR products

[0040] The gel block with the correct and bright position was cut off in a gel cutter into a sterilized 1.5 ml dorf tube, and gel extraction was carried out using a gel extraction kit (Axygene). The steps were as follows:

[0041] a. Add 400 μL of buffer DE-A to the centrifuge tube and heat it in a 75°C metal bath until the gel block melts;

[0042] b. After adding 200 μL of buffer DE-B and mixing, transfer it to a 2.0 ml preparation tube and centrifuge at 12000 rpm for 1 min;

[0043] c. Discard the waste liquid, add 500 μL of buffer W1 and centrifuge at 12000 rpm for 30 sec;

[0044] d. Discard the waste liquid, add 700 μL of buffer W2 and centrifuge at 12000 rpm for 1 min, and repeat once;

[0045] e. Place the empty tube in the centrifuge and centrifuge at 12000 rpm for 1 min to completely remove the liquid in the preparation column;

[0046] f. Place the preparation tube into a sterilized 1.5 ml centrifuge tube, let it stand at room temperature for 20 min until the absolute ethanol completely evaporates, add 25 μL of preheated Elution buffer at 65°C for elution, and finally obtain a solution containing the target gene PagVQ5Pro, which was stored at -20°C.

[0047] 2.2.3, Construction of vector by BP reaction

[0048] The target gene PagVQ5Pro obtained in the above step 2.2.2 was cloned into the intermediate vector pDONR207 through the BP reaction. The reaction system was shown in Table 4:

[0049] Table 4 Reaction system of BP reaction

[0050]

[0051] After connection for 6 h at 25 °C, PCR product gel extraction was carried out (the method was the same as that in step 2.2.2), and then transformation and sequencing of Escherichia coli were carried out. The specific experimental steps were as follows:

[0052] a. Add 5 μL of the reaction product to 50 μL of Escherichia coli competent cells, bury them on ice for 30 min, heat shock in a 42 °C metal bath for 1 min, and then bury them on ice for another 2 min;

[0053] b. Add 200 μL of LB in a laminar flow hood, place it in a shaker at 37 °C and 180 r / min for 1 h of shaking culture. Pipette 100 μl of the bacterial solution in the laminar flow hood and evenly spread it on the LB solid medium containing Kan antibiotic with a spreader;

[0054] c. Place the culture dish with the spread bacterial solution face up in an incubator at 37 °C for 30 min, then invert it and culture for about 12 h, and observe the growth of the bacterial colonies;

[0055] d. Use a pipette tip to pick a single, well-grown colony and inoculate it into 1 ml of liquid medium containing Kan antibiotic, place it in a shaker at 37 °C and 220 r / min for 4 - 5 h for subculture;

[0056] e. Send the shaken bacterial solution to a biological company for sequencing. According to the returned results, preserve the bacterial solution with the correct construction (bacterial solution: glycerol = 1:1). The remaining bacterial solution can be continuously subcultured in large quantities and then the plasmid can be extracted and preserved, or the plasmid returned by the company can be preserved.

[0057] 2.2.4. Construction of the vector by LR reaction

[0058] After the sequencing of the intermediate vector constructed in step 2.2.3 above was correct, the target gene PagVQ5Pro was constructed onto the overexpression vector pMDC164 using the LR reaction, and the vector pMDC164 without the ligated target gene was used as a control. The reaction system was shown in Table 5:

[0059] Table 5 Reaction system of the LR reaction

[0060]

[0061] At 25 °C, connect for 6 h, and then carry out PCR product gel extraction, transformation, and sequencing (the method was the same as the steps in 2.2.2); then extract the plasmid, and finally introduce it into the Agrobacterium tumefaciens competent cell GV3101. The specific steps were as follows:

[0062] (1) Take out the Agrobacterium tumefaciens competent cells (GV3101) from the ultra-low temperature refrigerator and thaw them on ice to a freeze-thaw state;

[0063] (2) Pipette 2.5 μl of the recombinant plasmid obtained in step 2.2.3 into 50 μl of Agrobacterium competent cells, incubate on ice for 5 min, flash-freeze in liquid nitrogen for 5 min, heat-shock in a 37 °C metal bath for 5 min, and continue to incubate on ice for 5 min;

[0064] (3) Add 200 μl of LB liquid medium in a laminar flow hood, place it in a shaker at 28 °C and 200 r / min, and shake for 4 - 5 h;

[0065] (4) Spread 100 μl of the bacterial solution evenly on an LB solid medium containing two antibiotics, Kan and Rif. First, place it upright in a 28 °C incubator for 30 min, then invert it and incubate in the dark for 2 - 3 days;

[0066] (5) Pick a single colony in a laminar flow hood and transfer it to 1 ml of LB liquid medium containing Kan and Rif, then place the shaking tube on a shaker at 28 °C and 220 r / min and shake for 24 - 48 h;

[0067] (6) After the bacterial solution is shaken evenly, perform bacterial solution PCR (the PCR program is the same as in step 2.2.1). The reaction system is shown in Table 6. At the same time, set positive and negative controls with ddH2O and plasmid to ensure the successful transformation of the recombinant plasmid. The successfully transformed bacterial solution is stored after preservation and placed at -80 °C for low-temperature storage.

[0068] Table 6 Reaction system of bacterial solution PCR

[0069]

[0070]

[0071] 3 Poplar genetic transformation

[0072] 3.1 Genetic transformation steps

[0073] a. Add the Agrobacterium obtained in step 2.2.4 above to an LB medium containing the corresponding Kan and Rif and shake it vigorously to make its OD600 value reach about 0.6;

[0074] b. In a laminar flow hood, place the cut leaves of 84K poplar with wounds into the bacterial solution from the previous step and shake on a low-speed horizontal shaker for about 20 min;

[0075] c. After absorbing the excess bacterial solution from the infected leaves, place them in a differentiation medium and incubate in the dark at 24 °C for 2 d;

[0076] d. After 2 d of dark incubation, transfer the leaves to a selection medium containing hygromycin and ticarcillin for selection. Generally, resistant buds will appear after about 20 d;

[0077] e. Cut the resistant shoots and transfer them to the rooting medium with the same resistance. After rooting, propagate them and detect the expression level.

[0078] 3.2 Identification of transgenic poplars by PCR

[0079] Using the GUS gene primers GUS-F / GUS-R (shown in Table 7), identify whether the pMDC164 vector fragment has been successfully transferred into the resistant plants by PCR. At the same time, use non-transgenic poplars (WT) as the negative control.

[0080] Table 7 Primers related to GUS transgenic identification

[0081]

[0082] The PCR amplification program is shown in Table 8:

[0083] Table 8 PCR amplification program

[0084]

[0085]

[0086] The PCR identification results are as Figure 1 shown. Select the resistant plants PagVQ5Pro-OE1 and 3 that have been successfully transferred as the transgenic lines of the poplar promoter overexpressing PagVQ5Pro.

[0087] 3.3 Salt induction experiment

[0088] 3.3.1 Preparation of the medium

[0089] Select the tissue culture seedlings of the transgenic lines of the poplar promoter overexpressing PagVQ5Pro (PagVQ5Pro-OE1, 3) and the control group (WT) for propagation. The medium formula: formula for a 1-liter system (MS: 2.215 g; sucrose 10 g; agar: 8 g).

[0090] 3.3.2 Process of the salt induction experiment

[0091] 1) Pull out the poplar seedlings that have grown for 4 weeks by the roots and place them in a 200 mM NaCl solution (the roots of the poplar seedlings are immersed in the salt solution) and soak them for 0 h, 3 h, 6 h, and 12 h respectively. Take leaves from each plant in the soaked seedlings at each time period.

[0092] 2) Place the leaves taken at each time period in a 2 ml centrifuge tube, add GUS solution, and soak the whole leaf in the GUS solution. After dark incubation for 24 hours, put the leaves into a centrifuge tube containing 70% ethanol, and then put it into a 95 °C water bath and boil for 10 - 15 minutes to remove the chlorophyll in the leaves and observe the leaf color.

[0093] Principle of GUS staining: The GUS gene encodes β-glucuronidase (GUS), which is a hydrolase that can catalyze the hydrolysis of many β-glucoside ester substances. It can decompose 5-bromo-4-chloro-3-indolyl-glucronide (abbreviated as X-Gluc) into a blue substance.

[0094] The decolorization results are as Figure 2 shown: Through the leaf staining conditions, it can be known that compared with the control group, the GUS staining activity of the Populus promoter transgenic lines overexpressing PagVQ5Pro (PagVQ5Pro-OE1, 3) is significantly enhanced under salt induction conditions, indicating that the promoter PagVQ5Pro is induced by salt expression.

[0095] The above-described embodiments only express several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A salt-inducible promoter PagVQ5Pro, characterized in that, The nucleotide sequence of the promoter PagVQ5Pro is shown as SEQ ID NO.

1.

2. An overexpression vector, characterized in that, The overexpression vector contains the promoter PagVQ5Pro as described in claim 1.

3. The overexpression vector according to claim 2, wherein The overexpression vector is pMDC 164.

4. A genetically engineered bacterium, characterized in that, The genetically engineered bacterium contains the overexpression vector as described in any one of claims 2-3.

5. A genetically engineered bacterium according to claim 4, wherein The genetically engineered bacterium is Agrobacterium.

6. Use of the salt-induced expression promoter PagVQ5Pro as described in claim 1 in the salt stress-induced expression of plants.

7. The application according to claim 6, characterized in that, The promoter PagVQ5Pro drives the expression of a target gene under salt stress induction in plants.

8. The application according to claim 7, characterized in that, The plant is Populus.

9. A method for obtaining the salt-induced expression promoter PagVQ5Pro as described in claim 1, characterized in that, Using the nucleotide sequence shown in SEQ ID NO.1 as a template, the nucleotide sequence of PagVQ5Pro is cloned by DNA molecular cloning technology. The primer sequences for DNA molecular cloning are as follows: SEQ ID NO.2: GGATCAAGCCTCAAAATACCT; SEQ ID NO.3: AGTGCGGCCTAACTATACCTT.

Images