Application of sgRNA for targeted knockout of bovine FGFR1 gene in construction of bovine mammary epithelial cell line
Through CRISPR/Cas9 technology, the FGFR1 gene was targeted to knock out in cow breast epithelial cells, and a stable breast epithelial cell line was constructed, which solved the gap in FGFR1 function research, realized the basis for breast function research, and provided experimental materials for cow breast growth regulation and lactation regulation mechanisms.
Patent Information
- Application Number
- CN202510764006.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-10
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-06-10
AI Technical Summary
In the prior art, no research on the function of the FGFR1 gene in bovine mammary epithelial cells has been reported, which has affected the in-depth study of the function of dairy cows and the lactation regulation mechanism.
Using CRISPR/Cas9 technology, a bovine breast epithelial cell line was constructed by designing sgRNAs targeting knockout bovine FGFR1 genes, and a bovine breast epithelial cell was electrotransfected with sgRNA expression vector and Cas9 expression vector, gene editing, screening and verifying monoclonal cell lines with FGFR1 gene knockout.
A bovine mammary epithelial cell line with significantly downregulated FGFR1 protein expression was successfully constructed. The cell viability and proliferation were not affected, and the expression of genes related to milk protein, lactose and milk fat synthesis was significantly reduced, providing good experimental materials for studying the breast function of dairy cows.
Smart Images

Figure CN120272530A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene editing technology, in particular to a method for the targeted knockout of FGFR1 Application of sgRNA targeting a gene in constructing bovine mammary epithelial cell lines. Background Art
[0002] Fibroblast growth factor receptor 1 (FGFR1) is an important member of the fibroblast growth factor receptor family. It participates in key signaling pathways such as Ras / Raf-MEK-MAPKs, PI3K-AKT, phospholipase Cγ (PLCγ) and STAT, and regulates basic cellular processes including proliferation, differentiation and survival. In recent years, with the continuous deepening of clinical research, a large number of studies have shown that FGFR1 Expression plays a key role in mammary gland development and breast cancer occurrence. FGFR1 Studies have shown that the expression of FGFR1 in muscle tissue of fetal and adult cattle is higher than that in calves, but FGFR1 There are no reports on the functional study of this gene in bovine mammary epithelial cells.
[0003] As an important economic milk-producing animal, the dairy cow's mammary gland tissue is a vast bioreactor, comprising multiple cell types, including mammary epithelial cells, myoepithelial cells, stromal cells, and immune cells. Mammary epithelial cells are primarily responsible for the synthesis and secretion of milk and serve as a cell model for studying the growth regulation, biological functions, and lactation regulation mechanisms of the dairy cow mammary gland.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The purpose of the present invention is to provide a targeted knockout cattle FGFR1 The application of sgRNA of the gene in the construction of bovine mammary epithelial cell lines provides a basis for further research on the mammary gland function and lactation regulation mechanism of dairy cows.
[0006] The technical solution of the present invention is described in detail as follows: The present invention provides a targeted knockout bovine FGFR1 Application of a sgRNA targeting a gene in constructing a bovine mammary epithelial cell line, wherein the sgRNA nucleotide sequence is: AGCAACCGCACGCGCATCAC (SEQ ID NO: 1).
[0007] Optionally or preferably, the method for constructing a bovine mammary epithelial cell line comprises: (1) Construction of sgRNA expression vector: annealing the sgRNA primer to obtain a double-stranded DNA fragment, and ligating the double-stranded DNA fragment to the expression vector using DNA ligase to obtain the sgRNA expression vector; (2) Electroporation of bovine mammary epithelial cells: The sgRNA expression vector and Cas9 expression vector were electroporated into bovine mammary epithelial cells. The sgRNA expression vector can stimulate red fluorescence signals. After 48 hours, puromycin and pyrotoxin were added for drug screening for 7 days, and then the culture was resumed using complete culture medium. (3) Screening and detection of monoclonal cell lines: Screen cells with red fluorescence from the recovered cultured cells and continue to expand the culture. Extract the total DNA of each expanded cultured cell as a template, use the detection primers for PCR amplification, and determine the achievement by sequencing the amplified products. FGFR1 Gene knockout bovine mammary epithelial cell line.
[0008] Optionally or preferably, the nucleotide sequence of the sgRNA primer in step (1) is as follows: sgRNA-F: accgAGCAACCGCACGCGCATCAC (SEQ ID NO: 2), sgRNA-R: aaacGTGATGCGCGTGCGGTTGCT (SEQ ID NO: 3).
[0009] Optionally or preferably, between steps (1) and (2), the steps of sgRNA in vitro transcription and in vitro cleavage are further included, wherein the sgRNA in vitro transcription is performed using the sgRNA expression vector DNA as a template, and the in vitro transcription template is obtained by amplifying the sgRNA in vitro transcription template primers SEQ ID NO: 4-5, and PCR is performed using T7 polymerase and dNTP substrate to obtain an amplified product, and then in vitro transcription is performed; The nucleotide sequences of the primers for amplification of the sgRNA in vitro transcription template are as follows: IVT-sgRNA-F: TTAATACGACTCACTATA GGAGCAACCGCACGCGCATCAC (SEQ ID NO: 4), the underlined sequence is the T7 promoter; IVT-sgRNA-R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 5).
[0010] Optionally or preferably, sgRNA in vitro cleavage is performed using bovine genomic DNA as a template to obtain a PCR amplification containing the sgRNA site. FGFR1 Gene sequence, containing sgRNA site FGFR1The gene sequence is used as a substrate, and Cas9 protein and sgRNA in vitro transcription products are added for in vitro cleavage; The nucleotide sequences of PCR amplification primers SEQ ID NO: 6-7 are as follows: QG- FGFR1 -sgRNA-F: CTTCGCCTGTCTTCCTTTGC (SEQ ID NO: 6), QG- FGFR1 -sgRNA-R: GGACTTGGCTACCCACCTGA (SEQ ID NO: 7).
[0011] Optionally or preferably, in step (2), the bovine mammary epithelial cells are cultured in complete medium for 24 h before electrotransfection, wherein the complete medium is DMEM / F12, further supplemented with FBS at a final concentration of 10% (v / v), penicillin at a final concentration of 100 U / mL, and streptomycin at a final concentration of 100 U / mL.
[0012] Optionally or preferably, in step (2), the final concentration of puromycin is 2.2 μg / mL, and the final concentration of rice thermotoxin is 6.0 μg / mL.
[0013] The present invention also provides a FGFR1 Bovine mammary epithelial cell line with gene knockout, sgRNA was used to knock out bovine mammary epithelial cells GFFR1 The gene knockout was constructed, and the sgRNA nucleotide sequence was: AGCAACCGCACGCGCATCAC (SEQ ID NO: 1).
[0014] Compared with the prior art, the present invention has the following beneficial effects: Clustered regularly interspaced short palidromic repeats / CRISPR-associated protein 9 (CRISPR / Cas9) is the third-generation gene editing technology after zinc finger nuclease technology (ZFNs) and transcription activator effector nuclease technology (TALEN). It is widely used in livestock and poultry farming and plant and animal breeding due to its high efficiency, rapidity and simplicity.
[0015] The present invention provides a targeted knockout bovine FGFR1 The application of the sgRNA of the gene in constructing a bovine mammary epithelial cell line, the mammary epithelial cell line obtained by constructing the sgRNA of the present invention through CRISPR / Cas9 technology, FGFR1 Protein expression was significantly downregulated, and knockout FGFR1The gene expression had no effect on the viability and proliferation of mammary epithelial cells, and the key proliferation genes in the cells PCNA 、 Cyclin D1 、 Cyclin E1 Therefore, the bovine mammary epithelial cell line constructed by the sgRNA provided by the present invention has stable biological activity and FGFR1 The expression of milk protein synthesis related genes (such as CSN1S1 、 CSN2 、 CSN3 、 EFL5 ), lactose synthesis-related genes ( GLUT1 and HKⅡ ) and milk fat synthesis-related genes ( SCD-1 ) expression was significantly decreased, which provided a basis for further study. FGFR1 The effects of genes on the biological functions of mammary epithelial cells provide very good experimental materials. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 For cattle FGFR1 Schematic diagram of gene sgRNA target sites, the blue marked positions are the exons corresponding to sgRNA.
[0017] Figure 2 for FGFR1 The construction process and results of knockout plasmids, where A is the schematic diagram of the sgRNA expression vector structure, B is the gel electrophoresis diagram of the bacterial solution PCR amplification corresponding to the sgRNA, and C is FGFR1 Sequence comparison of knockout sgRNA expression vectors.
[0018] Figure 3 Figure 3 is the verification result of sgRNA in vitro transcription and cleavage efficiency, where A is the electrophoresis result of in vitro transcription template preparation, B is the gel electrophoresis result of in vitro transcribed sgRNA, C is the gel electrophoresis diagram of sgRNA in vitro cleavage, and D is the statistical result diagram of sgRNA in vitro cleavage efficiency. IVT stands for in vitro transcription, and DL15000 and DL2000 represent molecular weight standards.
[0019] Figure 4Figure 3: Electroporation effect test results of bMECs. A: Cell fluorescence 72 h after electroporation (20×), A1-A3 represent different transfection replicates, and the scale bar is 100 μm. B: PCR gel electrophoresis of cell DNA 7 days after drug selection. DL2000 represents the molecular weight standard, sgRNA-NC represents the edited fragment in the control group, and sgRNA-A1-A3 represent the edited fragments in three different replicates of the transfection group. C: Sequence alignment results of cells 7 days after drug selection. sgRNA-NC represents the edited fragment sequence in the control group, and sgRNA-A1-A3 represent the edited fragment sequence in the transfection group.
[0020] Figure 5 for FGFR1 Growth and fluorescence of knockout monoclonal cells, showing the growth process of monoclonal cells at different times (4×).
[0021] Figure 6A This is the gel electrophoresis detection diagram of the sgRNA site in the monoclonal cell editing type determination experiment. DL5000 represents the molecular weight standard, KO#1~8 represent different cell lines, and NC represents the blank control.
[0022] Figure 6B This is a sequence alignment diagram of 8 monoclonal cell lines, KO#1~8, in the experiment to determine the editing type of monoclonal cells.
[0023] Figure 7 To determine the knockout effect of monoclonal cells and the cell viability and proliferation, A: WB verification of the knockout effect of monoclonal cell lines, NC represents blank control, KO represents knockout cell lines; B: knockout cell lines FGFR1 Grayscale analysis of WB results of gene expression; C: FGFR1 Comparison of cell viability between gene knockout cell lines (KO group) and wild type (NC group); D: knockout FGFR1 Effects on the expression of cell proliferation-related genes; E: knockout FGFR1 Effects on the expression of cell lactation-related genes. DETAILED DESCRIPTION
[0024] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.
[0025] Example 1 FGFR1 Construction of a gene knockout bovine mammary epithelial cell line 1.1 Test materials The bovine mammary epithelial cell line (bMECs), pGL3-hU6-sgRNA-mCherry-puromycin (pGL3, carrying a red fluorescent gene), and the pST1374-Cas9-ZFNLS AmpBst (Cas9) vector were maintained by the Laboratory of the Cattle and Sheep Genetic Improvement and Healthy Breeding Innovation Team of the Jiangsu Academy of Agricultural Sciences. These biological materials can also be purchased or constructed commercially.
[0026] 1.2 Main Reagents Reverse transcription kit, universal high-sensitivity dye-based quantitative PCR detection kit, DNA markers (2000, 5000), and 2× Rapid Taq Master Mix were purchased from Nanjing Novozymes. 10× protease inhibitor, RIPA protein lysis buffer, puromycin, and blasticidin were purchased from Shanghai Beyotime. Restriction endonuclease Bas I was purchased from New England Biolabs (NEB). An endotoxin-free plasmid extraction kit was purchased from Beijing Tiangen Biotechnology. DMEM / F12 was purchased from Shanghai Peiyuan. 1× PBS and 0.25% trypsin were purchased from Gbico. T4 DNA Ligase was purchased from Takara. An SDS-PAGE gel rapid preparation kit was purchased from Yazyme. Protein marker, PVDF membrane, and in vitro transcription kit were purchased from Thermo Fisher. An RNA extraction kit was purchased from Beijing Dona Pharmaceutical. DH5α competent Escherichia coli was purchased from Nanjing Qingke. Primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd.
[0027] 1.3 sgRNA design and vector construction Based on cattle FGFR1 The sequence of the gene (NCBI reference sequence XM_059882166) was generated using the gene editing target site online design website CRISPOR (http: / / crispor.tefor.net / ). FGFR1 Design sgRNA on exon 3 of the gene (see Figure 1 Based on the insertion position (Bsa I enzyme) of the sgRNA expression vector, accg was added to the 5' end of the forward primer and aaac was added to the 5' end of the reverse primer. The primer sequences were then synthesized at Nanjing Qingke Biotechnology Co., Ltd. See Table 1 for sgRNA and primer sequence information.
[0028] The PGL3 plasmid vector was linearized and recovered using Bsa I endonuclease. The upstream and downstream sgRNA primers listed in Table 1 were diluted to 100 μM in enzyme-free water. 5 μL of each was mixed and denatured at 98°C for 10 minutes. The mixture was then cooled to room temperature for annealing. The linearized vector and the annealed sgRNA double-stranded fragment were ligated using T4 DNA ligase. The reaction was incubated overnight at 16°C. The ligation product was transformed and cultured with ampicillin. Single colonies were picked and amplified using PCR. The upstream primer was PGL3-F: 5'-CGATTAGTGAACGGATCTCGACG-3' (SEQ ID NO: 8), and the downstream primer was the antisense strand of the sgRNA.
[0029] The PCR amplification system was as follows: 1 μL upstream primer, 1 μL downstream primer, 10 μL Taq enzyme, 1 μL bacterial solution, and water was added to 20 μL.
[0030] The PCR reaction program was as follows: initial denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 3 s, and final extension at 72°C for 5 min.
[0031] After verifying the correct band size by 2% agarose gel electrophoresis, Sanger sequencing was performed. The plasmid DNA was extracted using an endotoxin-free plasmid DNA extraction kit. After verifying the correct band size and concentration by 2% agarose gel electrophoresis, the DNA was stored in a -20°C refrigerator to obtain the sgRNA expression vector.
[0032] Table 1 sgRNA and primer sequences 1.4 sgRNA in vitro transcription A T7 promoter sequence was added to the 5' end of the sgRNA to form the upstream primer for in vitro transcription. The downstream primer was the PGL3-gRNA scaffold universal primer. See Table 2 for a specific primer list. Using the aforementioned sgRNA expression vector DNA as a template, PCR amplify the sgRNA in vitro transcription template. Prepare a 20 μL amplification system and follow the reaction procedure in 1.3, with an annealing temperature of 60°C and an extension time of 5 s. Recover the amplified product and proceed with in vitro transcription.
[0033] The transcription system was as follows: dATP 1 μL, dUTP 1 μL, dCTP 1 μL, dGTP 1 μL, T7 10 × buffer 1 μL, sgRNA recovery product 100 ng, T7 enzyme 1 μL, and water added to 10 μL. After mixing, the reaction was carried out at 37°C for 3 h to obtain the in vitro transcription product. The RNA quality of the in vitro transcription product was verified by 2% agarose gel electrophoresis.
[0034] Table 2 In vitro transcription template primer sequences Note: The underlined sequence is the T7 promoter sequence.
[0035] 1.5 sgRNA cleavage in vitro PCR amplification was performed using bovine genomic DNA as a template. FGFR1 Gene sequence, ensuring the amplified sequence contains the sgRNA editing region. Primer sequences are shown in Table 3. The amplification system and reaction procedure are described in 1.3, with an annealing temperature of 58°C and an extension time of 5 s. The amplified product is recovered and used as a substrate for in vitro cleavage by adding Cas9 protein and in vitro transcription products.
[0036] The cleavage system was as follows: 200 ng of Cas9 protein, 50 ng of in vitro transcribed sgRNA, 200 ng of DNA, and 2 μL of Cas9 protein buffer. The mixture was diluted to 20 μL with water. After cleavage at 37°C for 3 h, the cleavage efficiency was verified by 1.5% agarose gel electrophoresis.
[0037] Table 3 In vitro cleavage FGFR1 Fragment PCR amplification primer sequences 1.6 bMECs cell culture and electroporation After bMECs were revived, they were placed in complete culture medium (DMEM / F12 supplemented with 10% FBS, a final concentration of 100 U / mL penicillin, and 100 U / mL streptomycin) and cultured at 37°C, 5% CO2, and 100% humidity for 24 hours. Based on previous research by our group and myself, the optimal working concentrations of puromycin and oryzaetoxin are 2.2 μg / mL and 6.0 μg / mL, respectively.
[0038] The electroporation solution was prepared as follows: Solution I: 0.6 g MgCl₂.6H₂O and 1 g ATP-Na₂ dissolved in 5 mL ddH₂O, thoroughly dissolved and mixed, filtered through a 0.22 μm filter, aliquoted, and stored at -20°C to avoid repeated freeze-thaw cycles. 10× Solution II: 0.2 g glucose, 0.6 g NaHCO₃, and 6 g KH₂PO₄ dissolved in a 50 mL centrifuge tube, added to 30 mL ddH₂O, thoroughly dissolved and mixed, and adjusted to pH 7.4 using a pH meter by adding NaOH. The volume was then made up to 50 mL with ddH₂O, sterilized by filtering through a 0.22 μm filter, aliquoted, and stored at 4°C. Prepare the electroporation working solution at a volume ratio of 1:5 for Solution I:10× Solution II. The electroporation working solution reaction system is as follows: Solution Ⅰ 2 μL, 10 × Solution Ⅱ 10 μL, sgRNA expression vector 6.7 μg, Cas9 expression vector 13.3 μg, ddH2O to 100 μL.
[0039] When the cell confluence reached 70%-80%, the cells were digested to prepare a cell suspension, and 2.5×10 5 Transfer 100 cells to a 1.5 mL enzyme-free centrifuge tube and centrifuge at 1500 rpm for 5 min. Remove the supernatant and add the prepared electroporation working solution to a 1.5 mL enzyme-free centrifuge tube. Gently pipette to mix thoroughly. Pour the mixture from the centrifuge tube into the electrode cup, secure the lid, and perform electroporation at 300 V, 1 ms pulse duration, and 2 pulses. Replace the medium with fresh media 4 hours after electroporation. 48 hours after transfection, add puromycin and pyrotoxin toxin screen for 7 days and allow the cells to recover in normal culture medium for 2 days. Observe cell fluorescence under a fluorescence microscope and collect a portion of total cell DNA for PCR amplification using the primers and system described in 1.5. After agarose gel electrophoresis, cut the gel and send it to Nanjing Qingke Biotechnology Co., Ltd. for Sanger sequencing.
[0040] 1.7 Screening of Monoclonal Cell Lines Cells recovered from the drug screen were digested with 0.25% trypsin for 3 minutes until the cells became round but did not begin to detach. Single cells were aspirated using a mouth pipette and transferred to a 96-well plate for further culture. When the cell confluence in the 96-well plate reached approximately 80%, cell fluorescence was observed under a fluorescence microscope. Cells with red fluorescence were digested and transferred to a 24-well plate for further culture. When the cell confluence in the 24-well plate reached approximately 90%, half of the cells were digested and collected for total cell DNA extraction. PCR amplification was performed using the primers and system described in 1.5 and then sent for testing. The remaining cells were continued in culture.
[0041] 1.8 Detection of editing status in monoclonal cells Extract total DNA from monoclonal cells and use the above total DNA from monoclonal cells as a template for amplification using the following primers: BJ- FGFR1 -sgRNA-F: CTTCGCCTGTCTTCCTTTGC (SEQ ID NO: 6), BJ- FGFR1 -sgRNA-R: GCTCGCCACCTGTAAACAA (SEQ ID NO: 9).
[0042] The sgRNA editing site and the fragments before and after (2136 bp) were amplified, and the fragment size was determined by gel electrophoresis. The gel was cut and sent for testing, and the sequencing sequence was compared with SnapGene software to determine the editing status of the monoclonal cells.
[0043] 1. 9-cell editing type T-type sequencing Gene-edited monoclonal cells may exhibit multiple genotypes, requiring TA sequencing to determine the edited cell type. Use the PCR amplification system and primers described in 1.8 to obtain the target fragment and recover and purify it. Ligate the recovered product with a T-vector overnight at 16°C. The T-vector ligation system is as follows: 50 ng of target fragment DNA, 1 μL of pMD19-T Vector, 5 μL of 2 × Solution I, and ddH2O to 10 μL. Transform the ligation product, select positive colonies, and perform colony PCR. For each sample, randomly select 12 positive colonies for Sanger sequencing. Analyze the sequencing results to determine the specific edited cell type of the monoclonal cell line.
[0044] 1.10 Western blot Monoclonal cell lines were harvested and total protein was extracted. Ensure that 20 μg of protein was loaded. Electrophoresis was performed for 90 min. The membranes were transferred to the membranes (FGFR1 for 45 min, GAPDH for 25 min). Blocking was performed with 5% defatted powder for 2 h. The membranes were incubated with primary antibodies (1:1000) for FGFR1 and 1:12000 for GAPDH) at 4°C overnight. The membranes were washed with 1× TBST and incubated with rabbit secondary antibodies (1:5000) for 1.5 h at room temperature. After washing with 1× TBST, the membranes were incubated with ECL buffer (solution A:solution B = 1:1). Images were immediately developed using a chemiluminescence imaging system and saved. Bands were analyzed for grayscale using Image J.
[0045] 1.11 Real-time quantitative PCR (RT-qPCR) Monoclonal cell lines were collected, and total RNA was extracted from cells according to the instructions of the RNA extraction kit and reverse transcribed into cDNA. The reaction system was configured and the reaction program was run according to the instructions of the universal high-sensitivity dye-based quantitative PCR detection kit using cDNA as a template. Three replicates were set for each sample, and the Ct value of the gene was derived and used as the GAPDH The relative expression of target genes was calculated using 2 -ΔΔCt The data were analyzed by the primer sequence shown in Table 4.
[0046] Table 4 RT-qPCR primer sequences 1.11 Cell viability assay (CCK8) 2000 blank control cells were seeded into 96-well plates. FGFR1 Six replicate wells were set up for knockout cells, control groups, and knockout groups, and the cells were tested at 0, 12, 24, 36, 48, and 60 hours. The cells were cultured in a 37°C, 5% CO2, 100% humidity incubator. At the corresponding time points, the original culture medium was discarded, and fresh culture medium containing CCK8 reagent (100 μL culture medium + 10 μL CCK8 reagent) was added. The cells were incubated in the same incubator in the dark for 1 hour. After the reaction, the cell optical density (OD) value was measured using a microplate reader with the detection wavelength set at 450 nm.
[0047] 1.12 Data Statistical Analysis Statistical analysis was performed using Excel and GraphPad Prism 8.0. All data were expressed as mean ± standard deviation (mean ± SD). The differences between the two groups were analyzed using the independent sample t test. P <0.05 indicated that the difference was statistically significant.
[0048] 2 Results 2.1 Cow FGFR1 Construction of knockout plasmid FGFR1 The structure of knockout plasmid, i.e. sgRNA expression vector, is shown in Figure 2 A, bacterial liquid PCR amplification, sequence alignment ( Figure 2 Results in Figures B and C show that the bands are of a single size and the plasmid sequence is correct. These results demonstrate that the sgRNA expression vector was successfully constructed.
[0049] 2.2 Determination of sgRNA in vitro transcription and cleavage efficiency The in vitro cleavage assay was used to determine the cleavage efficiency of sgRNA. The in vitro transcription template, i.e., the sgRNA expression vector, was found in Figure 3 In A, the electrophoresis results of in vitro transcribed sgRNA showed ( Figure 3 B in the figure shows a clear band with good quality. Cas9 protein and sgRNA were then used to cut the target fragment in vitro. The length of the sgRNA in vitro cut fragment is shown in Table 1.5. The cut product size is approximately 360 bp and 150 bp. The in vitro cutting effect is shown in Figure 3 C in Figure 2 shows two cutting bands. After grayscale analysis of the bands using Image J, it can be seen that the cutting efficiency is 95.75% (see Figure 3 D statistics in Figure 2).
[0050] 2.3 Results of drug screening 7 days after electroporation of bMECs The Cas9 expression vector and sgRNA expression vector were co-transfected into bMECs, and the red fluorescence expression was observed using a fluorescence microscope. Figure 4 As shown in A, more than 95% of the cells have red fluorescence. After 7 days of cell selection, the cells were cultured normally for 2 days. DNA was extracted and the products were amplified by PCR and then electrophoresed. The results are as follows: Figure 4 B in the figure, the amplified product was cut from the gel and sent for testing, and the sequencing results are shown in Figure 4 In Figure C, the sequencing results showed that there were multiple double peaks in the editing region, indicating that the editing effect was obvious, and single clone cells could be further picked.
[0051] 2.4 FGFR1 Monoclonal cell screening results 384 cells were selected from the above drug screening cells, and 92 cells with good growth were obtained after expansion culture. The growth process of monoclonal cells is shown in Figure 5 Extract genomic DNA from some cells in the 24-well plate, amplify the sgRNA editing region, cut the gel and send it for testing. The sequencing results showed that there were 72 cell lines. FGFR1 The gene was edited (78.26%), and finally 8 FGFR1 knockout monoclonal cell lines with plump morphology and good growth were obtained.
[0052] 2.5 Determination of editing type of FGFR1 monoclonal cells For 8 strains FGFR1 The editing type of sgRNA sites in knockout monoclonal cell lines was analyzed, and the electrophoresis results after PCR amplification ( Figure 6A ) showed that KO#2 and KO#3 cell lines had large fragment deletions, KO#3 and KO#5 cell lines had mixed bands, and the bands of the other cell lines were consistent with the wild type. Further sequence results ( Figure 6B) showed that the wild-type cell line amplified a fragment of 2136 bp, the KO#2 strain amplified 1556 bp, and the KO#3 strain amplified a small fragment of a single editing type, 650 bp in size. The remaining six cell lines only had a 4 bp base deletion. Subsequent TA cloning to analyze the editing types of the above eight monoclonal cell lines showed that among the 12 positive clones, the KO#2 and KO#4 cells had only one editing type. The KO#2 cell line had a complete deletion of the sgRNA editing region, with the editing type being a large fragment deletion. The KO#4 cell line had a total deletion of 4 bp. Therefore, the KO#2 cell line was used as the FGFR1 knockout cell line for subsequent experimental studies.
[0053] 2.6 Determination of the Effect of FGFR1 Knockout and Its Impact on bMECs Compared with the control group, WB results showed that the expression of FGFR1 protein in KO#2 cell line was significantly downregulated ( Figure 7 A and B in the figure); CCK8 assay results showed that there was no significant difference in the OD450 values of FGFR1 knockout cells within each assay time period ( Figure 7 C), indicating knockout FGFR1 The results of RT-qPCR showed that knocking out key cell proliferation genes had no effect on the viability of bMECs. PCNA 、 Cyclin D1 、 Cyclin E1 There was no significant difference in gene mRNA expression ( Figure 7 The above results show that knockout FGFR1 After the addition of the gene, there was no significant effect on the viability and proliferation of bMECs. However, the genes related to milk protein synthesis (such as CSN1S1, CSN2, CSN3, EFL5 ), lactose synthesis-related genes ( GLUT1 and HKⅡ ) and milk fat synthesis-related genes ( SCD-1 ) were significantly downregulated ( Figure 7 These results indicate that knockout of the FGFR1 gene has no significant effect on the survival and proliferation of bMECs, but significantly inhibits milk secretion and synthesis in bovine mammary epithelial cells.
[0054] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.
Claims
1. Targeted Knockout Cattle FGFR1 The application of sgRNA of a gene in constructing a bovine mammary epithelial cell line is characterized in that, The sgRNA nucleotide sequence: AGCAACCGCACGCGCATCAC (SEQ ID NO: 1).
2. The use according to claim 1, characterized in that Methods for establishing bovine mammary epithelial cell lines include: (1) Construction of sgRNA expression vector: annealing the sgRNA primer to obtain a double-stranded DNA fragment, and ligating the double-stranded DNA fragment to the expression vector using DNA ligase to obtain the sgRNA expression vector; (2) Electroporation of bovine mammary epithelial cells: The sgRNA expression vector and Cas9 expression vector were electroporated into bovine mammary epithelial cells. The sgRNA expression vector carried a red fluorescent gene. After 48 hours, puromycin and pyrotoxin were added for drug screening for 7 days, and then the cells were cultured in complete medium for 2 days. (3) Screening and detection of monoclonal cell lines: Screen cells with red fluorescence from the recovered cultured cells and continue to expand the culture. Extract the total DNA of each expanded cultured cell as a template, use the detection primers for PCR amplification, and determine the achievement by sequencing the amplified products. FGFR1 Gene knockout bovine mammary epithelial cell line.
3. The use according to claim 2, characterized in that The nucleotide sequence of the primer for step (1) sgRNA is as follows: sgRNA-F: accgAGCAACCGCACGCGCATCAC (SEQ ID NO: 2), sgRNA-R: aaacGTGATGCGCGTGCGGTTGCT (SEQ ID NO: 3).
4. The use according to claim 2, characterized in that Between steps (1) and (2), the steps of sgRNA in vitro transcription and in vitro cleavage are also included. The sgRNA in vitro transcription is performed using the sgRNA expression vector as a template, and the in vitro transcription template is obtained by amplifying the sgRNA in vitro transcription template primers SEQ ID NO: 4~5, and in vitro transcription is performed using T7 polymerase and dNTP substrate; The nucleotide sequences of the primers for amplification of the sgRNA in vitro transcription template are as follows: IVT-sgRNA-F: TTAATACGACTCACTATA GGAGCAACCGCACGCGCATCAC(SEQ ID NO:4), IVT-sgRNA-R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 5).
5. The use according to claim 4, characterized in that sgRNA in vitro cleavage is performed using bovine genomic DNA as a template to obtain sgRNA sites by PCR amplification. FGFR1 Gene sequence, containing sgRNA site FGFR1 The gene sequence is used as a substrate, and Cas9 protein and sgRNA in vitro transcription products are added for in vitro cleavage; The nucleotide sequences of PCR amplification primers SEQ ID NO: 6-7 are as follows: QG- FGFR1 -sgRNA-F:CTTCGCCTGTCTTCCTTTGC(SEQ ID NO:6), QG- FGFR1 -sgRNA-R:GGACTTGGCTACCCACCTGA(SEQ ID NO:7)。 6. The use according to claim 2, characterized in that Step (2) Bovine mammary epithelial cells were cultured for 24 h in complete medium before electroporation. The complete medium was DMEM / F12 supplemented with FBS at a final concentration of 10% (v / v), penicillin at a final concentration of 100 U / mL, and streptomycin at a final concentration of 100 U / mL.
7. The use according to claim 6, characterized in that In step (2), the final concentration of puromycin was 2.2 μg / mL, and the final concentration of pyrotoxin was 6.0 μg / mL.
8. A FGFR1 A bovine mammary epithelial cell line with a knockout gene, characterized in that sgRNA in bovine mammary epithelial cells GFFR1 The gene knockout was constructed, and the sgRNA nucleotide sequence was: AGCAACCGCACGCGCATCAC (SEQ ID NO: 1).
Citation Information
Patent Citations
FGFR1 high-expression recombinant HEK293 cell and application thereof
CN101875916A
SgRNA for targeted knockout of bovine mammary epithelial cell TARDBP gene and cell strain constructed by sgRNA
CN117165592A
SgRNA for accurately editing bovine Oct4 and application of sgRNA
CN117625623A