Application of sdRNA-D43 in preparation of osteoarthritis product
By using sdRNA-D43 as a molecular marker, using gene diagnostic technology and kits, the difficulties in early diagnosis and treatment of osteoarthritis were solved, inhibition of cartilage degeneration and promotion of cartilage matrix synthesis were achieved, and disease progression and patient burden were reduced.
Patent Information
- Application Number
- CN202510471758.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-08
AI Technical Summary
The lack of effective early diagnosis and treatment targets in the prior art to prevent cartilage destruction of osteoarthritis, resulting in patients who can only rely on artificial joint replacement in the late stages of the disease, bringing huge medical and economic burdens.
The expression level of sdRNA-D43 was detected by using gene markers, and the plasmids of overexpression or knockdown of sdRNA-D43 was detected by kit extraction, reverse transcription, real-time quantitative PCR and other technologies, and a plasmid that overexpresses or knocks down sdRNA-D43 was constructed for early diagnosis and treatment of osteoarthritis.
The early diagnosis and treatment of osteoarthritis has been achieved, and cartilage degeneration is inhibited through sdRNA-D43, cartilage matrix synthesis is promoted, disease progression is reduced, and patient burden is reduced.
Smart Images

Figure CN120272587A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and particularly to the application of sdRNA-D43 in the preparation of osteoarthritis products. Background Art
[0002] Osteoarthritis (OA) is a degenerative disease mainly characterized by subchondral bone remodeling, joint inflammation, osteophyte formation, and cartilage degeneration. The incidence of OA has been increasing year by year, which is related to age, obesity, trauma, inflammation, genetics, anatomy, etc. At present, there is no effective therapeutic target to prevent the occurrence and development of cartilage damage. Only drugs such as non-steroidal anti-inflammatory drugs and steroids can control pain symptoms. End-stage OA patients can only receive artificial joint replacement treatment, which brings a huge medical and economic burden to patients and society. Therefore, seeking therapeutic targets for OA and effectively inhibiting cartilage degeneration are currently hot and difficult issues in joint surgery research.
[0003] SdRNAs (snoRNA-derived RNA fragments, sdRNA) are a class of special non-coding RNAs. Small nucleolar RNAs (snoRNAs) have long been considered as molecular guides for sequence-specific modification of ribosomal RNA (rRNA) and small nuclear RNA (snRNA). However, the role of sdRNAs in OA has not been reported. Therefore, it is of great significance to diagnose and intervene in osteoarthritis through sdRNAs at an early stage. Summary of the Invention
[0004] To make up for the deficiencies of the existing technology, the present discovery provides a molecular marker that can be used for the early diagnosis of osteoarthritis (OA). Compared with the traditional imaging examination for diagnosing osteoarthritis, using gene markers to diagnose osteoarthritis has timeliness, specificity, and sensitivity, enabling patients to know the disease risk at an early stage of the disease and taking corresponding preventive and treatment measures according to the level of risk.
[0005] One aspect of the present invention relates to the application of an sdRNA-D43 in the preparation of osteoarthritis products. The sequence of sdRNA-D43 is: CACAGATGATGAACTTATTGACGGG, as shown in SEQ ID NO: 1.
[0006] Preferably, the product is a kit, and the kit includes RNA extraction reagents, reverse transcription reagents, and is used for specifically amplifying the product. The kit includes detecting the expression level of sdRNA-D43 by RT-qPCR, real-time quantitative PCR, immunoassay, in situ hybridization, or chip detection.
[0007] Preferably, the kit includes at least a pair of primers for specifically amplifying sdRNA-D43.
[0008] Preferably, the kit includes an antibody that specifically binds to the sdRNA-D43 protein.
[0009] Preferably, the product is a drug, and sdRNA-D43 is the active ingredient of the drug.
[0010] Preferably, the drug includes plasmids for knocking down or overexpressing sdRNA-D43.
[0011] The plasmid is constructed by a method including the following steps:
[0012] S1. Design primers according to the sdRNA-D43 gene sequence, and PCR amplify the target gene;
[0013] S2. Design a plasmid for overexpressing sdRNA-D43 according to the sdRNA-D43 gene sequence.
[0014] Another aspect of the present invention relates to an expression vector containing sdRNA-D43.
[0015] The third aspect of the present invention relates to a host cell containing the expression vector.
[0016] The present invention first proposes that sdRNA-D43 can promote the synthesis and secretion of cartilage matrix, inhibit cartilage degeneration, and is of great significance for the diagnosis and treatment of early osteoarthritis.
[0017] The present invention collects samples from the damaged area (D) and undamaged area (U) of osteoarthritis, extracts cells, and uses high-throughput sequencing methods to compare the expression profiles of sdRNAs in D cartilage and U cartilage to obtain sdRNA-D43. SdRNA-D43 is significantly up-regulated in damaged cartilage, and this conclusion is verified by PCR experiments. These results reveal the potential value of sdRNA-D43 as a clinical diagnostic biomarker.
[0018] The present invention overexpresses sdRNA-D43 and detects indicators related to cartilage matrix synthesis in chondrocytes, and finds that sdRNA-D43 can inhibit the synthesis and secretion of cartilage matrix and promote cartilage degeneration. Then, the method of specifically knocking down sdRNA-D43 is used to detect the indicators of cartilage matrix generation, suggesting that the increase of sdRNA-D43 is an important factor leading to the occurrence of osteoarthritis. These results indicate that sdRNA-D43 is expected to be used as a drug for treating osteoarthritis. Brief Description of the Drawings
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or in the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0020] Figure 1 It is the expression situation of sdRNA-D43 in cartilage specimens; among them, A: Heat map of the expression of sdRNAs in the worn area and non-worn area of knee cartilage; B: Volcano plot of the expression of sdRNAs in the worn area and non-worn area of knee cartilage; C: qPCR verifies the expression situation of the top five up-regulated sdRNAs (which are sdRNA-D43, sdRNA-D57, sdRNA-D21, sdRNA-D3A, sdRNA-D93 respectively) in the cartilage of the worn area; D: Further verification of the expression situation of sdRNA-D43 in 30 clinical samples of the worn area and non-worn area.
[0021] Figure 2 It is the result diagram of the study on the role of sdRNA-D43 in human cartilage; among them, A: Knockdown and overexpression of sdRNA-D43 in chondrocytes, and qPCR detects the expression changes of sdRNA-D43 and chondrocyte senescence and senescence-related secretory phenotype indexes CDKN2A, CDKN1A, MMP13, MMP3, IL-1β, TNF-α; B-C: Knockdown and overexpression of sdRNA-D43 in chondrocytes, and WB detects the expression changes of chondrocyte senescence indexes p16, p21, MMP13, MMP3, IL-1β, TNF-α and autophagy indexes LC3B II / I, p62.
[0022] Figure 3 It is the result diagram of the study on the role verified by in vivo experiment of sdRNA-D43; among them, A: Experimental diagram of AAV-sh-rat-sdRNA-D43 or AAV-control treating MIA-induced OA rat model; B: CT detects the expression changes of cartilage degeneration after injecting AAV-sh-rat-sdRNA-D43 into the knee OA joint cavity of rats; C: Safranin-fast green staining and immunohistochemistry detect the expression changes of cartilage degeneration and senescence after injecting AAV-sh-rat-sdRNA-D43 into the knee OA joint cavity of rats. Specific implementation manners
[0023] The following is further detailed through specific implementation manners:
[0024] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. Therefore, the detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely represents selected embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the scope of protection of the present invention.
[0025] 1. Sample collection and processing
[0026] Knee joint cartilage tissues were obtained from surgical patients in the First Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong Province. Femoral condyles and tibial plateaus of adults (over 40 years old, knee osteoarthritis, Kellgren & Lawrence imaging grade III to IV, Thompson gross morphology grade III to IV) were obtained during joint replacement surgery for moderate to severe knee osteoarthritis.
[0027] According to the International Cartilage Repair Society (ICRS) grading system, knee osteoarthritis cartilage can be divided into a non-worn area (U, ICRS = 0) and a worn area (D, ICRS = 1 - 4), and they were collected separately according to the non-worn area and the worn area.
[0028] Surface articular cartilage was cut into 1 mm 3 pieces according to the intact area and the worn area. First, it was washed twice with PBS, then digested with protease (4 mg / mL, Roche, Inc) in a 37°C constant temperature incubator for 2 h, and then washed twice with PBS and digested with collagenase P (0.25 mg / L, Roche, Inc) in a 37°C constant temperature incubator for 12 - 14 h. After digestion and centrifugation, chondrocytes from the non-worn area and worn area of OA were obtained and seeded into 75 cm 2 flasks. When the density reached about 80%, they were passaged and seeded into 6-well plates, with about 2×10 6 -4×10 6 cells per well, and the medium was changed every 3 days.
[0029] 2. Determine sdRNA-D43 by high-throughput sequencing
[0030] Total RNA in normal chondrocytes (NA chondrocytes) and OA chondrocytes was extracted using a kit (purchased from Qiagen). The expression profiles of sdRNAs in the two groups of cells were obtained by high-throughput sequencing, and the differential sdRNA was identified and named sdRNA-D43. The results are shown in Figure 1 Figure A.
[0031] 3. Validation of the above sequencing results by real-time fluorescence quantitative PCR (RT-qPCR)
[0032] Chondrocytes from the non-worn area and worn area of cartilage from 6 different patient sources were collected respectively. Total RNA was extracted from the tissues of chondrocytes in the non-worn area and worn area, and reverse transcription was carried out. Subsequently, the top five up-regulated sdRNAs in chondrocytes of the worn area by sequencing (sdRNA-D43, sdRNA-D57, sdRNA-D21, sdRNA-D3A, sdRNA-D93 respectively) were verified by RT-qPCR, and the expression of sdRNA-D43 was further verified using knee non-worn area and worn area cartilage specimens from 30 different patients. The results are as Figure 1 shown in B-D.
[0033] Specifically, the reagent components of the reverse transcription reaction system are shown in Table 1. Prepare a new enzyme-free 200 μl EP tube, mix each component with the total RNA, and then place it in an RT-PCR instrument. The reverse transcription reaction is carried out under the following conditions: incubation at 37 °C for 15 min to start amplification, incubation at 85 °C for 5 s to terminate the reaction, and then the product is stored at 4 °C for later use.
[0034] Table 1 Reagent components of the reverse transcription reaction mixture for mRNA
[0035] Reagent components Volume (μL) 5xEVoM-MLV RT Master Mix 4 μL Total RNA 1 μg / RNA concentration ddH2O (RNase / DNase free) Make up the volume with RNA to 16 μL Total volume 20 μL
[0036] Specifically, the RT-qPCR detection uses 2x Green Pro Taq HS Premix II (ROXplus) reagent (purchased from AG Biology) and experiments are carried out according to its instructions. Subsequently, analysis is performed using an ABI Quant Studio TM Real-Time PCR instrument and Quant StudioTM Real-Time PCR software.
[0037] The internal reference primers are as follows:
[0038] hsa_GAPDH F1: 5'-GGAGCGAGATCCCTCCAAAAT-3';
[0039] hsa_GAPDH R1: 5'-GGCTGTTGTCATACTTCTCATGG-3'.
[0040] Statistical analysis is further performed on the gene expression levels obtained by real-time fluorescence quantitative PCR using the ΔΔCT method, and the gene expression levels are shown as 2^(-ΔΔCT).
[0041] 3. Inhibitory effect of knocking down and overexpressing sdRNA-D43 in the process of chondrocyte senescence
[0042] Using sdRNA-D43 inhibitor and overexpression (mimic), qPCR was used to detect the indicators of extracellular senescence and related inflammatory factors after knocking down and overexpressing sdRNA-D43 in chondrocytes. The results are as Figure 2 shown in A, and it was found that sdRNA-D43 has a promoting effect in the process of chondrocyte senescence.
[0043] (1) sdRNA-D43 inhibitor and mimic
[0044] In this experiment, a 3000 transfection kit was used for transfection. According to the ratio in the reagent instruction manual, the following were prepared respectively: ① Solution A: 125 μl Opti-MEM, 5 μl 3000; ② Solution B: 125 μl Opti-MEM, 5 μl 2 μg of sdRNA-D43 inhibitor or sdRNA-D43 mimic to be transfected. Solutions A and B were gently and thoroughly mixed, and after standing at room temperature for 15 min, cell transfection was carried out. Real-time fluorescence quantitative PCR (RT-qPCR) technology was used to detect the indicators related to cartilage degeneration,
[0045] and the specific process was as in step 3 of Example 1. The primers used were as follows:
[0046] Human CDKN2A (F, SEQ ID NO: 2): GGGTTTTCGTGGTTCACATCC;
[0047] Human CDKN2A (R, SEQ ID NO: 3): CTAGACGCTGGCTCCTCAGTA;
[0048] Human CDKN1A (F, SEQ ID NO: 4): CGATGGAACTTCGACTTTGTCA;
[0049] Human CDKN1A (R, SEQ ID NO: 5): GCACAAGGGTACAAGACAGTG;
[0050] Human MMP13 (F, SEQ ID NO: 6): CCAGACTTCACGATGGCATTG;
[0051] Human MMP13 (R, SEQ ID NO: 7) GGCATCTCCTCCATAATTTGGC;
[0052] Human MMP3(F,SEQ ID NO:8): CGGTTCCGCCTGTCTCAAG;
[0053] Human MMP3(R,SEQ ID NO:9) CGCCAAAAGTGCCTGTCTT;
[0054] Human IL-1β(F,SEQ ID NO:10): AGCTACGAATCTCCGACCAC;
[0055] Human IL-1β(R,SEQ ID NO:11): CGTTATCCCATGTGTCGAAGAA;
[0056] Human TNF-α(F,SEQ ID NO:12): CCGGGCAACAATGTCCAAAAG;
[0057] Human TNF-α(R,SEQ ID NO:13): AGGACGACTGTTCAGCACG;
[0058] 4. Detection of cartilage senescence and related inflammatory factor-related indicators using Western Blot technology
[0059] Prepare the gel using a PAGE gel rapid preparation kit (purchased from Ya Mei). The protein loading amount per well in the gel is 25 μg. Electrophoresis is carried out at a constant voltage of 80 V for 30 min, and then the voltage is changed to 120 V for 60 min. Subsequently, transfer the membrane at a constant current of 250 mA for 90 min, and appropriately increase or decrease the transfer time according to the protein molecular weight. Block for 10 min at room temperature using a rapid blocking solution (purchased from Ya Mei). Incubate the primary antibody overnight at 4 °C, wash, and then incubate the corresponding secondary antibody at room temperature for 1 h. The antibodies used are as follows: CDKN2A antibody, CDKN1A antibody, mmp13 antibody, mmp3 antibody, GAPDH antibody, LC3B antibody, p62 antibody, TNF-a, IL-1B (all antibodies are purchased from Proteintech). Prepare the enhanced chemiluminescence (ECL) luminescent solution (purchased from Merck millipore) and use an imager (ChemiDoc Touch, BIO-RAD) to obtain the band images, and perform semi-quantitative analysis using image J. The experimental results are as Figure 2 shown in B and C.
[0060] The experimental results show that sdRNA-D43 promotes the senescence of chondrocytes.
[0061] 5. Use animal experiments to verify that sdRNA-D43 can promote articular cartilage degeneration.
[0062] (1) The rat homologous sdRNA-D43 is: rat-sdRNA-D43. According to the sdRNA sequence information, a knockdown adeno-associated virus (AAV, purchased from Hanheng Biotech) was constructed.
[0063] (2) Twenty-four 12-week-old SD rats were selected for the experiment and randomly divided into four groups: saline group, MIA group, DMM + empty vector adeno-associated virus group (vector), and DMM + rat-sdRNA-D43 knockdown adeno-associated virus group (sh-rat-sdRNA-D43). Except for the saline group, all rats were injected with MIA virus at 8 weeks. Subsequently, two weeks later, the empty vector adeno-associated virus was injected into the MIA + vector group, and the sdRNA-D43 knockdown adeno-associated virus was injected into the DMM + sh-rat-sdRNA-D43 group. The injection was continuous for 2 weeks, once every other day, and the rats were sacrificed to collect specimens.
[0064] (3) The specimens were used for micro-CT, HE staining, safranin O-fast green staining, alcian blue staining, and immunohistochemistry (IHC) staining. The experimental results are as Figure 3 shown. It can be seen that after injecting sh-rat-sdRNA-D43 into the rat joint cavity, the degree of arthritis in the joint specimens was lower than that in the control group, and the expression levels of the aging-related indicators p16 and p21 were down-regulated, indicating that sh-sdRNA-D43 can inhibit cartilage aging and promote the synthesis of cartilage matrix. The experimental results are as Figure 3 shown.
[0065] The preferred specific embodiments of the present invention have been described in detail above. It should be understood that those of ordinary skill in the art can make many modifications and variations based on the concept of the present invention without creative efforts. Therefore, all technical solutions that can be obtained by those skilled in the art in the technical field of the present invention through logical analysis, reasoning, or limited experiments based on the concept of the present invention on the basis of the prior art shall fall within the protection scope determined by the claims.
Claims
1. The application of sdRNA-D43 in the preparation of osteoarthritis products, characterized in that, The sequence of sdRNA-D43 is: CACAGATGATGAACTTATTGACGGG, as shown in SEQ ID NO:
1.
2. Use of the sdRNA-D43 according to claim 1 in the preparation of an osteoarthritis product, characterized in that, The product is a kit, and the kit includes detecting the expression level of sdRNA-D43 by RT-qPCR, real-time quantitative PCR, immunoassay, in situ hybridization or microarray detection.
3. Use of the sdRNA-D43 according to claim 2 in the preparation of osteoarthritis products, characterized in that, The kit includes at least a pair of primers specifically amplifying sdRNA-D43.
4. Use of sdRNA-D43 according to claim 2 in the preparation of osteoarthritis products, characterized in that, The kit includes an antibody specifically binding to the sdRNA-D43 protein.
5. Use of the sdRNA-D43 according to claim 1 in the preparation of osteoarthritis products, characterized in that, The product is a drug, and sdRNA-D43 is the active ingredient of the drug.
6. Use of the sdRNA-D43 according to claim 5 in the preparation of an osteoarthritis product, characterized in that, The drug includes plasmids for knocking down or overexpressing sdRNA-D43.
7. An expression vector, comprising sdRNA-D43 according to any one of claims 1-6.
8. A host cell, comprising the expression vector according to claim 7.