SNP (Single Nucleotide Polymorphism) marker for identifying salt tolerance of grass carp and application thereof

By identifying the SNP sites of the NKCC1 gene of grass carp and designing primer groups for PCR amplification and sequencing, the problem of physiological metabolic imbalance in grass carp in a saline-alkali environment is solved, and rapid and accurate screening of salt-tolerant grass carp is achieved, reducing breeding costs and improving breeding efficiency.

CN120272601APending Publication Date: 2025-07-08PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510332248.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

Grass carp physiological metabolic imbalance in saline-alkali environments, traditional freshwater aquaculture models are difficult to promote, and existing molecular marking technologies are difficult to effectively screen individual grass carp with strong salt tolerance.

Method used

By identifying the SNP sites of the NKCC1 gene of grass carp, a specific primer set was designed for PCR amplification and sequencing, and combining a single-base extension reaction, the salt tolerance of grass carp was quickly and accurately identified.

Benefits of technology

It has achieved the selection of grass carp parents with excellent salt tolerance under the same breeding conditions, reducing breeding costs, improving breeding efficiency, and increasing the economic benefits of saline-alkali environmental breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_4
    Figure SMS_4
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, discloses an SNP (Single Nucleotide Polymorphism) marker for identifying salt tolerance of grass carp and application of the SNP marker, and particularly discloses a molecular marker related to salt tolerance of grass carp, which is characterized in that the sequence of the SNP molecular marker is shown as SEQ ID NO: 1, the SNP site is positioned at the 3503rd site from the 5'terminal of the sequence shown as SEQ ID NO: 1, and the polymorphism is T / C. The invention provides the SNP marker of the grass carp, by detecting the SNP marker, grass carp parents with excellent salt tolerance can be effectively selected under the same culture condition, and the SNP marker can be effectively used for molecular marker-assisted breeding of the grass carp. The grass carp parents can be subjected to genotype identification according to actual breeding requirements, the grass carp parents with proper genotypes are selected for breeding, grass carp offspring (fry) with high salt tolerance can be obtained, breeding time is saved, cost is low, accuracy is high, and the breeding process of the grass carp is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and particularly relates to an SNP marker for identifying the salt tolerance ability of grass carp and its application. Background Art

[0002] Grass carp (Ctenopharyngodon idellus) is an important freshwater economic fish in China, with advantages such as fast growth, strong adaptability, and high feed conversion efficiency. Its annual output has long ranked first among freshwater cultured fish, exceeding 5.5 million tons in 2022, accounting for more than 20% of the total national freshwater aquaculture output. It is a core species for ensuring the supply of high-quality protein for residents and promoting rural economic development. However, in saline-alkali areas, the soil has high salt content and the water quality is severely alkalized, making it difficult to promote the traditional freshwater aquaculture model. As a typical freshwater fish, the physiological and metabolic mechanisms of grass carp are highly sensitive to the saline-alkali environment. Long-term exposure to high-salt (salinity > 5‰) or high-pH water bodies will lead to osmotic imbalance, growth inhibition, and even death, severely limiting the effective utilization of saline-alkali land resources.

[0003] To break through this bottleneck, molecular marker-assisted breeding technology has become a key research direction. Currently, commonly used molecular markers include single nucleotide polymorphism (SNP), simple sequence repeat (SSR), and insertion-deletion (Indel). Among them, SNP markers have become the preferred tool for analyzing the genetic mechanisms of complex traits due to their advantages such as high distribution density, large detection throughput, high degree of genotyping automation, and low cost. Through genome-wide association analysis (GWAS) or selective sweep analysis, SNP loci related to salt tolerance can be accurately screened, such as functional variations that regulate ion transport proteins (such as Na + / K + -ATPase) or osmotic regulation genes (such as AQP3). Based on the genotype selection technology of SNP markers, salt-tolerant candidate individuals can be quickly identified, and combined with family selection or genomic selection (GS) strategies, salt-tolerant advantageous alleles can be directionally polymerized to breed new salt-tolerant grass carp varieties. Summary of the Invention

[0004] The present invention obtains SNP molecular markers related to the salt tolerance performance of grass carp by using molecular genetics and molecular biology methods. The SNP molecular markers can quickly distinguish the salt tolerance ability of grass carp with high accuracy, providing a reliable basis for the breeding and improvement of new salt-tolerant grass carp varieties.

[0005] The first object of the present invention is to provide SNP molecular markers related to the salt tolerance performance of grass carp.

[0006] The second object of the present invention is to provide a primer set for amplifying the SNP molecular markers of the first aspect of the present invention.

[0007] The objective of the third aspect of the present invention is to provide a kit.

[0008] The objective of the fourth aspect of the present invention is to provide the application of the SNP molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention, and / or the kit of the third aspect of the present invention.

[0009] The objective of the fifth aspect of the present invention is to provide a method for screening salt-tolerant grass carp.

[0010] The objective of the sixth aspect of the present invention is to provide the application of the method of the fifth aspect of the present invention in breeding salt-tolerant grass carp.

[0011] In order to achieve the above objectives, the technical solutions adopted by the present invention are as follows:

[0012] The first aspect of the present invention provides a molecular marker related to the salt tolerance performance of grass carp. The sequence of the SNP molecular marker is as shown in SEQ ID NO:1. The SNP locus is located at the 3503rd position from the 5' end of the sequence shown in SEQ ID NO:1, and its polymorphism is T / C.

[0013] In some embodiments of the present invention, when the genotype of the SNP locus is CT, it is grass carp with strong salt tolerance ability; when the genotype of the SNP locus is CC, it is grass carp with weak salt tolerance ability.

[0014] The second aspect of the present invention provides a primer set for amplifying the SNP molecular marker of the first aspect of the present invention.

[0015] In some embodiments of the present invention, the primer set is primer set 1 or primer set 2.

[0016] Among them, the nucleotide sequence of the primer set 1 is as follows:

[0017] P1: 5'-AAACAAACTGGCTCCCAGAG-3' (SEQ ID NO:2);

[0018] P2: 5'-GGAACTAGTGGAAGTGGTTG-3' (SEQ ID NO:3);

[0019] The nucleotide sequence of the primer set 2 is as follows

[0020] P3: 5'-GCCAACCTTGTGTGTTTGTC-3' (SEQ ID NO:4);

[0021] P4: 5'-TTGTCACACGCTGTGCTTTG-3' (SEQ ID NO:5);

[0022] P5: 5’-ctgactgactCATCTTCTCTCAGTTTATATG-3’ (SEQ ID NO:6).

[0023] The third aspect of the present invention provides a kit comprising the primer set of the second aspect of the present invention.

[0024] In some embodiments of the present invention, the kit further comprises a buffer used in PCR.

[0025] In some embodiments of the present invention, the buffer used in PCR is any reagent required for PCR amplification, such as DNA polymerase, dNTP, taq enzyme, MgCl2, etc.

[0026] In some embodiments of the present invention, the kit further comprises SAP, ExoI and reagents for single-base extension reaction (such as SNaPshot Mix).

[0027] The fourth aspect of the present invention provides the application of the SNP molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention and / or the kit of the third aspect of the present invention in any one of (1) to (5):

[0028] (1) Auxiliary selection or breeding of salt-tolerant grass carp;

[0029] (2) Preparation of products for auxiliary selection or breeding of salt-tolerant grass carp;

[0030] (3) Identification of the salt tolerance of grass carp;

[0031] (4) Preparation of products for identifying the salt tolerance of grass carp;

[0032] (5) Management, development and utilization of grass carp germplasm resources.

[0033] In some embodiments of the present invention, the selection is to screen grass carp with excellent salt tolerance.

[0034] The fifth aspect of the present invention provides a method for screening salt-tolerant grass carp, by detecting the genotype of the SNP molecular marker of the first aspect of the present invention in the genome of the grass carp to be tested, and determining the salt tolerance of the grass carp to be tested according to the genotype.

[0035] In some embodiments of the present invention, the method comprises the following steps: using the DNA of the grass carp to be tested as a template, performing PCR amplification with the primer set 1 of the second aspect of the present invention or the kit of the third aspect of the present invention to obtain a PCR amplification product; performing sequencing analysis on the PCR amplification product to determine the gene of the SNP molecular marker of the first aspect of the present invention in the genome of the grass carp to be tested; or

[0036] The method includes the following steps: using the grass carp DNA to be tested as a template, performing PCR amplification with P3 and P4 in the second aspect of the present invention to obtain a PCR amplification product;

[0037] Performing alkaline phosphatase treatment on the PCR amplification product to obtain product A;

[0038] Performing single-base extension reaction on product A with P5, and after the reaction is completed, performing sequencing analysis to determine the gene of the SNP molecular marker in the first aspect of the present invention in the genome of the grass carp to be tested.

[0039] In some embodiments of the present invention, the DNA of the grass carp can be obtained by using conventional means in the technical field, including the phenol-chloroform method and various DNA extraction kits.

[0040] In some embodiments of the present invention, the reaction program of PCR amplification is pre-denaturation at 90-94°C for 3-6 min; denaturation at 90-94°C for 20-35 s, annealing at 56-60°C for 30-35 s, extension at 70-72°C for 20-30 s, for 35-37 cycles; extension at 70-72°C for 3-12 min.

[0041] In some embodiments of the present invention, the alkaline phosphatase treatment includes mixing the PCR amplification product with SAP Mix and reacting in a PCR instrument, and the reaction program is 35-37°C for 35-40 min; 80-85°C for 12-16 min; 4°C ∞.

[0042] In some embodiments of the present invention, the single-base extension reaction includes the following steps: mixing product A, P5 and SNaPshot Mix and reacting in a PCR instrument, and the reaction program is pre-denaturation at 94-96°C for 25-30 s; denaturation at 94-96°C for 2-5 s, annealing at 50-52°C for 3-5 s, extension at 60-62°C for 2-3 min, for 35-37 cycles; extension at 70-72°C for 3-5 min; 15-17°C for 1-2 min.

[0043] In some embodiments of the present invention, the method for sequencing the PCR amplification product is not particularly limited, as long as the sequence of the fragment where the PCR amplification product, i.e., the SNP marker, is located can be effectively obtained. It can be detected by using at least one selected from the first-generation gene sequencing, the second-generation high-throughput gene sequencing, the third-generation high-throughput gene sequencing or any other feasible method for determining its genotype for the above-mentioned PCR amplification product. Thus, the genotype result can be obtained quickly, efficiently and accurately.

[0044] The sixth aspect of the present invention provides the application of the method in the fifth aspect of the present invention in breeding salt-tolerant grass carp.

[0045] The beneficial effects of the present invention are:

[0046] The present invention provides an SNP marker for grass carp. By detecting this SNP marker, it is possible to effectively select excellent salt-tolerant grass carp parents under the same breeding conditions, which can be effectively used for molecular marker-assisted breeding of grass carp. Furthermore, it is possible to identify the genotypes of grass carp parents according to actual breeding requirements, select appropriate genotype grass carp parents for breeding, and obtain grass carp offspring (fingerlings) with high salt tolerance performance, saving breeding time, having low cost, high accuracy, accelerating the breeding process of grass carp, and increasing the economic benefits of grass carp farming in saline-alkali environments.

[0047] Using high-salt conditions to select excellent salt-tolerant grass carp may cause irreversible lifelong damage to grass carp and reduce its reproductive performance. The present invention can directly select excellent salt-tolerant grass carp parents through SNP molecular markers, greatly reducing the cultivation cost of new salt-tolerant grass carp varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 It is the expression levels of the NKCC1 gene in the gills of grass carp in the control group, sensitive group, and tolerant group. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0049] The following further describes the content of the present invention in detail through specific embodiments.

[0050] It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0051] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0052] The following further describes the features and performance of the present invention in detail in combination with the embodiments.

[0053] Example 1 Obtaining the major salt-tolerant gene (NKCC1 gene) of grass carp and screening candidate SNPs

[0054] (I) Determination of candidate genes

[0055] (1) Obtaining experimental materials of salt-tolerant grass carp population and sensitive grass carp population

[0056] Select 1,200 fast-growing grass carps (average weight 10 g) cultivated by the Pearl River Fisheries Research Institute as experimental fish. Use two aquariums as containers, denoted as the control group and the experimental group respectively. Before the experiment, transfer the experimental fish to the aquariums to acclimatize for 12 hours. Put 600 grass carps in each aquarium, and do not feed any feed during this period. After the acclimatization period, start to adjust the salinity of the experimental group to 12 ppt at a rate of 3 ppt every two hours. After the salinity reaches 12 ppt, observe once every four hours, promptly fish out the dead fish, record the cumulative survival time, collect the caudal fins, soak them in absolute ethanol, and store them at 4 °C for future use. The earliest 150 dead and the last 150 dead experimental fish are respectively regarded as the salt-sensitive group and the salt-tolerant group. At the same time, during the sample collection period, collect the gill tissues of the control group, the salt-sensitive group (dying fish) and the tolerant group (the fish that survived until the end and were in good condition) and store them at -80 °C.

[0057] (2) Obtaining of the NKCC1 candidate gene

[0058] Design primers for the NKCC1 gene (F: AAGCTGCTGCCATGTTGAAA (SEQ ID NO:7); R: CCGGCTGAGTACTGAGAGTT (SEQ ID NO:8)), and obtain the expression levels of the NKCC1 gene in the gills of grass carps in the control group, the sensitive group and the salt-tolerant group.

[0059] The results show that the expression level of the NKCC1 gene in the tolerant group is 1.93 times that of the sensitive group, and the NKCC1 gene is determined as an important candidate gene ( Figure 1 ).

[0060] (2) Obtaining of candidate SNP molecular markers related to grass carp salt tolerance

[0061] Twenty grass carp caudal fins (10 salt-tolerant grass carp and 10 non-salt-tolerant grass carp) were randomly selected as experimental materials, and genomic DNA of fin rays was extracted using a Marine Animal Tissue Genomic DNA Extraction Kit (Tiangen). The quality of genomic DNA was detected by 1.0% agarose gel electrophoresis, and the concentration was detected using an ultraviolet spectrophotometer (Eppendorf, model AG2231), and stored at -20 °C for later use. According to the annotation of the NKCC1 gene, the sequence covering the NKCC1 gene transcript (SEQ ID NO:1) was extracted as a template to design primers (P1: 5’TTCACCATTAATTGCTTTTTG-3’ (SEQ ID NO:2); P2: 5’-ACAGTAATCCAGATTGTTAGTGG-3’ (SEQ ID NO:3)), and PCR amplification was performed on 20 grass carp. Among them, the reaction system for PCR amplification was: 1 μL of DNA, 20 μL of Mix, 1.5 μL of P1 primer, 1.5 μL of P2 primer, and made up to 40 μL with H2O. The PCR amplification reaction procedure was: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, for 35 cycles; extension at 72 °C for 10 min. The amplified product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the SNP sites and their peak maps of the sequencing results were counted.

[0062] The results showed that there was a SNP at the 3503rd base of the nucleotide sequence (SEQ ID NO:1) of the grass carp NKCC1 gene transcript. This SNP had three genotypes, namely TT, TC, and CC. Among them, the proportion of the CC genotype in 20 grass carp was 30%, the proportion of the TC genotype was 60%, and the proportion of the TT genotype was 10%. All the genotypes of salt-tolerant grass carp were TC. Among the non-salt-tolerant grass carp, 6 had the CC genotype, 2 had the TT genotype, and 2 had the TC genotype.

[0063]

[0064] Example 2 Development of SNP Markers for Identifying the Salt Tolerance Ability of Grass Carp

[0065] Analyze the SNP loci and salt tolerance ability in Example 1 by the SNaPshot method, including the following steps:

[0066] (I) Primer Sequences

[0067] Design SNaPshot extension primers according to the partial genomic sequence SEQ ID NO:1 of the grass carp NKCC1 gene. The primer sequences are as follows:

[0068] P3: 5’-GCCAACCTTGTGTGTTTGTC-3’ (SEQ ID NO:4);

[0069] P4: 5’-TTGTCACACGCTGTGCTTTG-3’ (SEQ ID NO:5);

[0070] P5: 5’-ctgactgactCATCTTCTCTCAGTTTATATG-3’ (SEQ ID NO:6).

[0071] (II) Cut the tail fin of the test fish to extract genomic DNA

[0072] Use scissors sterilized with alcohol to cut about 0.5×0.5 cm of the tail fin of the grass carp and put it into absolute ethanol for storage at room temperature. Extract the genomic DNA of the fin rays by using a marine animal tissue genomic DNA extraction kit (Tiangen). Detect the quality of the genomic DNA by 1.0% agarose gel electrophoresis, detect the concentration by using an ultraviolet spectrophotometer (Eppendorf, AG2231 type), and store it at -20°C for standby.

[0073] (III) Genotyping Experiment

[0074] (1) PCR Amplification Reaction

[0075] 1) Prepare the PCR master mix in a 1.5 mL EP tube and shake it gently and centrifuge it at low speed.

[0076] 2) Select an 8-channel pipette and add 9 μL of the PCR master mix to each well of the 384-well plate. Finally, add 1 μL of the template DNA (20 ng / μL), mix well, carefully cover the 384-well sealing film, and press firmly on each well to prevent evaporation and other phenomena during the PCR program. Centrifuge at 1000 rpm for 1 min. The PCR reaction system is shown in Table 1.

[0077] Table 1 PCR Reaction System

[0078]

[0079] 3) Set up the PCR amplification reaction program, place the PCR reaction plate on the PCR instrument, start the program, and the reaction program is shown in Table 2.

[0080] Table 2 PCR reaction program

[0081]

[0082]

[0083] (2) Treatment of the product with alkaline phosphatase

[0084] After the PCR reaction is completed, treat the PCR product with SAP (shrimp alkaline phosphatase, catalog number 783901000UN) to remove free dNTPs in the system. The specific steps are as follows:

[0085] Prepare the alkaline phosphatase treatment reaction solution (i.e., SAP mix) in a new 1.5 mL EP tube. The reaction components of SAP mix are shown in Table 3. Add SAP mix to the 384-well PCR reaction plate. For each well of the alkaline phosphatase treatment reaction, the total reaction volume is 6 μL, among which, 4 μL of PCR product and 2 μL of SAP mix. After pipetting is completed, carefully cover the 384-well sealing film and press firmly on each well to prevent evaporation and other phenomena during the PCR program. After centrifugation, place it in the PCR instrument. Set the SAP reaction program: 37°C for 40 min; 85°C for 15 min; 4°C ∞. Start the program

[0086] Table 3 SAP Mix

[0087]

[0088] (3) Single-base extension reaction

[0089] After the alkaline phosphatase treatment is completed, perform the single-base extension reaction. The total volume of the reaction system is 5 μL, and the reaction system is prepared according to Table 4. After pipetting is completed, carefully cover the 384-well sealing film and press firmly on each well to prevent evaporation and other phenomena during the PCR program. After centrifugation, place it in the PCR instrument for the reaction program shown in Table 4.

[0090] Table 4 Single-base extension reaction system and reaction program

[0091]

[0092] (4) Sequencing

[0093] Take 2 μL of the SNaPshot reaction product and add it to 8 μL of deionized formamide containing 0.8% LIZ120. Denature at 95 °C for 5 min, then quickly cool at -20 °C, and then perform sequencing on the 3730xL.

[0094] (5) Genotype reading

[0095] Export the raw data in.fsa format from the 3730xL instrument. After classifying and archiving according to the detection reaction, import them into the GeneMarker analysis software respectively for genotype data reading.

[0096] (IV) Result analysis

[0097] In this example, a total of 100 salt-tolerant grass carps and 100 sensitive grass carps (the salt-tolerant grass carp population and the sensitive grass carp population were obtained by the method of Example 1) were collected for genotyping. The SNaPshot SNP genotyping results were consistent with the sequencing results of the PCR products (i.e., PCR amplification of grass carp DNA using primers P1 - P2). Among the tolerant population, a total of 76 grass carps had the genotype CT, and among the sensitive population, only 20 grass carps had the genotype CT (Table 5). This indicates that the SNP locus at position 3503 of the genomic sequence SEQ ID NO:1 of the NKCC1 gene can provide a reliable basis for the identification of salt-tolerant grass carps. When the sample size is small, identification can be directly carried out by PCR product sequencing, which is fast and accurate; when the sample size is large, the SNaPshot method can be used to identify grass carps, which has a lower cost and is suitable for popularization.

[0098] Table 5 SNaPshot SNP genotyping results

[0099]

[0100] Example 3 Selection of salt-tolerant grass carps

[0101] Since the experimental grass carps are too small in size, intraperitoneal injection of electronic tags will seriously reduce the survival rate and affect the experimental results. Therefore, in this example, the chi-square test was used to detect the gene frequencies of tolerant and intolerant grass carps to determine its accuracy. The specific experiment is as follows:

[0102] I. Random grass carp population salt tolerance experiment

[0103] Randomly select 500 fast-growing grass carps cultivated by this unit for salt tolerance experiment. The specific experimental plan is as shown in Example 1. Briefly, the experimental grass carps are raised in an aquarium with a salinity of 12 ppt for 5 days (120 hours). The grass carps that die within the first 12 hours are considered to have poor salt tolerance, and the fish that still survive after 120 hours are considered to have strong salt tolerance.

[0104] II. Genotyping

[0105] The collected grass carp samples were genotyped using primers P1 and P2, and the genotyping method referred to Example 1.

[0106] III. Result analysis

[0107] At the end of the experiment, 30 tolerant and 30 intolerant grass carps were genotyped. The results are shown in Table 6. The chi-square test showed that X-squared = 24.137 and p-value = 5.736e-06, indicating that this SNP has practical application value.

[0108] Table 6 SNP verification results of the random population

[0109]

[0110] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments. Various changes can be made without departing from the spirit of the present invention within the scope of knowledge possessed by those of ordinary skill in the relevant art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Molecular markers related to the salt tolerance performance of grass carp, characterized in that, The sequence of the SNP molecular marker is shown as SEQ ID NO:

1. The SNP locus is located at the 3503rd position from the 5'-end of the sequence shown in SEQ ID NO: 1, and its polymorphism is T / C.

2. The SNP molecular marker according to claim 1, wherein When the genotype of the SNP locus is CT, it is a grass carp with strong salt tolerance. When the genotype of the SNP locus is CC, it is a grass carp with weak salt tolerance.

3. A primer set for amplifying the SNP molecular marker according to claim 1 or 2.

4. The primer set according to claim 3, characterized in that, The primer set is primer set 1 or primer set 2. Among them, the nucleotide sequence of the primer set 1 is shown as follows: P1: 5'-AAACAAACTGGCTCCCAGAG-3'; P2: 5'-GGAACTAGTGGAAGTGGTTG-3'; The nucleotide sequence of the primer set 2 is shown as follows: P3: 5'-GCCAACCTTGTGTGTTTGTC-3'; P4: 5'-TTGTCACACGCTGTGCTTTG-3'; P5: 5'-ctgactgactCATCTTCTCTCAGTTTATATG-3'.

5. A kit, comprising the primer set according to claim 3 or 4.

6. The application of the SNP molecular marker according to claim 1 or 2, the primer set according to claim 3 or 4, and / or the kit according to claim 5 in any one of (1) to (5): (1) The assistant selection or breeding of salt-tolerant grass carp; (2) Preparing products for the assistant selection or breeding of salt-tolerant grass carp; (3) Identifying the salt tolerance of grass carp; (4) Preparing products for identifying the salt tolerance of grass carp; (5) The management, development and utilization of grass carp germplasm resources.

7. A method for screening salt-tolerant grass carp, by detecting the genotype of the SNP molecular marker according to claim 1 or 2 in the genome of the grass carp to be tested, and determining the salt tolerance of the grass carp to be tested according to the genotype.

8. The method according to claim 7, wherein The method includes the following steps: using the DNA of the grass carp to be tested as a template, performing PCR amplification with the primer set 1 described in claim 4 or the kit described in claim 5 to obtain a PCR amplification product; performing sequencing analysis on the PCR amplification product to determine the gene of the SNP molecular marker according to claim 1 or 2 in the genome of the grass carp to be tested; or; The method includes the following steps: using the DNA of the grass carp to be tested as a template, performing PCR amplification with P3 and P4 described in claim 4 to obtain a PCR amplification product; Performing alkaline phosphatase treatment on the PCR amplification product to obtain product A; Performing a single-base extension reaction on product A with P5. After the reaction is completed, performing sequencing analysis to determine the gene of the SNP molecular marker according to claim 1 or 2 in the genome of the grass carp to be tested.

9. The method according to claim 8, characterized in that, When the genotype of the SNP molecular marker is CT, it is a grass carp with strong salt tolerance. When the genotype of the SNP molecular marker is CC, it is a grass carp with weak salt tolerance.

10. The application of the method according to claim 8 or 9 in the breeding of salt-tolerant grass carp.

Citation Information

Patent Citations

  • DNA (deoxyribonucleic acid) bar code primer pair, kit and method for identifying species of shark fins

    CN111118171A

  • Primer, probe and method for detecting tilapia lake virus through reverse transcription microdroplet type digital PCR (polymerase chain reaction)

    CN116064941A

  • Molecular marker related to salinity tolerance character of grass carp, amplification primer of molecular marker and application of molecular marker in salt-tolerant breeding of grass carp

    CN119351569A

  • Molecular marker related to salt-tolerant and rapid growth traits of grass carp and application of molecular marker

    CN119464513A