Primer probe group and kit for detecting J and K subgroup avian leukosis viruses and application
By designing a highly specific primer probe set and an optimized detection process, the long process, high cost and false positive false negatives of ALV-J and ALV-K detection in the prior art are solved, and fast and simple detection of avian leukemia virus is achieved.
Patent Information
- Application Number
- CN202510442967.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-10
- Publication Date
- 2025-07-08
AI Technical Summary
In the prior art, when detecting avian leukemia viruses ALV-J and ALV-K, there is a problem that the detection process is long, the cost is high, the false positives and false negatives are prone to occur, and it is difficult to distinguish endogenous and exogenous ALV.
A highly specific primer probe set was designed, combining self-developed preservation solution and RT direct expansion Mix, and optimized the detection process, using internal reference gene quality control, and achieving rapid and simple detection through multiple PCR.
It realizes high sensitivity, low cost and fast ALV-J and ALV-K detection, reduces false negatives and false positives, is suitable for batch sample testing, and simplifies the operation process.
Smart Images

Figure CN120272648A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of avian leukosis virus detection, and particularly relates to a primer-probe set, a kit and an application for detecting subgroup J and K avian leukosis viruses. Background Art
[0002] Avian leukosis virus (ALV) belongs to the members of the genus Alpharetrovirus in the family Retroviridae. Infecting poultry can cause a variety of neoplastic diseases, which is extremely harmful to the poultry industry. ALV is divided into exogenous virus and endogenous virus. Among them, exogenous ALV includes subgroups A, B, C, D, J, and K. Among endogenous ALV, subgroup E is the one with chicken as the host. Subgroup E usually has no pathogenicity, but it will interfere with the differential diagnosis of avian leukosis. ALV-J and ALV-K are the main subgroups prevalent in chicken flocks in China in recent years. Among them, ALV-J has strong pathogenicity, while most ALV-K has weak pathogenicity and is easy to escape conventional detection.
[0003] Avian leukosis is a vertically transmitted disease. The most effective measure to control avian leukosis is to purify the source of the chicken flock and establish a core breeding flock of breeding chickens free from exogenous ALV infection. The main means is to regularly detect exogenous ALV in the core breeding flock of breeding chickens and promptly eliminate positive chickens to purify and eliminate exogenous ALV in the chicken flock. Therefore, an efficient, rapid and convenient detection method is beneficial to controlling the transmission of ALV. The main detection and identification methods of ALV at home and abroad include virus isolation, ELISA, indirect immunofluorescence test, PCR, etc. The virus isolation method is the most reliable, but the detection cycle is long, and it needs to cooperate with other methods to identify subgroups. The ELISA detection method is the most widely used clinically in China and is relatively simple to operate, but it cannot distinguish between endogenous and exogenous ALV. The PCR detection method can exclude the interference of endogenous ALV by designing specific primers for exogenous ALV. The traditional PCR method needs to perform gel electrophoresis analysis on the products after amplification, and the operation is relatively cumbersome. Due to aerosol contamination, false positives often occur. Compared with the traditional PCR method, the fluorescence PCR method does not need to open the lid to analyze the products, and the sensitivity and specificity are further enhanced.
[0004] For example, Dou, J et al. developed a multiplex qPCR method capable of simultaneously detecting ALV-A / B / J / K. This method only produces positive signals for ALV-A / B / J / K subgroups and has no cross-reaction with other avian pathogens. The detection limits are 40 copies / µL for ALV-A, 11 copies / µL for ALV-B, 13.7 copies / µL for ALV-J, and 96 copies / µL for ALV-K (Dou, J. Viruses 2023.); Another example is the prior art CN117821668A, which provides a fluorescence quantitative PCR primer-probe combination and its kit for detecting exogenous avian leukosis virus, capable of more sensitively detecting exogenous avian leukosis virus A / B / J by fluorescence PCR, with a detection limit reaching 50 copies / μL. Although the above methods have successfully improved the detection sensitivity, they all require nucleic acid extraction before detection, resulting in a long detection process and high costs, and still need further optimization. Summary of the Invention
[0005] To solve the above problems, the present invention provides a primer-probe set, a kit, and an application for detecting avian leukosis virus subgroups J and K.
[0006] On the one hand, the present invention provides a primer-probe set for detecting avian leukosis virus subgroups J and K, and the primer-probe set includes: The first primer-probe set: primers with sequences as shown in SEQ ID NO.1-2 and a probe with a sequence as shown in SEQ ID NO.3; The second primer-probe set: primers with sequences as shown in SEQ ID NO.4-5 and probes with sequences as shown in SEQ ID NO.6-7.
[0007] SEQ ID NO.1: GGGCCTCCCTGAGACCGG; SEQ ID NO.2: GTTCGCAGTAAAACTGAACGGCT; SEQ ID NO.3: TGCACAMGCACAGGA; SEQ ID NO.4: GACCCGGAGAAGACACCCTTG; SEQ ID NO.5: GTCTTATTTGCCCAGGTGACCCAC; SEQ ID NO.6: CATCTGWTGCRACAACCAGGAAACGT; SEQ ID NO.7: TCCCCCCACCCC.
[0008] Specifically, the primer-probe set further includes a third primer-probe set for detecting a reference gene, and the reference gene is GAPDH.
[0009] More specifically, the third primer-probe set includes: primers with sequences shown in SEQ ID NO.8-9 and a probe with a sequence shown in SEQ ID NO.10.
[0010] SEQ ID NO.8: ATGCCATCACAGCCACACAGA; SEQ ID NO.9: GACGCTGGGATGATGTTCTGG; SEQ ID NO.10: ATGGCCCCTCTGGGAAGCTGTGG.
[0011] Preferably, the probe is labeled with a fluorescent group and a quenching group.
[0012] More preferably, the fluorescent group includes at least one of FAM, ROX, VIC or CY5 fluorescent groups, and the fluorescent groups of the probes in the first primer-probe set and the probes in the second primer-probe set are different from each other; the quenching group includes at least one of MGB, BHQ1, BHQ2 or TAMRA, and the quenching groups of the probes in the first primer-probe set and the probes in the second primer-probe set are different from each other.
[0013] On the other hand, the present invention provides an application of the above primer-probe set in the preparation of a kit for detecting subgroup J and K avian leukosis virus.
[0014] On the other hand, the present invention provides an application of the above PCR primer-probe set in the preparation of a PCR kit for detecting subgroup J and K avian leukosis virus.
[0015] On the other hand, the present invention provides a PCR kit for detecting subgroup J and K avian leukosis virus.
[0016] Specifically, the kit includes any one of the above primer-probe sets.
[0017] More specifically, the kit further includes: self-developed preservation solution, self-developed RT direct amplification Mix.
[0018] Preferably, the self-developed preservation solution includes the following components: 0.02-0.08% Tween 20, 0.01-0.05 mM guanidine hydrochloride, 0.2-0.6 μg tRNA, 5-15 mM Tris-HCl, 0.15-0.35 mM EDTA.
[0019] Preferably, the self-developed RT direct amplification Mix comprises the following components: 100 - 200 mM Tris-HCl, 0.1 - 0.5 mM dNTPs, 300 - 400 mM KCl, 15 - 20 mM MgCl2, 10 - 20 mg / mL BSA, 0.1 - 0.5% Glycerol, 1.5 - 3.5% Trehalose, 0.3 - 0.8 U / μL hot-start Taq enzyme, 0.3 - 0.9 U / μL reverse transcriptase.
[0020] Preferably, the positive control contains at least one of the amplified fragments of ALV-J, ALV-K, and / or chicken GAPDH gene.
[0021] In another aspect, the present invention provides the use of the above primer-probe set and / or kit in detecting subgroup J and K avian leukosis viruses.
[0022] In yet another aspect, the present invention provides a method for detecting subgroup J and K avian leukosis viruses.
[0023] Specifically, the method comprises the following steps: (1) Collect samples, perform pretreatment to obtain samples to be tested; (2) Configure a reaction system and perform an amplification reaction; (3) Result judgment.
[0024] More specifically, in step (1), the samples include: egg white, feces, plasma, and cell culture medium.
[0025] More specifically, in step (1), the pretreatment method is: mix the samples with the self-developed preservation solution at a ratio of 1:2 - 20.
[0026] More specifically, in step (2), the reaction system includes: 5 - 10 μL of the sample to be tested, a primer-probe set with a final concentration of 0.2 μM, and 5 - 10 μL of the self-developed RT direct amplification Mix.
[0027] More specifically, in step (2), the conditions for the amplification reaction are: 50°C for 3 min; 95°C for 1 min; 95°C for 2 s, 56°C for 15 s, for 42 cycles.
[0028] Compared with the prior art, the present invention has the following advantages: (1) The J-type and K-type PCR primer sets designed by the present invention can minimize the possibility of missed detection to the greatest extent: on the one hand, the inventor fully utilizes the published ALV sequences of various types on GenBank, and on the other hand, through Sanger sequencing, two new mutation sites are discovered. Combining the sequence information from these two aspects, PCR primer sets are designed in the specific conserved regions of the J-type and K-type respectively. Among them, the J-type contains two different probes, and the K-type contains degenerate probes, which can avoid false negatives caused by primer set off-target to the greatest extent.
[0029] (2) This kit adopts an endogenous internal standard quality control system, which can monitor the collection, transportation, and detection processes of the samples to be tested, and can better avoid false negatives in the detection results.
[0030] (3) The kit of the present invention contains reagents for the entire process from sample collection to sample detection. Through a large number of optimization experiments, a preservation solution formula suitable for direct amplification of samples and amplification reagents with strong stress resistance are screened out. It has the advantages of simple operation, fast detection speed, strong specificity, high sensitivity, etc., can save time, manpower, and material costs, and is suitable for the detection of batch samples. Description of the Drawings
[0031] Figure 1 It is a partial result of Sanger sequencing of avian leukosis virus. The mutation sites indicated by the red arrows in the figure are first discovered by the present invention, and the mutation sites indicated by the black arrows are recorded in the database.
[0032] Figure 2 It is the verification result of the primer-probe sets for J and K subgroups of avian leukosis virus. 1 is 30,000 copies; 2 is 3,000 copies; 3 is 300 copies; 4 is 30 copies; 5 is 3 copies.
[0033] Figure 3 It is the comparison of the detection effects at different dilution ratios of egg white and preservation solution. 1 is diluted at a ratio of 1:10; 2 is diluted at a ratio of 1:20; 3 is diluted at a ratio of 1:4; 4 is diluted at a ratio of 1:2.
[0034] Figure 4 It is the comparison of the amplification results between the self-developed direct amplification mix and the comparative mix.
[0035] Figure 5 It is the detection result of the 500-copy / mL plasmid of J and K subgroups of avian leukosis virus.
[0036] Figure 6Results of sensitivity assessment for subgroup J and K avian leukosis viruses. A: Detection results of 1000 copies / mL plasmid in 5% egg white stock matrix; B: Detection results of 1000 copies / mL plasmid in 25% anal swab stock matrix; C: Detection results of 1000 copies / mL plasmid in 10% blood culture stock matrix.
[0037] Figure 7 Results of specificity assessment for subgroup J and K avian leukosis viruses.
[0038] Figure 8 Results of repeatability assessment for subgroup J and K avian leukosis viruses.
[0039] Figure 9 Results of accuracy assessment for subgroup J and K avian leukosis viruses.
[0040] Figure 10 Results of verification for the comparative primer set of subgroup J and K avian leukosis viruses. 1: 30,000 copies; 2: 3000 copies; 3: 300 copies; 4: 30 copies; 5: 3 copies.
[0041] Figure 11 Amplification results of using the comparative preservation solution to detect egg white samples. Specific implementation manners
[0042] The following further elaborates the present invention in combination with specific embodiments. The following embodiments are not used to limit the present invention, but only to illustrate the present invention. The experimental methods used in the following embodiments are conventional conditions if not otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels if not otherwise specified.
[0043] Example 1 Establishment of kit and method 1. Sequence analysis and primer design Download the full-length sequences of exogenous ALV-A, ALV-B, ALV-C, ALV-D, ALV-J, ALV-K and endogenous ALK-E published in GenBank, and use MEGA software for alignment analysis to roughly determine the primer design target region. Collect 85 ALV-positive samples from different sources such as breeding chicken farms and farms, conduct Sanger sequencing analysis on the target sequence, and obtain the variation of recent ALV epidemic strains. Comprehensively utilize the sequence characteristics of various types of ALV published on GenBank and the sequence variations newly discovered by Sanger sequencing (such as Figure 1As shown in the figure, PCR primer-probe sets were designed in the J-type and K-type specific conservative regions respectively. The J-type contains two different probes, and the K-type contains degenerate probes to maximize the avoidance of false negatives caused by off-target of the primer-probe set. The sequence information of the primers and probes is shown in Table 1.
[0044] Table 1 Information of primers and probes for avian ALV detection
[0045] 2. Primer-probe verification The artificially synthesized single-stranded positive reference templates (positive K-type template and positive J-type template) were serially diluted to 6000 copies / μL, 600 copies / μL, 60 copies / μL, 6 copies / μL, and 0.6 copies / μL; primer-probe verification was carried out in a 20 μL system (containing 5 μL template, final concentration of primer-probe was 0.2 μM, Novoprotein hot start Taq enzyme p132, and made up with ddH2O). The results are shown in Figure 2 As shown in the figure, the amplification effects of K-type and J-type were ideal: the amplification curves showed a typical S shape, and all the above concentration templates could be detected.
[0046] 3. Optimization of the dosage of self-developed preservation solution Egg white and the self-developed preservation solution were mixed at different dilution ratios (volume ratio 1:2, 1:4, 1:10, 1:20), and a low-concentration positive template (single-stranded K-type template with a final concentration of 6 copies / μL) was added to screen out the best preservation solution and dilution ratio. The results are shown in Figure 3 As shown in the figure. 10 μL of template, 5 μL of primer mixture and 5 μL of Novoprotein hot start Taq enzyme P132 were added to a 20 μL reaction system for amplification detection, and the amplification conditions are shown in Table 2. Under this condition, the best dilution ratio of egg white to the preservation solution is 1:10.
[0047] Table 2 PCR detection program for avian leukosis virus of J and K subgroups
[0048] Note: For ALV-K type, FAM channel is selected; for ALV-J type, ROX channel is selected; for internal standard, VIC channel is selected.
[0049] Self-developed preservation solution: 0.05% (v / v) Tween 20, 0.03 mM guanidine hydrochloride, 0.4 μg tRNA (Beijing Solarbio Science & Technology Co., Ltd., 9014-25-9), 10 mM Tris-HCl, 0.25 mM EDTA.
[0050] 4. Screening of direct amplification enzyme mix Multiple RT direct amplification enzyme mixes were tested, including: self-developed RT direct amplification Mix, commercial direct amplification reagents such as Novoprotein, CWBIO, and Zhuhai Baorui. Among them, the optimized self-developed RT direct amplification Mix had the best amplification effect, and the results were as Figure 4 shown. The 20 μL amplification system contained 10 μL of direct amplification enzyme mix, and the final concentration of the primer probe was 0.2 μM. The test sample was a K-type positive anal swab. The PCR amplification program is shown in Table 2.
[0051] Self-developed RT direct amplification Mix: 150 mM Tris-HCl, 0.3 mM dNTPs, 360 mM KCl, 18 mM MgCl2, 15 mg / mL BSA, 0.2% (v / v) Glycerol, 2.5% (v / v) Trehalose, 0.5 U / μL vazyme p122-MD2 enzyme, 0.6 U / μL HiScript II Reverse Transcriptase.
[0052] 5. Assembly of the detection kit for subgroup J and K avian leukosis virus The present invention provides a kit for detecting subgroup J and K avian leukosis virus, which consists of a sample collection tube, a primer tube, an amplification reagent tube, a positive control tube, and a negative control tube.
[0053] Among them, the sample collection tube contains 1 mL of self-developed preservation solution; The primer tube contains a primer mixture, including the primer probe group shown in SEQ ID NO.1 - SEQ ID NO.10, with a concentration of 1 μmol / L; The amplification reagent tube contains self-developed RT direct amplification Mix; The positive control tube contains a plasmid DNA template, and the plasmid DNA contains amplification fragments of ALV-J, ALV-K, and chicken GAPDH genes, with a concentration of 1000 copies / μL.
[0054] The negative control tube contains nuclease-free water.
[0055] 6. Establishment of the detection method for subgroup J and K avian leukosis virus Using the kit provided by the present invention to detect subgroup J and K avian leukosis virus, the method includes the following steps: (1) Preparation method of the test sample 1) Pretreatment of egg white sample: Pipette 100 μL of egg white into the sample collection tube, shake and mix well for 30 s, and the supernatant is the test sample, which is left standing at room temperature for later use.
[0056] 2) Anal swab sample collection and pretreatment: Insert the cotton swab 2 cm into the cloaca, gently rotate 3 times, place the swab head into the sample collection tube, shake and mix for 30 seconds, the supernatant is the sample to be tested, and let it stand at room temperature for later use.
[0057] 3) Blood cell culture medium: dilute 5 times with self-developed preservation solution, and keep the supernatant as the sample to be tested for later use.
[0058] (2) Sample addition and amplification detection Add 5 μL of primer mixture, 5 μL of self-developed RT direct amplification Mix, and 10 μL of the sample to be tested to the PCR reaction tube, mix thoroughly, and then test on the machine, setting negative and positive controls. Perform amplification reaction on the qPCR instrument, and the reaction conditions are the same as those in Table 2.
[0059] (3) Result judgment 1) Quality Control: Negative control: FAM and ROX channels have no typical amplification curves, and VIC channel Ct>36 or no typical amplification curve; Positive control: FAM, ROX, and VIC channels have typical amplification curves and Ct values ≤32; The above requirements must be met at the same time in the same experiment before the test results of the samples to be tested can be analyzed, otherwise the experiment will be considered invalid.
[0060] 2) The interpretation of the test sample results is shown in Table 3.
[0061] Table 3 Interpretation criteria for PCR detection of J and K subgroup avian leukosis viruses
[0062] Note: When ALV-K and ALV-J of the samples to be tested (except egg white) are both negative, if the Ct of the VIC channel is > 34 or there is no typical amplification curve, it is recommended to retest. There is no or very little chicken gDNA in the egg white sample, so the internal standard is not required for quality control.
[0063] Example 2 Performance evaluation of the J and K subgroup avian leukosis virus detection kit 1. Sensitivity Using the kit and method constructed in Example 1, 4 replicate detection experiments were set for each concentration (10 copies / reaction, 5 copies / reaction, 3 copies / reaction, 1 copy / reaction) of positive J-type plasmid samples and positive K-type plasmid samples, and preliminary tests of the minimum detection limit were performed. The test results were: 10 copies / reaction and 5 copies / reaction were all detectable (4 / 4), 3 copies / reaction and 1 copy / reaction were detected 2 times (2 / 4) and 1 time (1 / 4), respectively.
[0064] According to the detection results of the above plasmid standards, for plasmids with 1000 copies / mL (i.e., 10 copies per reaction as mentioned above) and 500 copies / mL (i.e., 5 copies per reaction as mentioned above), 20 replicate wells (10 μL loading) were detected for each, and it was preliminarily confirmed that the sensitivity of this detection system could reach 1000 copies / mL (≥95% detection rate). Among them, the positive detection rate of the 500 copies / mL sample was 75% (15 / 20), and the results are as Figure 5 shown. Further, 20 detections were carried out under matrix conditions such as egg white, anal swab, and blood culture medium using reagents from different batches (one batch was a finished kit), and the detection rates were all 100% (20 / 20). Finally, it was confirmed that the detection sensitivity of this kit could reach 1000 copies / mL (≥95% detection rate), and the results are as Figure 6 shown.
[0065] 2. Specificity Using the kit and method constructed in Example 1, the purchased standards or clinical samples of ALV-A type, ALV-B type, and ALV-C type and chicken gDNA with different concentrations (the sequencing result was endogenous type E) were detected, and the results are as Figure 7 shown: all were negative.
[0066] 3. Repeatability Using the kit and method constructed in Example 1, the coefficient of variation (CV value) of the CT values of plasmids of type K and type J (4000 copies / mL) was <5%, and the results are shown in Table 4 and Figure 8 shown. It can be seen from Table 4 that our CV values were 1.52% and 1.90%, both less than 5% and with relatively low values, so the repeatability was good.
[0067] Table 4 Repeatability evaluation results of the PCR detection kit for avian leukosis virus of subgroups J and K
[0068] 4. Accuracy Using the kit and method constructed in Example 1, samples of subtypes K and J with different concentrations (6000 copies / μL, 600 copies / μL, 60 copies / μL, 6 copies / μL, 0.6 copies / μL) were detected, and the results are as Figure 9 shown. All could successfully detect the positive of subtype K or subtype J, indicating that the kit provided by the present invention has good accuracy when detecting avian leukosis virus of subgroups J and K.
[0069] Comparative Example 1 Change the primer set of subtype K to ALV-K-F2 / ALV-K-R2 / ALV-K-P2, change the primer set of subtype J to ALV-J-F / ALV-J-R / ALV-J-Pa and ALV-J-F / ALV-J-R / ALV-J-Pb. The primer sequences are shown in Table 5. Dilute the artificially synthesized single-stranded positive reference template to 6000 copies / μL, 600 copies / μL, 60 copies / μL, 6 copies / μL, and 0.6 copies / μL, and use Novoprotein P132 enzyme for amplification. Make up to 5μL of template, with the final concentration of primers and probes being 0.2μM, Novoprotein hot start Taq enzyme p132, and ddH2O. The amplification program is the same as that in Table 2.
[0070] The results are shown in Figure 10 , the amplification of the K subtype sample with 3 copies failed, and the sensitivity was poor; the fluorescence increment of the J subtype sample with 3 copies was relatively low.
[0071] Table 5
[0072] Comparative Example 2 Replace the preferred self-developed preservation solution with normal saline, self-developed preservation solution formula 2 (0.03% Tween 20, 0.04 mM guanidine hydrochloride, 0.3 g tRNA, 5 mM Tris-HCl, 0.2 mM EDTA), and self-developed preservation solution formula 3 (0.06% Tween 20, 0.03 mM guanidine hydrochloride, 0.2 μg tRNA, 10 mM Tris-HCl, 0.2 mM EDTA). The remaining steps are the same as those in Step 3 of Example 1. The experimental results are shown in Figure 11 , changing the components of the self-developed preservation solution / using a commercial preservation solution for treatment cannot directly complete the amplification with egg white samples as templates.
[0073] In summary, the multiplex PCR primer-probe set, kit, and method for detecting avian leukosis virus subgroups J and K of the present invention have good application effects and significant advantages in the detection and identification of ALV J type and K type.
[0074] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the protection scope of the present invention. Any simple modification or equivalent replacement of the technical solution of the present invention by those of ordinary skill in the art does not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A primer-probe set for detecting subgroup J and K avian leukosis virus, characterized in that, Comprising at least one of the following primer-probe sets: The first primer-probe set: primers with sequences as shown in SEQ ID NO.1-2 and a probe with a sequence as shown in SEQ ID NO.3; The second primer-probe set: primers with sequences as shown in SEQ ID NO.4-5 and probes with sequences as shown in SEQ ID NO.6-7.
2. The primer-probe set according to claim 1, characterized in that, It also includes a third primer-probe set for detecting an internal reference gene, and the internal reference gene is GAPDH.
3. The primer-probe set according to claim 2, wherein The third primer-probe set includes: primers with sequences as shown in SEQ ID NO.8-9 and a probe with a sequence as shown in SEQ ID NO.
10.
4. The primer-probe set according to any one of claims 1-3, characterized in that, The probe is attached with a fluorophore and a quencher.
5. The primer-probe set according to claim 4, wherein The fluorophore includes at least one of FAM, ROX, VIC or CY5 fluorophores, and the fluorophores of the probes in the first primer-probe set are different from those of the probes in the second primer-probe set; the quencher includes at least one of MGB, BHQ1, BHQ2 or TAMRA, and the quenchers of the probes in the first primer-probe set are different from those of the probes in the second primer-probe set.
6. Use of the primer-probe set according to any one of claims 1-5 in the preparation of a kit for detecting subgroup J and K avian leukosis virus.
7. A kit for detecting subgroup J and K avian leukosis virus, characterized in that, The kit includes the primer-probe set according to any one of claims 1-5.
8. The kit according to claim 7, wherein The kit also includes the following components: self-developed preservation solution, self-developed RT direct amplification Mix.
9. The kit according to claim 8, wherein The self-developed preservation solution includes the following components: 0.02-0.08% Tween 20, 0.01-0.05 mM guanidine hydrochloride, 0.2-0.6 μg tRNA, 5-15 mM Tris-HCl, 0.15-0.35 mM EDTA.
10. The kit according to claim 8, wherein The self-developed RT direct amplification Mix includes the following components: 100-200 mM Tris-HCl, 0.1-0.5 mM dNTPs, 300-400 mM KCl, 15-20 mM MgCl2, 10-20 mg / mL BSA, 0.1-0.5% Glycerol, 1.5-3.5% Trehalose, 0.3-0.8 U / μL hot start Taq enzyme, 0.3-0.9 U / μL reverse transcriptase.
11. Use of the primer-probe set according to any one of claims 1-5 or the kit according to any one of claims 7-10 in the detection of subgroup J and K avian leukosis virus.
Citation Information
Patent Citations
Fluorescent quantitative PCR (Polymerase Chain Reaction) primer combination for detecting exogenous avian leukosis virus and kit thereof
CN117821668A