Fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection primer probe combination, kit and detection method for porcine viral diarrhea

Abstract

The invention discloses a fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection primer and probe combination, a kit and a detection method for porcine viral diarrhea. Nucleotide sequences of detection primers are shown as SEQ ID NO.1-9, wherein the porcine viral diarrhea virus is porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA and porcine delta coronavirus PDCoV. The detection primer or kit provided by the invention has remarkable application value in rapid detection of the porcine diarrhea virus and epidemiological monitoring of the porcine diarrhea virus.

Description

Technical Field

[0001] The present invention belongs to the field of animal pathogen detection, and particularly relates to a primer-probe combination, a kit and a detection method for fluorescence quantitative RT-PCR detection of porcine viral diarrhea. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) belongs to the genus Alphacoronavirus of the family Coronaviridae. According to the differences in the viral S gene, global PEDV strains are divided into classical strains (G1 genotype) and variant strains (G2 genotype), and G2 is further divided into non-S-INDEL (G2a genotype) and S-INDEL (G2b genotype) subtypes. PEDV was first discovered in the UK in 1971. After 2010, variant strains broke out globally, causing the mortality rate of piglets to be as high as 80 - 100%. The virus is highly stable in the environment, and the virus excretion period can exceed 14 days. PEDV infection causes damage to intestinal epithelial cells, leading to watery diarrhea, vomiting, and dehydration, especially with a high fatality rate (100%) in neonatal piglets. Weaned piglets are prone to reinfection due to the disappearance of milk-derived antibodies, and adult pigs have milder symptoms. Porcine rotavirus group A (PoRVA) belongs to the genus Rotavirus of the family Reoviridae and is a segmented double-stranded RNA virus. The typing is based on the VP7 (G type) and VP4 (P type) genes, and common combinations such as G9P[7] etc. are found, and among them, G9P

[13] is the most common combination of G and P types. Rotavirus is widespread in pig herds, mainly infecting weaned piglets, and often co-infects with PEDV and PDCoV, with a co-infection rate of about 3.21%. Porcine deltacoronavirus (PDCoV) belongs to the genus Deltacoronavirus of the family Coronaviridae and is a newly discovered porcine intestinal pathogenic coronavirus in recent years, and is one of the members with the smallest genome among known coronaviruses. PDCoV mainly invades intestinal epithelial cells, resulting in villus atrophy, crypt hyperplasia, and intestinal mucosal barrier disruption. The clinical symptoms are manifested as acute watery diarrhea (yellow or grayish white), vomiting, and dehydration, and the mortality rate increases significantly when co-infected with PEDV.

[0003] The clinical symptoms caused by PEDV, PoRVA, and PDCoV infections in piglets are similar to those caused by PRV, PCV2, SFV, PRRSV, etc., making it difficult to quickly diagnose based on clinical symptoms. In the past five years, the above three frequently-occurring domestic viruses have been detected in fecal samples of piglets and adult pigs, and subclinical infections and co-infections occur from time to time. Moreover, the mutation rate of PEDV is relatively fast at present. Since the discovery of the mutant strain of PEDV in China in 2010, G1b, G2a, G2b, and S-INDEL genotype strains have emerged in less than 15 years. At present, the combined detection methods for PEDV, PoRVA, and PDCoV have relatively poor specificity compared with the present invention: the types of viruses with similar clinical symptoms are not fully covered, the accuracy has great limitations, and there is no mature commercial kit for the latest mutant strains to detect the three simultaneously. Therefore, it is particularly important to construct a simple and efficient fluorescence quantitative RT-PCR detection method for porcine viral diarrhea to provide support for the prevention and control of piglet diarrhea. Summary of the Invention

[0004] The first object of the present invention is to provide fluorescence PCR primers and probes for detecting porcine epidemic diarrhea virus (PEDV), porcine group A rotavirus (PoRVA), and porcine deltacoronavirus (PDCoV) respectively.

[0005] The second object of the present invention is to provide a triple fluorescence PCR detection kit for detecting and differentiating porcine epidemic diarrhea virus (PEDV), porcine group A rotavirus (PoRVA), and porcine deltacoronavirus (PDCoV).

[0006] The third object of the present invention is to provide a triple fluorescence PCR detection method for differentiating porcine epidemic diarrhea virus (PEDV), porcine group A rotavirus (PoRVA), and porcine deltacoronavirus (PDCoV).

[0007] Compared with single fluorescence quantitative PCR, through primer design and adjustment of each component of PCR, the present invention realizes the purpose of simultaneously detecting and differentiating porcine epidemic diarrhea virus (PEDV), porcine group A rotavirus (PoRVA), and porcine deltacoronavirus (PDCoV) in one analysis without reducing the sensitivity and specificity. To a certain extent, it reduces the workload and cost of detection, and greatly reduces the time required for detection, thus winning precious time for the prevention and control of diseases; To achieve the above object, the technical solution adopted by the present invention is as follows: A primer-probe combination for fluorescence quantitative RT-PCR detection of swine viral diarrhea, targeting the N gene of porcine epidemic diarrhea virus (PEDV), the NSP3 genome of porcine group A rotavirus (PoRVA), and the ORF1ab gene of porcine delta coronavirus (PDCoV). Primers and probes that can cover most strains and are suitable for triple fluorescence quantitative PCR are designed and screened, including three pairs of specific primers and three specific probes. The sequences of the primers and probes are as follows: Porcine epidemic diarrhea virus: Forward primer 20210721F1 (SEQ ID No.1): 5'-GGACCAGCAAATTGGATACTGG-3' Reverse primer 20210721R1 (SEQ ID No.2): 5'-GTAGTAGAAATGCCAATTGGAAGGTT-3' Probe 20210721P1-FAM (SEQ ID NO.3): 5'-(6-FAM)CGCATGCGCCGTGG(TAMRA-N)-3' Porcine group A rotavirus Forward primer 411013-2F5 (SEQ ID No.4): 5'-TTAACCATCTACACATGACCCTCTA-3' Reverse primer 411013-2R5 (SEQ ID No.5): 5'-GCCATTTAGGTTTTTGACAGTGTT-3' Probe 411013-2P5-ROX (SEQ ID No.6): 5'-(ROX)AGCACAATAGTTAAAAGC(BHQ2)-3' Porcine delta coronavirus Forward primer 20210125F4 (SEQ ID No.7): 5'-GCTTACCACGGACTCTTTTGATG-3' Reverse primer 20210125R4 (SEQ ID No.8): 5'-CAGGAGTTCTTGTACATTAGGGTCAGA-3' Probe 20210125P4-CY5 (SEQ ID No.9): 5'-(CY5)CCTGCATCTTGCATGTAGTGCCACCC(BHQ2)-3' The probe 20210721P1-FAM, the probe 411013-2P5-ROX, and the probe 20210125P4-CY5 are respectively labeled with different fluorescent reporter groups at the 5' end. The probe 411013-2P5-ROX and the probe 20210125P4-CY5 are both labeled with the same fluorescent quenching group at the 3' end, while the probe 20210721P1-FAM is labeled with different fluorescent quenching groups at the 3' end.

[0008] Furthermore, the fluorescent reporter group is FAM, ROX, or CY5, and the fluorescent quenching group is TAMRA-N or BHQ2.

[0009] Furthermore, the probe 20210721P1-FAM is labeled with FAM at the 5' end and TAMRA-N at the 3' end; the probe 411013-2P5-ROX is labeled with ROX at the 5' end and BHQ2 at the 3' end; the probe 20210125P4-CY5 is labeled with CY5 at the 5' end and BHQ2 at the 3' end.

[0010] A fluorescence quantitative RT-PCR detection kit for porcine viral diarrhea, comprising three pairs of specific primers and three specific probes.

[0011] Furthermore, the kit also includes an enzyme, a positive control, and a negative control.

[0012] Furthermore, the enzyme is 25×FastKing Enzyme, the positive control is an in vitro recombinant plasmid of the gene synthesis fragments of porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA, and porcine delta coronavirus PDCoV; the negative control is DEPC-treated water.

[0013] A fluorescence quantitative RT-PCR detection method for porcine viral diarrhea, characterized by comprising the following steps: Step 1: Extract the DNA of the sample to be tested; Step 2: Using the DNA template in Step 1, perform triple fluorescence quantitative PCR amplification with the kit described in Claim 4; Step 3: Analyze the PCR amplification product, and determine whether the sample to be tested contains porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA, and porcine delta coronavirus PDCoV according to the amplification reaction result.

[0014] Further, in step two, the total volume of the fluorescence quantitative RT-PCR reaction for viral diarrhea is 25 μL, and the porcine diarrhea viruses therein are porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA, and porcine delta coronavirus PDCoV. The optimal final concentrations of the upstream primer 20210721F1 and the downstream primer 20210721R1 of the N gene of PEDV are both 0.2 μmol / L, and the optimal final concentration of the probe 20210721P1-FAM is 0.1 μmol / L; the optimal final concentrations of the upstream primer 411013-2F5 and the downstream primer 411013-2R5 of the NSP3 gene of PoRVA are both 0.2 μmol / L, and the optimal final concentration of the probe 411013-2P5-ROX is 0.1 μmol / L; the optimal final concentrations of the upstream primer 20210125F4 and the downstream primer 20210125R4 of the ORF1ab gene of PDCoV are both 0.2 μmol / L, and the optimal final concentration of the probe 20210125P4-CY5 is 0.1 μmol / L.

[0015] Further, in step two, the reaction program for triple fluorescence quantitative PCR amplification is: 50 °C for 15 min, 1 cycle; 95 °C for 2 min, 1 cycle; 95 °C for 15 s, 60 °C for 30 s, 40 cycles.

[0016] Good coverage and universality: The primers and probes involved in the present invention are respectively designed for the most conserved genes of porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA, and porcine delta coronavirus PDCoV, covering the sequences of the vast majority of strains of these viruses in Genebank. In addition, the amplification conditions formed by the primers and probes of the present invention are the same as those of several other important porcine infectious diseases, and experiments can be carried out simultaneously on the same platform with other diseases, with strong universality, which is conducive to the simultaneous diagnosis of multiple pathogenic microorganisms. At the same time, the PEDV project in this study has a good detection level for the variant strains collected this time, reducing the missed detection of PEDV to a certain extent, and the detection method for variant strains has been updated and optimized in real time. This is the main innovation point of the present invention.

[0017] High efficiency and economy: Three viruses are detected simultaneously in a single reaction, saving time, reagents, and sample volume, and having good detection rates for PEDV, PoRVA, and PDCoV strains, and can detect different strong and weak positive strains of the three.

[0018] Strong compatibility: It can be adapted to a variety of sample types (feces, intestinal tissue, anal swabs, etc.).

[0019] High sensitivity, specificity, and repeatability: Such as Figure 4, three batches of triple fluorescence RT-PCR detection kits for porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine deltacoronavirus produced in small-scale trials were used to perform 20 repeated detections on samples of porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine deltacoronavirus diluted at gradients of 10-3 to 10-5. The results showed that at a 95% confidence level, the lowest detection limit of porcine epidemic diarrhea virus was 10 -0.88 TCID 50 / 0.1 ml. The lowest detection limit of porcine group A rotavirus was 10 -0.50 TCID 50 / 0.1 ml. The lowest detection limit of porcine group A rotavirus was 10 -0.20 TCID 50 / 0.1 ml. The positive detection rates of three batches of triple fluorescence RT-PCR detection kits for porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine deltacoronavirus produced in small-scale trials for known porcine epidemic diarrhea virus nucleic acid positive samples, porcine rotavirus nucleic acid positive samples, and porcine deltacoronavirus positive samples were all 100%. The detection rates for virus solutions of different genotypes of porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine deltacoronavirus were all 100%. There was no non-specific reaction with porcine pseudorabies virus, porcine parvovirus, porcine circovirus type 2 virus, classical swine fever virus, porcine reproductive and respiratory syndrome virus, transmissible gastroenteritis virus of swine, and the host genes. The stability was good between the same batch and within different batches, and the coefficient of variation was below 4%; the positive detection rate reached 100%. Description of the Drawings

[0020] Figure 1 These are the specific amplification curves of porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine deltacoronavirus in the present invention. Among them, 1 is the amplification curve of the positive control of porcine epidemic diarrhea virus, 2 is the amplification curve of the positive control of porcine group A rotavirus, 3 is the amplification curve of the positive control of porcine deltacoronavirus, and 15 - 24 are the amplification curves of the negative control, porcine reproductive and respiratory syndrome virus, porcine pseudorabies virus, porcine parvovirus, classical swine fever virus, porcine epidemic diarrhea virus + transmissible gastroenteritis virus of swine. The amplification curves of porcine pseudorabies, porcine parvovirus, porcine circovirus, classical swine fever, porcine reproductive and respiratory syndrome, transmissible gastroenteritis virus of swine, nucleic acid extracted from SPF pig fecal samples, nucleic acid extracted from SPF pig anal swabs, and nucleic acid extracted from SPF pig small intestine tissue samples, and 4 - 14 are the amplification curves of the samples of 15 - 24 plus the non-competitive internal standard.

[0021] Figure 2 This is the amplification curve of porcine epidemic diarrhea virus in the present invention.

[0022] Figure 3 This is the amplification curve of porcine group A rotavirus in the present invention.

[0023] Figure 4 This is the amplification curve of porcine deltacoronavirus in the present invention.

[0024] Figure 5 This is the optimization result of the annealing temperature of triple RT-PCR for three viruses.

[0025] Figure 6 、 7 Points 8 are the sensitivity test results of triple RT-PCR for porcine epidemic diarrhea virus, group A rotavirus of pigs, and porcine deltacoronavirus.

[0026] Figure 9 This is part of the test results of the triple RT-PCR detection primer pair for clinical samples. Specific implementation mode

[0027] The technical solution of the present invention will be further described below in conjunction with the accompanying drawings and examples, but it is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention shall be covered within the protection scope of the present invention. In the following examples, unless otherwise specified, all are conventional methods, and the test materials used are all conventional biochemical reagents unless otherwise specified. Example

[0028] Establishment of a triple fluorescence PCR detection method for detecting and differentiating porcine epidemic diarrhea virus PEDV, group A rotavirus of pigs PoRVA, and porcine deltacoronavirus PDCoV.

[0029] 1. Design and synthesis of primers and probes.

[0030] On the basis of NCBI sequence alignment analysis, for the highly conserved regions of the N gene of PEDV, the NSP3 genome of PoRVA, and the ORF1ab gene of PDCoV, primers and probes that can cover most strains and are suitable for triple detection are designed and screened respectively, including three pairs of specific primers and three specific probes. The sequences of the primers and probes are as follows: Porcine epidemic diarrhea virus: Forward primer 20210721F1 (SEQ ID No.1): 5'-GGACCAGCAAATTGGATACTGG-3' Reverse primer 20210721R1 (SEQ ID No.2): 5'-GTAGTAGAAATGCCAATTGGAAGGTT-3' Probe 20210721P1-FAM (SEQ ID NO.3): 5'-(6-FAM)CGCATGCGCCGTGG(TAMRA-N)-3' The probe is labeled with FAM at the 5' end and TAMRA-N at the 3' end.

[0031] Group A rotavirus of swine Upstream primer 411013-2F5 (SEQ ID No.4): 5'-TTAACCATCTACACATGACCCTCTA-3' Downstream primer 411013-2R5 (SEQ ID No.5): 5'-GCCATTTAGGTTTTTGACAGTGTT-3' Probe 411013-2P5-ROX (SEQ ID No.6): 5'-(ROX)AGCACAATAGTTAAAAGC(BHQ2)-3' The probe is labeled with ROX at the 5' end and BHQ2 at the 3' end.

[0032] Swine deltacoronavirus Upstream primer 20210125F4 (SEQ ID No.7): 5'-GCTTACCACGGACTCTTTTGATG-3' Downstream primer 20210125R4 (SEQ ID No.8): 5'-CAGGAGTTCTTGTACATTAGGGTCAGA-3' Probe 20210125P4-CY5 (SEQ ID No.9): 5'-(CY5)CCTGCATCTTGCATGTAGTGCCACCC(BHQ2)-3' The probe is labeled with CY5 at the 5' end and BHQ2 at the 3' end.

[0033] 2. Establishment of the internal standard plasmid system: A random DNA sequence was artificially designed, and corresponding internal standard primers and probes were designed based on the designed random DNA sequence. According to the designed internal standard fragment sequence, DNA fragments were synthesized on a fully automatic DNA synthesizer. After the synthesized internal standard fragments were ligated to the pUC57 vector, they were transformed into TOP10 competent cells. After picking monoclonal colonies and identification, Escherichia coli TOP10 (pUC57-IC-G) was constructed. After expanding Escherichia coli TOP10 (pUC57-IC-G), plasmids were extracted to obtain the recombinant plasmid pUC57-IC-G containing the internal standard fragment. The internal standard plasmid pUC57-IC-G (4 μg / tube) was dissolved in 40 μl of 1×TE buffer with a mass concentration of 100 ng / μl. According to the mass concentration of the internal standard plasmid pUC57-IC-G and the plasmid size (2777 bp), the plasmid copy number concentration was converted to 3.28×10 10 copies / μl. The internal standard plasmid pUC57-IC-G was serially diluted 10-fold ten times with 1×TE buffer. Using the designed internal standard primer and probe combination, the 10 -4 ~10 -10 -fold diluted samples of the internal standard plasmid pUC57-IC-G (i.e., 3.28×10 6 ~10 0 copies / μl) were tested in triplicate. At the same time, DEPC-treated water was set as a negative control. The internal standard primers and probes amplified well and there was no non-specific amplification for the PEDV, GARV, and PDCoV targets. The amounts of the internal standard primers and probes were optimized, and the amounts of the internal standard primers and probes in the system were determined to be 0.1 μM / 0.1 μM / 0.05 μM.

[0034] 3. Optimization of the fluorescence quantitative RT-PCR reaction system and amplification conditions; The primer and probe concentrations determined in the first step were diluted to 50 μmol / L with sterile water, and the addition amounts of 0.1 μL, 0.2 μL, 0.25 μL, and 0.4 μL were screened respectively.

[0035] Using the FastKing one-step reverse transcription-fluorescence quantitative kit (probe method), fluorescence PCR matrix screening tests were performed on the primers and labeled probes with different addition amount combinations on a Tianlong fluorescence quantitative PCR instrument. Taking the minimum Ct value, higher relative fluorescence intensity value (RFU), and typical S-shaped amplification curve as the comprehensive judgment basis, the optimal addition amounts of the upstream and downstream primers for detecting the N gene of PEDV, the NSP3 genome of PoRVA, and the ORF1ab gene of PDCoV were finally determined to be 0.2 μL each, and the optimal addition amount of the probe was 0.1 μL; the optimal addition amounts of the upstream and downstream primers for the NSP3 genome of PoRVA were 0.2 μL each, and the optimal addition amount of the probe was 0.1 μL; the optimal addition amounts of the upstream and downstream primers for the ORF1ab gene of PDCoV were 0.2 μL each, and the optimal addition amount of the probe was 0.1 μL.

[0036] Under the conditions of the optimal primer and probe addition amounts, enzyme addition amount, and the general fluorescence PCR reaction amplification reagents, a screening test was carried out for the annealing and extension temperature in the range of 58°C - 62°C. Finally, the annealing and extension temperature was determined to be 60°C. A screening test was also carried out for the reverse transcription time among 10 min, 15 min, and 30 min, and finally the reverse transcription time was determined to be 15 min.

[0037] In the optimized 25 μL PCR reaction system, the upstream and downstream primers and probes for porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine deltacoronavirus were all diluted to 50 μmol / L. The triple RT-PCR reaction system was 25 μL: 2×FastKing One Step Probe RT-qPCR Mix 12.5 μL, template 5 μL, 25×FastKing Enzyme Mix 1 μL, upstream and downstream primers (50 μmol / L) 0.03 - 0.1 μL each, probe (50 μmol / L) 0.1 μL, and made up to 25 μL with RNase-Free ddH2O. The optimized PCR amplification conditions were: 50°C for 15 min, 1 cycle; 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles.

[0038] Result determination Quality control standard: The positive control shows a specific S-shaped amplification curve, and the Ct value is around 20 - 25; the negative control has no amplification curve and no Ct value.

[0039] If this condition is met, the test result is determined to be valid.

[0040] Result determination: On the premise that the Ct value in the HEX channel ≤ 35 and there is a typical amplification curve, if the Ct value in the FAM channel ≤ 35 and there is a typical amplification curve, it is determined to be positive for porcine epidemic diarrhea virus nucleic acid; If the Ct value in the FAM channel > 35 or there is no Ct value, it is determined to be negative for porcine epidemic diarrhea virus nucleic acid; If the Ct value in the ROX channel ≤ 35 and there is a typical amplification curve, it is determined to be positive for porcine group A rotavirus nucleic acid; If the Ct value in the ROX channel > 35 or there is no Ct value, it is determined to be negative for porcine group A rotavirus nucleic acid; If the Ct value in the CY5 channel ≤ 35 and there is a typical amplification curve, it is determined to be positive for porcine deltacoronavirus nucleic acid; If the Ct value in the CY5 channel > 35 or there is no Ct value, it is determined to be negative for porcine deltacoronavirus nucleic acid.

[0041] If the Ct value of the HEX channel is > 35 or there is no Ct value, the result is invalid. The reason should be found and excluded, and this sample should be retested.

[0042] 4. Fluorescent quantitative RT-PCR specificity test: The inactivated vaccine of Porcine circovirus type 2 (LG strain), live vaccine of Classical swine fever (cell-derived), live vaccine of Porcine reproductive and respiratory syndrome (CH-1R strain), inactivated vaccine of Pseudorabies, inactivated vaccine of Porcine parvovirus (WH-1 strain), and RNA standard of Transmissible gastroenteritis virus of swine are all commercially available vaccines and products purchased. The nucleic acid extraction of the above vaccines was carried out according to the instructions of the commercial kit.

[0043] Positive samples of Porcine epidemic diarrhea virus, Porcine rotavirus, and Porcine delta coronavirus were all collected by Hunan Guanmu Biotechnology Co., Ltd. and were respectively identified as positive for Porcine epidemic diarrhea virus, Porcine rotavirus, and Porcine delta coronavirus alone by the multiplex RT-PCR detection method for Transmissible gastroenteritis virus of swine, Porcine epidemic diarrhea virus, and Porcine rotavirus (GB_T 36871-2018) and the fluorescent RT-PCR method in the quarantine technical specification for Porcine delta coronavirus (SN / T5124-2019). SPF pig feces, SPF pig anal swabs, and SPF pig small intestine tissue samples were collected from the Experimental Animal Center of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0044] Fluorescent PCR amplification was carried out with the optimal reaction system and amplification conditions determined in the third step. The results showed that specific amplification curves appeared for the positive controls of Porcine epidemic diarrhea virus, Porcine rotavirus, and Porcine delta coronavirus; no specific amplification curves appeared for Porcine circovirus, Porcine reproductive and respiratory syndrome virus, Pseudorabies virus, Porcine parvovirus, Classical swine fever virus, Transmissible gastroenteritis virus of swine, and the negative control. The experimental results are shown in Figure 1 。

[0045] 5. Fluorescent quantitative RT-PCR sensitivity test: The sensitive quality control samples P1 (nucleic acid of Porcine epidemic diarrhea virus HLJ2020), P2 (nucleic acid of Porcine group A rotavirus DQ19 strain), and P3 (nucleic acid of Porcine delta coronavirus BY2019 strain) were serially diluted 5 times by 10-fold with DEPC-treated water to obtain the serially diluted samples P1×10 -1 ~P1×10 -5 ,P2×10 -1 ~P2×10 -5 ,P3×10 -1 ~P3×10 -5 。

[0046] For P1×10-3 ~P1×10 -5 , P2×10 -3 ~P2×10 -5 , P3×10 -3 ~P3×10 -5 Three batches of porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine delta coronavirus triple fluorescence RT-PCR detection kits produced in pilot tests were used to perform 20 repeated tests according to the established method. The minimum detection limit for porcine epidemic diarrhea virus was 10 -0.88 TCID 50 / 0.1ml, the minimum detection limit for porcine group A rotavirus is 10 -0.50 TCID 50 / 0.1ml, the minimum detection limit for porcine group A rotavirus is 10 -0.20 TCID 50 / 0.1ml, the kinetic curve of fluorescence PCR amplification is shown in Figure 6 , 7 , 8; Fluorescence quantitative RT-PCR repeatability test: According to the detection results of the multiplex RT-PCR method for transmissible gastroenteritis virus, porcine epidemic diarrhea virus and porcine rotavirus (GB_T 36871-2018) combined with nested PCR and sequencing, and the fluorescence RT-PCR method in the Technical Specification for Quarantine of Porcine Delta Coronavirus (SN / T 5124-2019), samples with a gray value ratio of the target band in the sample to the target band in the positive control ≥ 1 are regarded as strongly positive samples, samples with a gray value ratio < 1 are regarded as moderately positive samples, and samples without a target band whose amplification products need to be detected as positive by nested PCR and sequencing are regarded as weakly positive samples; for samples with a positive nucleic acid test result for porcine epidemic diarrhea virus alone, 1 strongly positive sample, 1 moderately positive sample, and 1 weakly positive sample are selected; for samples with a positive nucleic acid test result for porcine rotavirus alone, 1 strongly positive sample, 1 moderately positive sample, and 1 weakly positive sample are selected. For samples with a positive nucleic acid test result for porcine delta coronavirus alone, 1 sample with a FAM channel Ct value ≤ 20 is selected as a strongly positive sample, 1 sample with a FAM channel 20 < Ct value ≤ 25 is selected as a moderately positive sample, and 1 sample with a FAM channel 25 < Ct value ≤ 30 is selected as a weakly positive sample. At the same time, 1 sample each of pig feces, anal swabs, and small intestine tissues that are negative for porcine epidemic diarrhea virus, porcine rotavirus, and porcine delta coronavirus nucleic acids are selected. Then, a total of 9 samples, including strongly positive, moderately positive, and weakly positive samples of porcine epidemic diarrhea virus nucleic acid, strongly positive, moderately positive, and weakly positive samples of porcine rotavirus nucleic acid, and strongly positive, moderately positive, and weakly positive samples of porcine delta coronavirus nucleic acid, and a total of 3 samples of pig feces, anal swabs, and small intestine tissues that are negative for porcine epidemic diarrhea virus, porcine rotavirus, and porcine delta coronavirus nucleic acids are selected.

[0047] At the same time, from 3 batches of triple fluorescence RT-PCR detection kits for porcine epidemic diarrhea virus, group A rotavirus of pigs, and porcine delta coronavirus, 10 kits are randomly selected from each batch for the 13 samples described above. Each sample is tested with 5 kits, and there are 5 replicates in each kit. Among them, kits 1-5 of batch 2022001 are used to complete the repeatability test of samples LC5, XF7, MG9, MF12, LG11, XC6, LF1, MG15, MC16, JF1, and kits 6-10 are used to complete the repeatability test of samples JG1, JC1; kits 1-5 of batch 2022002 and batch 2022003 are used to complete the repeatability test of samples LC5, XF7, MG9, MF12, LG11, XC6, LF1, MG15, MC16, and kits 6-10 are used to complete the repeatability test of samples JF1, JG1, JC1.

[0048] The detection results showed that the within - batch and between - batch coefficients of variation of the Ct values of the triple - fluorescence RT - PCR detection kit for porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine delta - coronavirus in amplifying the genes of porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine delta - coronavirus were both <4%, indicating that the triple - fluorescence RT - PCR detection kit for porcine epidemic diarrhea virus, porcine group A rotavirus, and porcine delta - coronavirus had good repeatability.

[0049] Fluorescence quantitative RT - PCR compliance test Thirty samples collected from pig farms negative for porcine epidemic diarrhea virus, porcine rotavirus, and porcine delta - coronavirus, including pig feces, anal swabs, and small intestine tissue samples, were subjected to nucleic acid extraction using a virus DNA and RNA co - extraction kit. Thirty samples confirmed to be negative for porcine epidemic diarrhea virus, porcine rotavirus, and porcine delta - coronavirus nucleic acids by the multiplex RT - PCR detection method for porcine transmissible gastroenteritis virus, porcine epidemic diarrhea virus, and porcine rotavirus (GB_T36871 - 2018) combined with nested PCR and sequencing, and the fluorescence RT - PCR method in the technical specification for the quarantine of porcine delta - coronavirus (SN / T 5124 - 2019) were detected using 3 batches of the triple - fluorescence RT - PCR detection kit for porcine epidemic diarrhea virus, porcine rotavirus, and porcine delta - coronavirus produced in small - scale production. The results showed that all samples were negative for porcine epidemic diarrhea virus, porcine rotavirus, and porcine delta - coronavirus nucleic acids, without non - specific amplification, and the negative coincidence rate was 100%.

[0050] The above - mentioned embodiments of the present invention are only examples for clearly explaining the present invention, rather than limitations on the implementation manners of the present invention. For those skilled in the art, based on the above description, other different forms of changes or variations can be made. It is impossible to list all the implementation manners here. Any obvious changes or variations derived from the technical solutions of the present invention still fall within the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting porcine viral diarrhea by fluorescence quantitative RT-PCR, characterized in that, The nucleotide sequences of the detection primers are shown in SEQ ID NO.1 to 9. Among them, the porcine diarrhea viruses are porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA, and porcine delta coronavirus PDCoV. Three groups of primers and probes with conserved sequences and high specificity are designed respectively for the N gene of porcine epidemic diarrhea virus PEDV, the NSP3 genome of porcine group A rotavirus PoRVA, and the ORF1ab gene of porcine delta coronavirus PDCoV. The sequences are as follows: Porcine epidemic diarrhea virus: Forward primer 20210721F1 (SEQ ID No.1): 5'-GGACCAGCAAATTGGATACTGG-3' Reverse primer 20210721R1 (SEQ ID No.2): 5'-GTAGTAGAAATGCCAATTGGAAGGTT-3' Probe 20210721P1-FAM (SEQ ID NO.3): 5'-(6-FAM)CGCATGCGCCGTGG(TAMRA-N)-3' Porcine group A rotavirus Forward primer 411013-2F5 (SEQ ID No.4): 5'-TTAACCATCTACACATGACCCTCTA-3' Reverse primer 411013-2R5 (SEQ ID No.5): 5'-GCCATTTAGGTTTTTGACAGTGTT-3' Probe 411013-2P5-ROX (SEQ ID No.6): 5'-(ROX)AGCACAATAGTTAAAAGC(BHQ2)-3' Porcine delta coronavirus Forward primer 20210125F4 (SEQ ID No.7): 5'-GCTTACCACGGACTCTTTTGATG-3' Reverse primer 20210125R4 (SEQ ID No.8): 5'-CAGGAGTTCTTGTACATTAGGGTCAGA-3' Probe 20210125P4-CY5 (SEQ ID No.9): 5'-(CY5)CCTGCATCTTGCATGTAGTGCCACCC(BHQ2)-3' The probes 20210721P1-FAM, 411013-2P5-ROX, and 20210125P4-CY5 are respectively labeled with different fluorescent reporter groups at the 5' end. The probes 411013-2P5-ROX and 20210125P4-CY5 are both labeled with the same fluorescent quenching group at the 3' end, while the probe 20210721P1-FAM is labeled with different fluorescent quenching groups at the 3' end.

2. The primer-probe combination for detecting porcine viral diarrhea by fluorescence quantitative RT-PCR according to claim 1, characterized in that: The fluorescent reporter groups are FAM, ROX or CY5, and the fluorescent quenching groups are TAMRA-N or BHQ2.

3. A primer-probe combination for detecting swine viral diarrhea by fluorescence quantitative RT-PCR according to claim 1 or 2, characterized in that: The probe 20210721P1-FAM is labeled with FAM at the 5'-end and TAMRA-N at the 3'-end; the probe 411013-2P5-ROX is labeled with ROX at the 5'-end and BHQ2 at the 3'-end; the probe 20210125P4-CY5 is labeled with CY5 at the 5'-end and BHQ2 at the 3'-end.

4. A fluorescence quantitative RT-PCR detection kit for porcine viral diarrhea, characterized in that, The kit contains three pairs of specific primers and three specific probes as described in claim 1 or 2 or 3.

5. A fluorescence quantitative RT-PCR detection kit for porcine viral diarrhea according to claim 4, characterized in that: The kit further includes an enzyme, a positive control and a negative control.

6. The fluorescence quantitative RT-PCR detection kit for porcine viral diarrhea according to claim 5, wherein: The enzyme is 25×FastKing Enzyme, and this reverse transcription kit is purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; the positive control is an in vitro recombinant plasmid of the gene synthesis fragments of porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA, and porcine deltacoronavirus PDCoV; the negative control is DEPC-treated water.

7. A fluorescence quantitative RT-PCR detection method for porcine viral diarrhea, characterized in that, It includes the following steps: Step 1: Extract the DNA of the sample to be tested. Step 2: Using the DNA template described in Step 1, perform triple fluorescence PCR amplification with the kit described in claim 4. Step 3: Analyze the PCR amplification product, and determine whether the sample to be tested contains porcine epidemic diarrhea virus PEDV, porcine group A rotavirus PoRVA, and porcine deltacoronavirus PDCoV according to the amplification reaction result.

8. A fluorescence quantitative RT-PCR detection method for porcine viral diarrhea according to claim 7, characterized in that: In Step 2, the optimal final concentrations of the upstream primer 20210721F1 and the downstream primer 20210721R1 of the N gene of porcine epidemic diarrhea virus PEDV are both 0.2 μmol / L, and the optimal final concentration of the probe 20210721P1-FAM is 0.1 μmol / L; the optimal final concentrations of the upstream primer 411013-2F5 and the downstream primer 411013-2R5 of the NSP3 gene of porcine group A rotavirus PoRVA are both 0.2 μmol / L, and the optimal final concentration of the probe 411013-2P5-ROX is 0.1 μmol / L; the optimal final concentrations of the upstream primer 20210125F4 and the downstream primer 20210125R4 of the ORF1ab gene of porcine deltacoronavirus PDCoV are both 0.2 μmol / L, and the optimal final concentration of the probe 20210125P4-CY5 is 0.1 μmol / L.

9. The fluorescence quantitative RT-PCR detection method for porcine viral diarrhea according to claim 7, wherein: In Step 2, the reaction program of the double fluorescence PCR amplification is: 50°C for 15 min, 1 cycle; 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles.

Images